ID: 1140504823

View in Genome Browser
Species Human (GRCh38)
Location 16:75464608-75464630
Sequence CCATTCACCACAGAGAAATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504815_1140504823 4 Left 1140504815 16:75464581-75464603 CCGCTCCCCTCGCGCTCCATCCC 0: 1
1: 0
2: 7
3: 109
4: 1146
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504811_1140504823 17 Left 1140504811 16:75464568-75464590 CCCGCCGCTGCCGCCGCTCCCCT 0: 1
1: 0
2: 13
3: 92
4: 720
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504818_1140504823 -3 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504814_1140504823 7 Left 1140504814 16:75464578-75464600 CCGCCGCTCCCCTCGCGCTCCAT 0: 1
1: 0
2: 0
3: 17
4: 252
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504813_1140504823 13 Left 1140504813 16:75464572-75464594 CCGCTGCCGCCGCTCCCCTCGCG 0: 1
1: 0
2: 9
3: 40
4: 431
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504816_1140504823 -1 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504812_1140504823 16 Left 1140504812 16:75464569-75464591 CCGCCGCTGCCGCCGCTCCCCTC 0: 1
1: 1
2: 15
3: 190
4: 1389
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504817_1140504823 -2 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504808_1140504823 26 Left 1140504808 16:75464559-75464581 CCCGGCCGACCCGCCGCTGCCGC 0: 1
1: 0
2: 6
3: 60
4: 424
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504809_1140504823 25 Left 1140504809 16:75464560-75464582 CCGGCCGACCCGCCGCTGCCGCC 0: 1
1: 1
2: 6
3: 77
4: 600
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504810_1140504823 21 Left 1140504810 16:75464564-75464586 CCGACCCGCCGCTGCCGCCGCTC 0: 1
1: 0
2: 7
3: 66
4: 546
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504823 Original CRISPR CCATTCACCACAGAGAAATG AGG Exonic
901257382 1:7841880-7841902 CCTTTCACCACTTAGTAATGGGG + Intronic
902548554 1:17205702-17205724 CCCTTCACCTCAAAGAGATGGGG - Intronic
903136143 1:21310502-21310524 CCATGCACCACAAGGAATTGGGG + Intronic
903403885 1:23080232-23080254 CCATTCACCACTGGGCAGTGAGG - Intronic
904909927 1:33927151-33927173 CCATTCACCACAAGAAAAGGGGG - Intronic
906924940 1:50105305-50105327 ACAATCAACACAGAGCAATGGGG - Intronic
908292704 1:62684479-62684501 GCATATACCACAGAAAAATGGGG - Intronic
908466746 1:64403477-64403499 CCATTAATCACAGGGGAATGTGG - Intergenic
909290997 1:73883047-73883069 CCATTCACCACAGAGTCATGAGG + Intergenic
909695341 1:78462241-78462263 CCACTGACCCCACAGAAATGGGG - Intronic
917601142 1:176575147-176575169 CCATTGACCTCAGATAAATCTGG - Intronic
921274785 1:213508431-213508453 CAATTCAGCACAGAAAAAAGTGG + Intergenic
921612594 1:217230154-217230176 CCTTTCACCCCAGAGATATTTGG - Intergenic
923713741 1:236407373-236407395 CCAGTCACTGAAGAGAAATGGGG - Intronic
924901023 1:248399632-248399654 CTCTTCCTCACAGAGAAATGTGG - Intergenic
1063193086 10:3716492-3716514 TCACTCATCTCAGAGAAATGAGG + Intergenic
1065376418 10:25048042-25048064 CTCTACACCACAGAGAAAAGTGG + Intronic
1065890323 10:30115844-30115866 CCTTTCTCCACAGAGAAAGGGGG + Intergenic
1066285541 10:33962575-33962597 CTATTCTCCAAAGAGAAAAGAGG + Intergenic
1066664664 10:37770691-37770713 CCATTCAGGACACAGACATGGGG + Intergenic
1067530043 10:47063846-47063868 CCATTTGCCACAGAGAAAAGGGG - Intergenic
1068972921 10:62978024-62978046 ACATACAACACAGAGAAATGAGG + Intergenic
1069258142 10:66360390-66360412 CTATTTCCCACAGAAAAATGGGG - Intronic
1071165552 10:82802218-82802240 TCATTCACGACAGAGAGAGGAGG + Intronic
1073770366 10:106728859-106728881 ACAATTACCACAGAGCAATGAGG - Intronic
1074424175 10:113336504-113336526 CCATTCAAAGCAGAAAAATGAGG - Intergenic
1074686082 10:115963646-115963668 CCAGACATCACAGAGTAATGGGG - Intergenic
1075845839 10:125544520-125544542 CAGTTCACCCCAGAGAGATGTGG + Intergenic
1076241094 10:128908294-128908316 CCATTCAGCACAGGAAACTGAGG + Intergenic
1077058853 11:609023-609045 CCATTCCCCAGAGAGGAAGGGGG + Exonic
1078265658 11:9754658-9754680 CCACTCATTTCAGAGAAATGAGG + Intergenic
1078423139 11:11228647-11228669 CCAGTCACCACCGTGACATGCGG - Intergenic
1079698817 11:23518778-23518800 CCAATTCCCAAAGAGAAATGGGG - Intergenic
1083446130 11:62709002-62709024 CCAAGCACCCCAGAGATATGAGG + Exonic
1084597391 11:70125039-70125061 CAAGGCACCACAGAGAAGTGGGG + Intronic
1087744674 11:101929859-101929881 CCAAACACCACAGAAAATTGTGG - Intronic
1089938618 11:122392039-122392061 ACAGTCACCACAGAGTAAGGTGG - Intergenic
1091469970 12:718111-718133 CCATTCACAAAAGGAAAATGTGG + Intergenic
1091687967 12:2577121-2577143 CCATTCAACAGAGAGAAAGATGG - Intronic
1092582010 12:9852044-9852066 AGATTCACCAGGGAGAAATGAGG + Intergenic
1093020885 12:14202802-14202824 CCAGGCACCACAGAGAAAAGTGG - Intergenic
1095461850 12:42452361-42452383 CCAGTCACCACAGAACACTGAGG - Intronic
1096683756 12:53274315-53274337 CCATTCATCACAGCGAAGTCAGG - Intronic
1098255031 12:68607894-68607916 CTATGCACAACAGAGAGATGGGG + Intergenic
1101654543 12:106708466-106708488 TCAGTGACCAGAGAGAAATGGGG + Intronic
1102957032 12:117065438-117065460 CCGTTCACCACAGAGGAACGGGG + Intronic
1104653931 12:130559148-130559170 CTTCTCACCACAGAGAAATAAGG - Intronic
1105837160 13:24222141-24222163 CCATACAGCAGAGAGAAGTGAGG - Intronic
1106601553 13:31191833-31191855 CCATCTACCACACAGAAAAGGGG - Intergenic
1107832247 13:44384903-44384925 CCAATCACCAATGAGAAAAGTGG - Intronic
1108531105 13:51328371-51328393 CAATTCAGCACGGAGCAATGTGG + Intergenic
1108785533 13:53896743-53896765 TCATTGACCACTGAAAAATGAGG - Intergenic
1109912857 13:68939225-68939247 CCATAAACAGCAGAGAAATGTGG - Intergenic
1111702583 13:91709547-91709569 CTATTCGCAACACAGAAATGAGG - Intronic
1111930793 13:94511193-94511215 CCATTCCCACCTGAGAAATGGGG + Intergenic
1113140120 13:107138246-107138268 CCATTCGCAAAAGGGAAATGTGG - Intergenic
1114451693 14:22830569-22830591 TCACTAACCACAGAGAAAAGTGG - Intronic
1118512930 14:66495999-66496021 CCTTCCACCACAGATAAATCAGG + Intergenic
1119794489 14:77383565-77383587 ACAGTCACCTCAGACAAATGTGG + Intronic
1121091468 14:91185647-91185669 CCATTTAGCACAGAGTCATGAGG + Intronic
1121842389 14:97145133-97145155 CCATTTACCATTGAGAAAAGTGG - Intergenic
1123009365 14:105340222-105340244 CCTTTCCCCACAGATGAATGAGG - Intronic
1125972698 15:43924806-43924828 CCATTCTCCGCACAGCAATGAGG + Intronic
1127472477 15:59302725-59302747 CCATTTACAACTGAAAAATGAGG + Intronic
1128856174 15:71018598-71018620 CCATTCAACACAGATATGTGAGG + Intronic
1129057690 15:72833396-72833418 CCATTCATTTCAGGGAAATGTGG + Intergenic
1130028070 15:80286739-80286761 CCATTCCCCACAGAGAGTTTGGG + Intergenic
1131009265 15:89003820-89003842 CCTTTCAGCACAGTGAACTGGGG + Intergenic
1131044643 15:89304190-89304212 CGAATCACAACAGAAAAATGTGG + Intronic
1132013173 15:98293449-98293471 CCTTTCACCTAAGAGAACTGGGG - Intergenic
1133577803 16:7110662-7110684 TCATTCACCATAGTTAAATGAGG + Intronic
1135910826 16:26559177-26559199 CCATTCACCCCAGAGGAACAAGG - Intergenic
1136609674 16:31358630-31358652 CCATTCAGCACTGAGCAGTGAGG + Intronic
1137554923 16:49464543-49464565 CCATTTAGTACAAAGAAATGAGG + Intergenic
1138704686 16:58902860-58902882 GCGTTCACCAGAGAAAAATGAGG - Intergenic
1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG + Exonic
1143241523 17:5447038-5447060 ACATTCACCACAGAGTACTCAGG + Intronic
1143268586 17:5659006-5659028 CCATTCACCACGGACAGAAGTGG + Intergenic
1144102745 17:11957725-11957747 CCATACACCACAGAAAAAACAGG + Intronic
1144321316 17:14123112-14123134 CCATATACCTCAGAGAACTGTGG - Intronic
1144585148 17:16483186-16483208 CCATTCATCTCAGAGCACTGGGG - Intronic
1144792987 17:17871961-17871983 CCATTCACAACAGAGGAGAGTGG - Intronic
1147014313 17:37478463-37478485 CCTTTCACCATTGAGAAATAGGG - Exonic
1147030265 17:37628325-37628347 CCTTTCACCACAGGGACATTTGG - Intronic
1148725783 17:49788988-49789010 CCATACCCAACAGAAAAATGTGG + Intronic
1149151208 17:53566013-53566035 CTAGTCACCATAGAGAAATATGG + Intergenic
1149289102 17:55198232-55198254 CCATCTGCCACACAGAAATGGGG + Intergenic
1150608836 17:66716795-66716817 CCATTCTCCAAGGAGAAACGTGG - Intronic
1150848716 17:68684684-68684706 GCTTTCACAACAGAAAAATGGGG + Intergenic
1151815374 17:76469063-76469085 CCGTTCCCCACAGGAAAATGGGG - Intronic
1152737785 17:82005730-82005752 TCACTCAGCACAGAGAATTGGGG + Intronic
1153987241 18:10363605-10363627 CCATTAACCATAGAGAAAGGGGG - Intergenic
1156049262 18:32912368-32912390 CCATTCACAACATACAGATGAGG + Intergenic
1156889698 18:42176493-42176515 TCATTCACCATAAAGAACTGGGG + Intergenic
1158162893 18:54506488-54506510 CCATACTCGAGAGAGAAATGGGG + Intergenic
1159380967 18:67658675-67658697 CCATGAACCACAGAAAGATGAGG + Intergenic
1167289998 19:48619266-48619288 CAACTCACCACAGAGAAGTCCGG - Exonic
1168087694 19:54060474-54060496 AGCTTCACCACAGAGGAATGAGG + Intronic
925721335 2:6830697-6830719 CCTGTGACCAGAGAGAAATGAGG + Intergenic
926785265 2:16511761-16511783 CCATTCATCACACAGGGATGTGG - Intergenic
927127214 2:20022825-20022847 CCATTCATAACAAAGACATGGGG - Intergenic
927786124 2:25976265-25976287 ACATTCACCACAGAGAGAGTGGG + Intronic
929893062 2:45935316-45935338 CCATTCACCAAAGATAAGTGGGG + Intronic
930813945 2:55572758-55572780 CTATTTACCACAGTGAGATGTGG + Intronic
932202267 2:69840547-69840569 CACTCCACCACTGAGAAATGTGG - Intronic
933832646 2:86223266-86223288 CCCTTCCCCACAGAGAGAAGAGG - Intronic
934099322 2:88637185-88637207 ACATTCTCTACAGAGAAAAGAGG - Intergenic
936785409 2:116088474-116088496 TCATTCATCACAGAGATAAGCGG - Intergenic
938975023 2:136468721-136468743 GGATTCAACTCAGAGAAATGAGG + Intergenic
939270651 2:139934838-139934860 CCATTCTCCACCAAGAAATAAGG - Intergenic
939794321 2:146622818-146622840 CCCTTCCACACTGAGAAATGAGG + Intergenic
940084494 2:149843372-149843394 AAATTCACTATAGAGAAATGAGG - Intergenic
941068419 2:160929022-160929044 CCAAATACCACAGAGAACTGTGG + Intergenic
942806627 2:179938639-179938661 CCACTTACGACCGAGAAATGTGG - Intergenic
943444569 2:187968012-187968034 CCCTTCACCACATTGAACTGAGG - Intergenic
943921718 2:193715284-193715306 CCACTCACCACCCAGCAATGTGG - Intergenic
945206953 2:207342521-207342543 CCTTTCACCACAGAGAATCATGG + Intergenic
945464210 2:210148009-210148031 GCATTCACCAAAGAAAAAAGGGG - Intronic
946050023 2:216854816-216854838 CCAGTCCAGACAGAGAAATGAGG + Intergenic
947480996 2:230499881-230499903 CAATTCTCTCCAGAGAAATGTGG + Intronic
948313165 2:237004865-237004887 CCAGTCACAAAACAGAAATGCGG + Intergenic
1168948322 20:1779654-1779676 CCATTCACCTCAGAGCACTTGGG + Intergenic
1169239842 20:3967562-3967584 CAATACACCACAGCTAAATGGGG + Intronic
1170273404 20:14554240-14554262 CATTTAACGACAGAGAAATGAGG - Intronic
1172030761 20:31980477-31980499 CCATGCCCCACGGTGAAATGGGG + Intronic
1175040450 20:56044838-56044860 CCAGTGTCCACAGAGAAATAGGG - Intergenic
1175463414 20:59172360-59172382 CCAACAACCACAGTGAAATGAGG + Intergenic
1175768654 20:61608715-61608737 CCACCAACCACAGAGCAATGAGG - Intronic
1177879404 21:26674232-26674254 CCACTCACAACTGAGACATGAGG - Intergenic
1181439077 22:22926612-22926634 ACAGTGACCACAGGGAAATGGGG - Intergenic
1183009809 22:34935555-34935577 CCATTCTCTACACAGAAATTGGG + Intergenic
949204625 3:1423351-1423373 ATATTCACCATAGAGGAATGGGG - Intergenic
949757005 3:7423649-7423671 CCACCCACCAAAGAGAAATATGG + Intronic
951087023 3:18524551-18524573 CAATTTCCCACAAAGAAATGCGG - Intergenic
951320124 3:21234393-21234415 TCATTCACCAAACAGTAATGGGG - Intergenic
952960524 3:38586454-38586476 CCAGTCATCACAGAGAAAGGGGG + Intronic
954054640 3:48011600-48011622 CCATTTACAACAGACGAATGTGG + Intronic
954829865 3:53411281-53411303 CCATTCAAGACAGAGAGAGGGGG - Intergenic
957423182 3:79999613-79999635 CAATTCACAACAGATAAATAGGG + Intergenic
957858096 3:85905118-85905140 GCATTCACCATAGACAAAAGGGG - Intronic
958206454 3:90402584-90402606 GCATTCACCACACAGAGTTGAGG - Intergenic
960335454 3:116411928-116411950 GCATACAAGACAGAGAAATGGGG - Intronic
961815063 3:129545318-129545340 CCATTCACCACATTTAAATCCGG + Intronic
965046987 3:163591286-163591308 CAAATCACTACAGAGAAATATGG - Intergenic
965545974 3:169916801-169916823 CCATTTACAACAGAACAATGGGG - Intronic
965952315 3:174325187-174325209 CCATACACCTCAATGAAATGTGG + Intergenic
966577584 3:181519727-181519749 CCATTCTCCACAGAAAAGTCAGG + Intergenic
969218296 4:5741092-5741114 GCATTTATCTCAGAGAAATGAGG + Intronic
969530423 4:7727344-7727366 CCAGTGAGCACAGATAAATGAGG - Intronic
969856528 4:10004231-10004253 TCATTCACAACAGAGAAGTCTGG + Intronic
969939185 4:10713365-10713387 CCATGAACAACAGAGAACTGGGG + Intergenic
971446050 4:26749930-26749952 CCATTCAGCCAAAAGAAATGAGG - Intronic
975945515 4:79701342-79701364 GCATTTATCTCAGAGAAATGAGG - Intergenic
979362270 4:119778852-119778874 CCATTCAGGACAGAGGCATGGGG - Intergenic
979598894 4:122564645-122564667 CCAGTTACCACAAAGAAATTTGG - Intergenic
979600040 4:122577373-122577395 CCCATCATCTCAGAGAAATGTGG + Intergenic
979796934 4:124857768-124857790 TCCTTCACCAAAGGGAAATGTGG - Intergenic
981532430 4:145765298-145765320 CCTTTTAGCACAGAGATATGGGG - Intronic
982341802 4:154307859-154307881 CCATTTCCCAGAGAGAAAGGAGG + Intronic
982554780 4:156846235-156846257 ACATCCACAACAGAGAAATCTGG + Intronic
983110193 4:163740490-163740512 CCAATCACCACTGAGCAATAGGG + Intronic
983787853 4:171757590-171757612 TCAGTCTCCACAGAAAAATGGGG - Intergenic
984511654 4:180685837-180685859 TCAATCACCAGAGAGAAATGAGG + Intergenic
985855871 5:2426364-2426386 CTTTCCAGCACAGAGAAATGGGG - Intergenic
986143248 5:5051227-5051249 CCATTCAGTAAAGAGAAAAGGGG + Intergenic
986939897 5:12937159-12937181 CCATTCCCCACCAAGAATTGGGG - Intergenic
987324208 5:16797541-16797563 CCATTCACAACAGCCAAAGGTGG + Intronic
992420708 5:76601810-76601832 CCATTCACTACATAGACAAGTGG - Intronic
992480859 5:77151332-77151354 CTATTGACCACAGTGAACTGGGG + Intergenic
993040103 5:82804602-82804624 CCATTTCCAACAGAGTAATGGGG - Intergenic
993939028 5:94036322-94036344 ACATTCCCCATAGATAAATGTGG + Intronic
994352247 5:98759607-98759629 CTATTCAAGACAGAGAAAAGAGG - Intergenic
994591833 5:101783568-101783590 CCCTTCCTCACAGAGAAATGAGG + Intergenic
996895528 5:128477308-128477330 CCCAGTACCACAGAGAAATGGGG + Intronic
998615512 5:143736007-143736029 TCAGCCACCACAGAGAAAGGTGG + Intergenic
1003466918 6:6389469-6389491 CCCTTCTCCATAGAGAAGTGAGG - Intergenic
1004249192 6:14008662-14008684 GCATGCTGCACAGAGAAATGGGG - Intergenic
1004336310 6:14767686-14767708 TCTTTCACCACAGAGAAGTACGG + Intergenic
1005192873 6:23245932-23245954 CCCTTCACCACAAATAAATAAGG + Intergenic
1007343476 6:41208993-41209015 CCTTTCCTCACAGACAAATGGGG + Intergenic
1008634427 6:53395595-53395617 CAATTCGACACAGAGATATGTGG - Intergenic
1010924679 6:81729881-81729903 GCATTTACCACAGAGACATTTGG + Intronic
1011825857 6:91304523-91304545 ACATTAACTACAGAGGAATGAGG - Intergenic
1011910895 6:92436357-92436379 CCATGCATCACTCAGAAATGTGG - Intergenic
1013894371 6:115067899-115067921 CGATTGACCACAGAGATCTGAGG + Intergenic
1015945870 6:138500311-138500333 CAATTAACCACAGAGAACTAGGG + Intronic
1016661262 6:146583347-146583369 CCAGTCAACACACAGAACTGTGG + Intergenic
1016821337 6:148349074-148349096 CCCTTCCCCACAGAGCAAAGAGG + Intronic
1017489404 6:154931421-154931443 ACATTCAGCACTGAGAACTGAGG + Intronic
1017494342 6:154970292-154970314 CCAATTTCCACAGAGAAATTCGG + Intronic
1021255370 7:18386090-18386112 GCTTTCACCAGAGAGAAATGGGG - Intronic
1021302911 7:18994102-18994124 TCCTCCACCACAGAGACATGTGG + Intronic
1025080631 7:55979488-55979510 AGATTCACCACAGAGAACTAAGG - Intronic
1029254831 7:99262633-99262655 CCACTGAGCACAGAGAAGTGAGG - Intergenic
1030367425 7:108661252-108661274 CCATTGACCACATAAACATGAGG - Intergenic
1033763420 7:144461636-144461658 GCACTCACCACAGGGAAATCAGG - Intronic
1035348319 7:158223692-158223714 CCATTAAGTACAGTGAAATGTGG - Intronic
1036678562 8:10853963-10853985 CCATTTACCACAGAGAAAAGAGG + Intergenic
1037096807 8:14995619-14995641 CCATTCACTTGAGAGAAAGGAGG + Intronic
1042130745 8:65584927-65584949 CCTTTTACCAGAGAGCAATGAGG + Intergenic
1043172286 8:76980454-76980476 CCGTTCACCACAGGAAACTGAGG - Exonic
1044535305 8:93350755-93350777 CCATTCAAAAAGGAGAAATGGGG + Intergenic
1047366992 8:124220877-124220899 CCTTTCACCACACATAAATGGGG + Intergenic
1048385088 8:133904713-133904735 CCATTCACCACAGATCCATGTGG + Intergenic
1050131644 9:2418997-2419019 CCATGCACCAGAGCAAAATGAGG - Intergenic
1052527832 9:29642738-29642760 GCATTTATCTCAGAGAAATGAGG + Intergenic
1058098286 9:100888211-100888233 CTAGTCTCCACAGAGAATTGAGG - Intergenic
1058353764 9:104058261-104058283 CCATTCAGGACATAGACATGGGG + Intergenic
1060245755 9:121944935-121944957 ACATTCATCTCAGAAAAATGTGG + Intronic
1185777225 X:2813060-2813082 CCTTCCACCTCAGATAAATGGGG - Intronic
1186092135 X:6061361-6061383 CCCTACAGCACACAGAAATGTGG + Intronic
1188433838 X:30138190-30138212 CCATTTACCACATACAGATGGGG + Intergenic
1188951519 X:36380907-36380929 CAAATCAACACAGAGAAATCAGG - Intronic
1190940843 X:55039612-55039634 ACATTCATCTCAGAAAAATGTGG - Intergenic
1191115889 X:56852208-56852230 CCATTCATCACATAGGCATGGGG + Intergenic
1192428948 X:71099936-71099958 CCATTCCCCACAGAGCATTTGGG - Intronic
1192521452 X:71804770-71804792 GCATTCACCACAGATGACTGAGG + Intergenic
1194517581 X:94875578-94875600 CCACTGACCTCAGAGAAATACGG - Intergenic
1195165322 X:102214384-102214406 CCAGTCACCACAGTGATATGAGG - Intergenic
1195193536 X:102472707-102472729 CCAGTCACCACAGTGATATGAGG + Intergenic
1196055262 X:111348619-111348641 CCATTCATCAGAAAGAACTGGGG + Intronic
1198041391 X:132856421-132856443 ACATTCCCCACAGATAAAGGGGG + Intronic
1201489202 Y:14523689-14523711 CCATTAACCAGAGAGAAAAGGGG + Intronic