ID: 1140504823

View in Genome Browser
Species Human (GRCh38)
Location 16:75464608-75464630
Sequence CCATTCACCACAGAGAAATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 204}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504811_1140504823 17 Left 1140504811 16:75464568-75464590 CCCGCCGCTGCCGCCGCTCCCCT 0: 1
1: 0
2: 13
3: 92
4: 720
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504816_1140504823 -1 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504817_1140504823 -2 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504809_1140504823 25 Left 1140504809 16:75464560-75464582 CCGGCCGACCCGCCGCTGCCGCC 0: 1
1: 1
2: 6
3: 77
4: 600
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504810_1140504823 21 Left 1140504810 16:75464564-75464586 CCGACCCGCCGCTGCCGCCGCTC 0: 1
1: 0
2: 7
3: 66
4: 546
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504812_1140504823 16 Left 1140504812 16:75464569-75464591 CCGCCGCTGCCGCCGCTCCCCTC 0: 1
1: 1
2: 15
3: 190
4: 1389
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504814_1140504823 7 Left 1140504814 16:75464578-75464600 CCGCCGCTCCCCTCGCGCTCCAT 0: 1
1: 0
2: 0
3: 17
4: 252
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504818_1140504823 -3 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504813_1140504823 13 Left 1140504813 16:75464572-75464594 CCGCTGCCGCCGCTCCCCTCGCG 0: 1
1: 0
2: 9
3: 40
4: 431
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504815_1140504823 4 Left 1140504815 16:75464581-75464603 CCGCTCCCCTCGCGCTCCATCCC 0: 1
1: 0
2: 7
3: 109
4: 1146
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204
1140504808_1140504823 26 Left 1140504808 16:75464559-75464581 CCCGGCCGACCCGCCGCTGCCGC 0: 1
1: 0
2: 6
3: 60
4: 424
Right 1140504823 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 2
3: 16
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504823 Original CRISPR CCATTCACCACAGAGAAATG AGG Exonic