ID: 1140504824

View in Genome Browser
Species Human (GRCh38)
Location 16:75464609-75464631
Sequence CATTCACCACAGAGAAATGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 370}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504812_1140504824 17 Left 1140504812 16:75464569-75464591 CCGCCGCTGCCGCCGCTCCCCTC 0: 1
1: 1
2: 15
3: 190
4: 1389
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504815_1140504824 5 Left 1140504815 16:75464581-75464603 CCGCTCCCCTCGCGCTCCATCCC 0: 1
1: 0
2: 7
3: 109
4: 1146
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504813_1140504824 14 Left 1140504813 16:75464572-75464594 CCGCTGCCGCCGCTCCCCTCGCG 0: 1
1: 0
2: 9
3: 40
4: 431
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504814_1140504824 8 Left 1140504814 16:75464578-75464600 CCGCCGCTCCCCTCGCGCTCCAT 0: 1
1: 0
2: 0
3: 17
4: 252
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504809_1140504824 26 Left 1140504809 16:75464560-75464582 CCGGCCGACCCGCCGCTGCCGCC 0: 1
1: 1
2: 6
3: 77
4: 600
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504810_1140504824 22 Left 1140504810 16:75464564-75464586 CCGACCCGCCGCTGCCGCCGCTC 0: 1
1: 0
2: 7
3: 66
4: 546
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504808_1140504824 27 Left 1140504808 16:75464559-75464581 CCCGGCCGACCCGCCGCTGCCGC 0: 1
1: 0
2: 6
3: 60
4: 424
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504818_1140504824 -2 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504817_1140504824 -1 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504811_1140504824 18 Left 1140504811 16:75464568-75464590 CCCGCCGCTGCCGCCGCTCCCCT 0: 1
1: 0
2: 13
3: 92
4: 720
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370
1140504816_1140504824 0 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG 0: 1
1: 0
2: 2
3: 17
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504824 Original CRISPR CATTCACCACAGAGAAATGA GGG Exonic
901353241 1:8617750-8617772 CTTTCAGCAAAGATAAATGAGGG - Intronic
903732692 1:25508145-25508167 GATTCACCAAATTGAAATGAAGG + Intergenic
903821048 1:26102834-26102856 CATTTACCTAAGAGAAATGGAGG - Intergenic
906555937 1:46713766-46713788 AATTAACTACAGAGAGATGACGG + Intronic
907638583 1:56161333-56161355 CAGTGGCCACAGAGATATGAAGG + Intergenic
908382054 1:63606060-63606082 CATTCTGCAGAGAGAAATAAAGG - Intronic
909312041 1:74163749-74163771 AATTTATCCCAGAGAAATGAAGG - Intronic
909515546 1:76503236-76503258 CATTCAGAACAAAGAAGTGAAGG - Intronic
911351007 1:96755478-96755500 CATTTACCCAAGAGAAAAGAAGG + Intronic
911766178 1:101677686-101677708 TAATCACCACAGATAAATGTTGG - Intergenic
913304653 1:117414816-117414838 CACTCACCACACTGAAATCAAGG - Exonic
914923653 1:151864985-151865007 CAGTCACCACAGGGAACTGTTGG - Intergenic
914929033 1:151913265-151913287 TATTTACCCAAGAGAAATGAAGG - Intergenic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
916089560 1:161297047-161297069 CATCCCCCACAGATAAAGGAGGG + Intergenic
916859429 1:168786918-168786940 CTTTAACCAAAGAGACATGAGGG + Intergenic
917682003 1:177376791-177376813 CATTAACAAAAGAAAAATGAGGG - Intergenic
920289540 1:204909076-204909098 CATTTATCCCAGAAAAATGAAGG - Intronic
920714388 1:208326047-208326069 CAGACATCACAGAGAACTGAAGG + Intergenic
921544027 1:216452930-216452952 CATTCAGCACAGGAAAAAGATGG - Intergenic
922583791 1:226718867-226718889 CATTTATCACAAATAAATGAAGG + Intronic
1064168154 10:13004227-13004249 GAGTCACCACACTGAAATGATGG - Intronic
1064343894 10:14513087-14513109 CGTTCACCACACAGACTTGATGG + Intergenic
1065013118 10:21437352-21437374 CATTCACCACTGAGTAAGAAAGG + Intergenic
1066186864 10:33018388-33018410 CATTCACCACCGATAATTGCTGG - Intergenic
1066285542 10:33962576-33962598 TATTCTCCAAAGAGAAAAGAGGG + Intergenic
1066391488 10:34980488-34980510 CCTTCTGAACAGAGAAATGAAGG + Intergenic
1066811923 10:39350232-39350254 GATTCAACACTGAGAGATGAAGG + Intergenic
1066934316 10:41806535-41806557 CATTTACCTCTGTGAAATGAAGG + Intergenic
1068779834 10:60907540-60907562 TATTCACCCCAGAGAAGAGAGGG + Intronic
1069907703 10:71741560-71741582 CATCTACCCCAGAGCAATGATGG - Intronic
1071051640 10:81457870-81457892 CAGTCATCACAGAGTAATCATGG - Intergenic
1071436234 10:85650376-85650398 CCCCCACCACAGAGAGATGAAGG + Intronic
1072569381 10:96645352-96645374 ACTTCACCCCAGAGAGATGAAGG - Intronic
1074424174 10:113336503-113336525 CATTCAAAGCAGAAAAATGAGGG - Intergenic
1075529420 10:123215588-123215610 CACTTATCCCAGAGAAATGAAGG - Intergenic
1077981040 11:7301016-7301038 CATTTAACACAGGCAAATGAAGG - Intronic
1078993317 11:16670698-16670720 GCTTCACCCCAGAGAAATGCAGG - Intronic
1079059903 11:17239454-17239476 AAGTCAACAGAGAGAAATGAGGG + Intronic
1079922796 11:26452781-26452803 GATTCACCAAAGTTAAATGAAGG + Intronic
1080290703 11:30667936-30667958 CATTCAGCACAGAGAAAAATTGG - Intergenic
1082203891 11:49407252-49407274 CATTCACCAAACAAAAATCACGG + Intergenic
1083107498 11:60372783-60372805 TATTCAACACATAGACATGAGGG + Intronic
1083128607 11:60599572-60599594 TATTTACTAAAGAGAAATGAGGG - Intergenic
1086651202 11:89293269-89293291 CATTCACCAAACAAAAATCATGG - Intronic
1086725623 11:90179705-90179727 CATTCACCAAAAGGAAATCAGGG - Intronic
1087269999 11:96101343-96101365 CATTCTCCACAGGGAAGTGATGG - Intronic
1087649067 11:100843459-100843481 CATTCAAGAGAAAGAAATGAAGG + Intronic
1088769013 11:113014495-113014517 CATTCATCTTAAAGAAATGAAGG - Intronic
1090350514 11:126104919-126104941 CGTTCTCCACAGAGACACGAGGG - Intergenic
1090495106 11:127204303-127204325 CATTCAGGACATAGGAATGAGGG - Intergenic
1090592966 11:128291825-128291847 CATTCACCAGACAGAAATCATGG - Intergenic
1090919540 11:131195893-131195915 CCTTCTCCACGGAGAAATGGAGG + Intergenic
1093304386 12:17495097-17495119 CATTCACCACAGGTAAGTGTCGG - Intergenic
1093722284 12:22458416-22458438 CTTTCACCACTGGGAAATCAGGG + Intronic
1095067975 12:37806360-37806382 CATTTACCACTGTGAGATGAAGG - Intergenic
1096683755 12:53274314-53274336 CATTCATCACAGCGAAGTCAGGG - Intronic
1101559590 12:105843778-105843800 CAAACCCCACAGAGAACTGACGG - Intergenic
1102957033 12:117065439-117065461 CGTTCACCACAGAGGAACGGGGG + Intronic
1105461553 13:20594372-20594394 CATTCCACACTGAGAAATGAAGG - Intronic
1108113395 13:47101926-47101948 CTTAGACCACAGAGAAGTGAAGG - Intergenic
1108794727 13:54017698-54017720 CATTCACCACACACAAAACAAGG + Intergenic
1109043527 13:57376007-57376029 CATTCACCAGAGAAAAATCAAGG - Intergenic
1109809107 13:67486226-67486248 CATCCAGAACAGAGAACTGAGGG + Intergenic
1109833426 13:67824242-67824264 CATTTATCCCAAAGAAATGAAGG - Intergenic
1110862845 13:80362581-80362603 CATTTCCCACATAGAAAGGAAGG - Intergenic
1112550634 13:100417440-100417462 CATTCACTAAACAGAGATGAAGG - Intronic
1112723891 13:102279860-102279882 CATTCAGCAGGGAGAACTGATGG - Intronic
1112930825 13:104734872-104734894 CATTTAACATAGAAAAATGATGG - Intergenic
1113061842 13:106330668-106330690 CATGCAGCACAGAGAAAAGCAGG + Intergenic
1114395059 14:22350600-22350622 GATTCACCAAATTGAAATGAAGG + Intergenic
1115184097 14:30665094-30665116 GATTCACCAAGGTGAAATGAAGG + Intronic
1119903109 14:78278107-78278129 TATTCACCACATAGGACTGAAGG - Intronic
1120104147 14:80475159-80475181 GTTTCACCAAACAGAAATGAAGG - Intergenic
1121091469 14:91185648-91185670 CATTTAGCACAGAGTCATGAGGG + Intronic
1121837264 14:97102945-97102967 CATTTACCAAAGAAAAATCATGG - Intergenic
1123634399 15:22289437-22289459 CTTTCAGCAAAGATAAATGAGGG + Intergenic
1124063823 15:26321040-26321062 CAGCCACAACACAGAAATGATGG + Intergenic
1125020652 15:34983018-34983040 CTTTTACCACAGAGGAAAGATGG - Exonic
1125204055 15:37131074-37131096 CAGTCACCACCAATAAATGATGG - Intergenic
1125972699 15:43924807-43924829 CATTCTCCGCACAGCAATGAGGG + Intronic
1127444615 15:59047992-59048014 CATTCCCAATAGGGAAATGAAGG - Intronic
1128856175 15:71018599-71018621 CATTCAACACAGATATGTGAGGG + Intronic
1129386906 15:75201396-75201418 CATTGACTACAACGAAATGAGGG + Intronic
1131714753 15:95096176-95096198 CAATGACCAGAGAGAAATTAGGG + Intergenic
1135664804 16:24326756-24326778 CATTCCCTACAGTGGAATGAAGG + Intronic
1137002145 16:35238553-35238575 CTCTCACAACAGAAAAATGATGG + Intergenic
1137414863 16:48266304-48266326 CTTTCTCCAAAGAGAAATTAAGG - Intronic
1137554924 16:49464544-49464566 CATTTAGTACAAAGAAATGAGGG + Intergenic
1138704685 16:58902859-58902881 CGTTCACCAGAGAAAAATGAGGG - Intergenic
1140504824 16:75464609-75464631 CATTCACCACAGAGAAATGAGGG + Exonic
1141215296 16:82018120-82018142 CATTGCCCTGAGAGAAATGAAGG - Intergenic
1142139467 16:88466325-88466347 CATTCTCCTCAGAGAACTGAAGG + Intronic
1142986544 17:3698466-3698488 TAATCACCCCAGAAAAATGAAGG - Intergenic
1145441194 17:23108767-23108789 CATTCAACACACAGAGTTGAAGG + Intergenic
1145442762 17:23130190-23130212 CATTCAACACACAGAGTTGAAGG + Intergenic
1145447789 17:23199800-23199822 CATTCAACACACAGAGTTGAAGG + Intergenic
1145449017 17:23217975-23217997 CATTCAACTCACAGAGATGAAGG + Intergenic
1145455994 17:23319945-23319967 CATTCAACTCACAGAGATGAAGG + Intergenic
1145460647 17:23387811-23387833 CATTCAACTCACAGAGATGAAGG + Intergenic
1145464064 17:23437352-23437374 CATTCAACTCACAGAGATGAAGG + Intergenic
1145464244 17:23440066-23440088 CATTCAACTCACAGAGATGAAGG + Intergenic
1145466073 17:23466527-23466549 CATTCAACACACAGAGTTGAAGG + Intergenic
1145466411 17:23471447-23471469 CATTCAACTCACAGAGATGAAGG + Intergenic
1145467932 17:23493505-23493527 CATTCAACTCACAGAGATGAAGG + Intergenic
1145472542 17:23560334-23560356 CATTCAACTCACAGAGATGAAGG + Intergenic
1145473417 17:23573069-23573091 CATTCAACTCACAGAGATGAAGG + Intergenic
1145486946 17:23769682-23769704 CATTCAACTCACAGAGATGAAGG + Intergenic
1145487291 17:23774601-23774623 CATTCAACTCACAGAGATGAAGG + Intergenic
1145490689 17:23823968-23823990 CATTCAACTCACAGAGATGAAGG + Intergenic
1145491019 17:23828725-23828747 CATTCAACTCACAGAGATGAAGG + Intergenic
1145492478 17:23849923-23849945 CATTCAACTCACAGAGATGAAGG + Intergenic
1145493545 17:23865705-23865727 CATTCAACTCACAGAGATGAAGG + Intergenic
1145497999 17:23930688-23930710 CATTCAACTCACAGAGATGAAGG + Intergenic
1145503620 17:24012624-24012646 CATTCAACTCACAGAGATGAAGG + Intergenic
1145508637 17:24085732-24085754 CATTCAACTCACAGAGATGAAGG + Intergenic
1145512085 17:24135774-24135796 CATTCAACTCACAGAGATGAAGG + Intergenic
1145516367 17:24197876-24197898 CATTCAACTCACAGAGATGAAGG + Intergenic
1145516873 17:24205174-24205196 CATTCAACTCACAGAGATGAAGG + Intergenic
1145519248 17:24239619-24239641 CATTCAACTCACAGAGATGAAGG + Intergenic
1145521193 17:24267961-24267983 CATTCAACTCACAGAGATGAAGG + Intergenic
1145525955 17:24337363-24337385 CATTCAACTCACAGAGATGAAGG + Intergenic
1145528983 17:24381629-24381651 CATTCAACTCACAGAGATGAAGG + Intergenic
1145534597 17:24463218-24463240 CATTCAACTCACAGAGATGAAGG + Intergenic
1145535255 17:24472710-24472732 CATTCAACTCACAGAGATGAAGG + Intergenic
1145535932 17:24482546-24482568 CATTCAACTCACAGAGATGAAGG + Intergenic
1145540417 17:24547844-24547866 CATTCAACTCACAGAATTGAAGG + Intergenic
1145541126 17:24558197-24558219 CATTCAACTCATAGAGATGAAGG + Intergenic
1145543395 17:24591099-24591121 CATTCAACTCACAGAGATGAAGG + Intergenic
1145544513 17:24607378-24607400 CATTCAACTCACAGAGATGAAGG + Intergenic
1145546690 17:24639093-24639115 CATTCAACTCACAGAGATGAAGG + Intergenic
1145547059 17:24644527-24644549 CATTCAACTCACAGAGATGAAGG + Intergenic
1145547769 17:24654877-24654899 CATTCAACTCACAGAGATGAAGG + Intergenic
1145548464 17:24665059-24665081 CATTCAACTCACAGAGATGAAGG + Intergenic
1145551445 17:24708485-24708507 CATTCAACTCAAAGAGATGAAGG + Intergenic
1145551616 17:24711033-24711055 CATTCAACTCACAGAGATGAAGG + Intergenic
1145551802 17:24713748-24713770 CATTCAACTCACAGAGATGAAGG + Intergenic
1145555974 17:24774123-24774145 CATTCAACTCACAGAGATGAAGG + Intergenic
1145556523 17:24782106-24782128 CATTCAACTCACAGAGATGAAGG + Intergenic
1145557508 17:24796348-24796370 CATTCAACTCACAGAGATGAAGG + Intergenic
1145560318 17:24837406-24837428 CATTCAACACACAGAGTTGAAGG + Intergenic
1145561146 17:24849444-24849466 CATTCAACTCACAGAGATGAAGG + Intergenic
1145561956 17:24861152-24861174 CATTCAACTCACAGAGATGAAGG + Intergenic
1145564041 17:24891514-24891536 CATTCAACTCACAGAGATGAAGG + Intergenic
1145566992 17:24934253-24934275 CATTCAACTCACAGAGATGAAGG + Intergenic
1145569127 17:24965290-24965312 CATTCAACTCACAGAGATGAAGG + Intergenic
1145577872 17:25092659-25092681 CATTCAACTCACAGAGATGAAGG + Intergenic
1145578886 17:25107415-25107437 CATTCAACTCACAGAGATGAAGG + Intergenic
1145593271 17:25316111-25316133 CATTCAACTCAAAGAGATGAAGG + Intergenic
1145593936 17:25325784-25325806 CATTCAACTCACAGAGATGAAGG + Intergenic
1145594490 17:25333930-25333952 CATTCAACTCACAGAGATGAAGG + Intergenic
1145594821 17:25338849-25338871 CATTCAACTCACAGAGATGAAGG + Intergenic
1145595183 17:25344281-25344303 CATTCAACTCACAGAGATGAAGG + Intergenic
1145595376 17:25346996-25347018 CATTCAACTCACAGAGATGAAGG + Intergenic
1145596125 17:25358025-25358047 CATTCAACTCACAGAGATGAAGG + Intergenic
1145597369 17:25376183-25376205 CATTCAACTCACAGAGATGAAGG + Intergenic
1145601941 17:25443205-25443227 CATTCAACTCACAGAGATGAAGG + Intergenic
1145609938 17:25559440-25559462 CATTCAACTCACAGAGATGAAGG + Intergenic
1145613293 17:25608304-25608326 CATTCAACTCACAGAGATGAAGG + Intergenic
1145615127 17:25635113-25635135 CATTCAACTCACAGAGATGAAGG + Intergenic
1145620265 17:25710181-25710203 CATTCAACTCACAGAGATGAAGG + Intergenic
1145621555 17:25729019-25729041 CATTCAACTCACAGAGATGAAGG + Intergenic
1145622330 17:25740146-25740168 CATTCAACTCACAGAGATGAAGG + Intergenic
1145628107 17:25823973-25823995 CATTCAACTCACAGAGATGAAGG + Intergenic
1145629010 17:25837215-25837237 CATTCAACTCACAGAGATGAAGG + Intergenic
1145637114 17:25954348-25954370 CATTCAACTCACAGAGATGAAGG + Intergenic
1145644763 17:26065671-26065693 CATTCAACTCACAGAGATGAAGG + Intergenic
1145645107 17:26070589-26070611 CATTCAACTCACAGAGATGAAGG + Intergenic
1145649839 17:26139464-26139486 CATTCAACACACAGAGTTGAAGG + Intergenic
1145651608 17:26164918-26164940 CATTCAACTCACAGAGATGAAGG + Intergenic
1145652540 17:26178328-26178350 CATTCAACTCACAGAGATGAAGG + Intergenic
1145653853 17:26197329-26197351 CATTCAACTCACAGAGATGAAGG + Intergenic
1145654978 17:26213617-26213639 CATTCAACTCACAGAGATGAAGG + Intergenic
1145656648 17:26237880-26237902 CATTCAACTCACAGAGATGAAGG + Intergenic
1145658499 17:26264862-26264884 CATTCAACTCACAGAGATGAAGG + Intergenic
1145659809 17:26283860-26283882 CATTCAACTCACAGAGATGAAGG + Intergenic
1145661115 17:26302899-26302921 CATTCAACTCACAGAGATGAAGG + Intergenic
1145663143 17:26332251-26332273 CATTCAACTCACAGAGATGAAGG + Intergenic
1145663852 17:26342603-26342625 CATTCAACTCACAGAGATGAAGG + Intergenic
1145664033 17:26345322-26345344 CATTCAACTCACAGAGATGAAGG + Intergenic
1145671990 17:26460915-26460937 CATTCAACTCACAGAGATGAAGG + Intergenic
1145674211 17:26493496-26493518 CATTCAACTCACAGAGATGAAGG + Intergenic
1145676052 17:26520317-26520339 CATTCAACTCAGAGAGTTGAAGG + Intergenic
1145677163 17:26536616-26536638 CATTCAACTCACAGAGATGAAGG + Intergenic
1146423057 17:32707480-32707502 AATTCAGCGCATAGAAATGAAGG + Intronic
1146981339 17:37164549-37164571 CATTAAAGACAGAGAAAGGAAGG + Intronic
1148247011 17:46039026-46039048 CATTCATCTGAGAGAAGTGAAGG - Exonic
1149016446 17:51913922-51913944 TATTATCCACAGAGAACTGAGGG + Intronic
1149515210 17:57275930-57275952 CAGTGAGCACAGAGAACTGAAGG - Intronic
1149548449 17:57521899-57521921 CATTCTCCAAAGAGGAAGGACGG - Intronic
1150378203 17:64699861-64699883 CAGACACCACAGAGATGTGAAGG + Intergenic
1151361522 17:73592146-73592168 CTTGCACCACAGAAAAAGGAAGG + Intronic
1152075971 17:78159990-78160012 GATTCACCACAGCCAAATGGTGG - Intronic
1152649635 17:81486481-81486503 TACTCACCACAGAGAAAAGGTGG - Intergenic
1152737786 17:82005731-82005753 CACTCAGCACAGAGAATTGGGGG + Intronic
1153703851 18:7725091-7725113 TATTCACCACATCTAAATGATGG + Intronic
1153875435 18:9366295-9366317 CATTCACCACAGCGACATCTAGG - Intronic
1155492767 18:26416441-26416463 CATTCCTCTCACAGAAATGAAGG - Intergenic
1155790051 18:29954965-29954987 CATTCTCCACAGAAAAATGGAGG - Intergenic
1156104752 18:33646788-33646810 CATTCCTCACAGTGAAAAGAGGG + Intronic
1156799872 18:41097112-41097134 CCTTGACCCCAAAGAAATGAAGG + Intergenic
1157071920 18:44417922-44417944 GATTCACCAAGGATAAATGAAGG + Intergenic
1157083745 18:44555796-44555818 CACTCCCCACAGAGATAGGAAGG - Intergenic
1158029120 18:52941032-52941054 TTTTCAGCACAGAAAAATGATGG + Intronic
1158735408 18:60074181-60074203 CATCCACCACAGAGACTTAAAGG - Intergenic
1159380968 18:67658676-67658698 CATGAACCACAGAAAGATGAGGG + Intergenic
1159756598 18:72373143-72373165 CATTTACCACATAGAACTAATGG + Intergenic
1163317320 19:16549848-16549870 CATTTACCAAAAATAAATGATGG - Exonic
1163965672 19:20745093-20745115 TATTGTCCCCAGAGAAATGAAGG - Intronic
1163982013 19:20909708-20909730 CATTCACCACAGTGAGAACATGG + Intergenic
1164155334 19:22592435-22592457 CTCCCAACACAGAGAAATGATGG + Intergenic
1166272390 19:41722829-41722851 CATACACCAAAAAGAATTGAAGG - Intronic
1168116451 19:54223548-54223570 CAGTGAGCACAGAGAAATGCAGG + Intronic
927123612 2:19991654-19991676 AATATACCACAGAGAAATGGTGG - Intergenic
928698417 2:33873773-33873795 TATACACCAAAAAGAAATGAAGG - Intergenic
929090531 2:38212783-38212805 CATTTATCCCAGAGAAATGAAGG + Intergenic
929171770 2:38939322-38939344 TATACACCCAAGAGAAATGAGGG - Intronic
931865572 2:66407350-66407372 TATTTACCCAAGAGAAATGAAGG + Intergenic
931918562 2:66986957-66986979 CAGATACCACAGAAAAATGATGG + Intergenic
932609096 2:73185480-73185502 CATTGAAGACAGAGAAATGCAGG - Intergenic
933280537 2:80328279-80328301 CATTCAGGACAGAGCAAAGAAGG - Intronic
935948448 2:108307039-108307061 TATTCACAACAGTGAAATCATGG + Intronic
936782958 2:116055437-116055459 CAGTCACGACAAAGAAATAAAGG - Intergenic
937229184 2:120387496-120387518 AATTCTCCACAGAGTCATGATGG + Intergenic
939747568 2:145994560-145994582 CATTCACTAGAGAGTGATGATGG - Intergenic
939794323 2:146622819-146622841 CCTTCCACACTGAGAAATGAGGG + Intergenic
940481859 2:154242598-154242620 AATTCAACACACAGAAATGGTGG - Intronic
942409235 2:175690553-175690575 CAGTAATAACAGAGAAATGAAGG - Intergenic
942451355 2:176109519-176109541 CATTCACCGAAGAGGAAGGAAGG - Exonic
942782234 2:179657947-179657969 ATCTCACCACAGTGAAATGATGG + Intronic
943272419 2:185823793-185823815 TATTCACCATAGACAAATGATGG + Intronic
943658887 2:190536461-190536483 GACTCACCACAGATAAAGGAAGG + Intergenic
944066088 2:195620363-195620385 CATTCACAATAAATAAATGAAGG + Intronic
944511492 2:200470452-200470474 CACTCAGCACAGAGAACCGAGGG - Intronic
945936101 2:215904267-215904289 CAGTTACCTCAGTGAAATGAAGG - Intergenic
946050024 2:216854817-216854839 CAGTCCAGACAGAGAAATGAGGG + Intergenic
946715085 2:222545737-222545759 CAGCCACCACAGAGAAGGGAAGG - Intronic
946744798 2:222834751-222834773 CATTCACAACAGCCAAAAGATGG + Intergenic
946875834 2:224128960-224128982 CAGTCTCCTCAGAGAAATAATGG - Intergenic
947021773 2:225685247-225685269 GCTTGACCACAGATAAATGAGGG - Intergenic
947593008 2:231395799-231395821 CACTCACCACAGCGACATGGCGG - Exonic
948466841 2:238156321-238156343 CATTCCTCACAGGGAAAAGATGG + Intergenic
1169199543 20:3701558-3701580 CACTGACCACAGAGCAGTGAAGG + Exonic
1170273403 20:14554239-14554261 ATTTAACGACAGAGAAATGAGGG - Intronic
1171035696 20:21710728-21710750 CATCCACAACAGTGAAATGAAGG + Intronic
1171288168 20:23960390-23960412 TATTTACCACAAAAAAATGAAGG + Intergenic
1172210215 20:33192442-33192464 CAATCACAAGAGAGAAAGGATGG + Intergenic
1175463415 20:59172361-59172383 CAACAACCACAGTGAAATGAGGG + Intergenic
1175581860 20:60105925-60105947 ATTTCATCACTGAGAAATGATGG + Intergenic
1176762907 21:12976544-12976566 CATTCAACTCACAGAATTGAAGG - Intergenic
1177488258 21:21787112-21787134 CTTTCCCCAAAGAGATATGAAGG - Intergenic
1177879403 21:26674231-26674253 CACTCACAACTGAGACATGAGGG - Intergenic
1179420322 21:41230780-41230802 CATTCACCACCATGAAAAGATGG - Intronic
1180026684 21:45167826-45167848 CATTTATCCCAGAGAAATGAAGG - Intronic
1181439076 22:22926611-22926633 CAGTGACCACAGGGAAATGGGGG - Intergenic
1181457703 22:23069176-23069198 CCTCCACCACAGAGCTATGATGG + Intronic
1182678370 22:32058441-32058463 CATTTACAACAGAGGAATGTTGG - Intronic
1183269860 22:36854373-36854395 TATTTACCCAAGAGAAATGAAGG + Intergenic
1183874931 22:40772078-40772100 TATTTACCCAAGAGAAATGAAGG - Intronic
1184521569 22:44997499-44997521 AATGCACCACAGATAAATGCCGG - Intronic
1184904083 22:47467715-47467737 CATGCACCACTAAGAAATAAAGG - Intronic
949383681 3:3474785-3474807 CATTCATCATAGACAAATTAAGG - Intergenic
950533100 3:13564561-13564583 CAGGCATCTCAGAGAAATGATGG - Intronic
951100440 3:18682322-18682344 CATGCACCTCAGAGAAATAGAGG + Intergenic
952960525 3:38586455-38586477 CAGTCATCACAGAGAAAGGGGGG + Intronic
955339539 3:58114469-58114491 TATTCACAACAGACAAAAGACGG - Intronic
955847600 3:63182954-63182976 CATTCTACAAAGATAAATGAAGG - Intergenic
957858095 3:85905117-85905139 CATTCACCATAGACAAAAGGGGG - Intronic
958248765 3:91203204-91203226 CATTCAACTCAGAGAGTTGAAGG - Intergenic
959254985 3:103998342-103998364 TTATCACCACAAAGAAATGATGG + Intergenic
959570654 3:107879950-107879972 TATTTACCCGAGAGAAATGAAGG - Intergenic
959965323 3:112347479-112347501 CAGTCTCCTCAGAGAGATGAAGG - Intronic
960335453 3:116411927-116411949 CATACAAGACAGAGAAATGGGGG - Intronic
961392707 3:126564522-126564544 CATTTATCCCAGAGAAATGAAGG - Intergenic
962665575 3:137650729-137650751 CCTTCACCAGAGAGAAATCCTGG + Intergenic
963398932 3:144772092-144772114 CATTCCCCACTTAGAAGTGAAGG + Intergenic
964156061 3:153585671-153585693 GATTCACCACAGTGAAATGAAGG + Intergenic
964171581 3:153776443-153776465 CATATATCACAGAGAAATTAAGG - Intergenic
966577585 3:181519728-181519750 CATTCTCCACAGAAAAGTCAGGG + Intergenic
966698208 3:182814928-182814950 CATTCCCCAGAGACAAAGGAAGG - Intronic
967610292 3:191497886-191497908 CAGACACCAGAGAGAAATGGTGG - Intergenic
968026951 3:195450530-195450552 CATTCTCCAAAGAGAACAGAAGG - Intergenic
968256312 3:197276302-197276324 GATTCACCACAGATTATTGAAGG - Intronic
968290864 3:197538744-197538766 AATTCACTAGACAGAAATGAGGG + Intronic
970274918 4:14388248-14388270 AATTCATAAAAGAGAAATGATGG + Intergenic
971446049 4:26749929-26749951 CATTCAGCCAAAAGAAATGAGGG - Intronic
973529029 4:51817053-51817075 CATTCAACTCACAGAGATGAAGG - Intergenic
973771544 4:54211707-54211729 CATTCTCCACACAGCAATCAGGG - Intronic
976889486 4:90029094-90029116 TATTCTACACAGAGTAATGAAGG + Intergenic
977215457 4:94278036-94278058 CATTTTCCACAAAGAAATAAAGG + Intronic
977662740 4:99609641-99609663 CATTCACCACAGAGATTGGAAGG + Intronic
978040538 4:104055649-104055671 GATTCAAGAAAGAGAAATGAAGG - Intergenic
978716192 4:111846028-111846050 AATTCACCCCAGAGGAAGGAGGG + Intergenic
978952552 4:114578564-114578586 CAGTCAAGACAAAGAAATGAAGG - Intergenic
979383805 4:120040401-120040423 CATTTATTCCAGAGAAATGAAGG - Intergenic
979386694 4:120075109-120075131 GATACACCACAAAGATATGAAGG + Intergenic
979522276 4:121681602-121681624 CATTCAAATCACAGAAATGAAGG + Intronic
979796932 4:124857767-124857789 CCTTCACCAAAGGGAAATGTGGG - Intergenic
980381485 4:132025464-132025486 CATGCACCACAGAGGAAAAATGG + Intergenic
981787800 4:148501329-148501351 GATTCACCAAGGTGAAATGAAGG - Intergenic
981931590 4:150195098-150195120 CCTTAACCACACAGGAATGAGGG - Intronic
982637175 4:157911432-157911454 CCTTCTCCAGAGAAAAATGAAGG - Intergenic
982812617 4:159845066-159845088 TATTTACCCAAGAGAAATGAAGG - Intergenic
983787852 4:171757589-171757611 CAGTCTCCACAGAAAAATGGGGG - Intergenic
983814113 4:172101532-172101554 AATTGACCTCAGAGAAATGTAGG - Intronic
983921353 4:173349134-173349156 AATTTACCTCAGAAAAATGAAGG + Intergenic
984457589 4:179990050-179990072 CATTGCTCACAGAGAAAGGATGG - Intergenic
984533843 4:180947580-180947602 CAGTCACTAAAGTGAAATGAGGG - Intergenic
985461473 4:190111567-190111589 CCTTCACCACAGTGAACTGTAGG + Intergenic
985841731 5:2311039-2311061 CAAGCAACACAGAGAAATGTTGG - Intergenic
986454779 5:7905839-7905861 CATGCACTACAGACAAATGTTGG + Intronic
986583655 5:9292166-9292188 CATTCAACAAAGGGAAAGGAGGG - Intronic
987205678 5:15622673-15622695 CCTGTAGCACAGAGAAATGAAGG + Intronic
989677275 5:43986364-43986386 CATGGACCACAGAGACATTATGG + Intergenic
989910130 5:49625262-49625284 CATTCAACACACAGAGTTGAAGG - Intergenic
990064029 5:51689932-51689954 CATTCATTACAGAAAGATGATGG - Intergenic
991954495 5:71979131-71979153 TATATGCCACAGAGAAATGAAGG - Intergenic
992214374 5:74510938-74510960 CATACTCCACAGAGATCTGAGGG + Intergenic
994591835 5:101783569-101783591 CCTTCCTCACAGAGAAATGAGGG + Intergenic
999039553 5:148392280-148392302 CATTTCCCACAGACAATTGATGG - Intronic
999463513 5:151778091-151778113 CATTTACCCAAGAGAAATAAAGG - Intronic
1001408695 5:171495263-171495285 CATGCCCCACAGAGGAAGGAAGG + Intergenic
1003466916 6:6389468-6389490 CCTTCTCCATAGAGAAGTGAGGG - Intergenic
1004336311 6:14767687-14767709 CTTTCACCACAGAGAAGTACGGG + Intergenic
1005745752 6:28835802-28835824 TTTTCTCCACAGAGAAATTAAGG - Intergenic
1007198493 6:40084531-40084553 CATTCACAACACAGAATTAAAGG - Intergenic
1008816799 6:55578760-55578782 CATTCACCGAAGAGAGATAACGG + Intronic
1009713356 6:67353789-67353811 CATTCACAACACCAAAATGATGG - Intergenic
1010448132 6:75971894-75971916 CAATCAGCAAAAAGAAATGAGGG - Intronic
1011618450 6:89219946-89219968 CATTCAACATATAGAAATAAAGG + Intronic
1012268127 6:97172379-97172401 TTTTGACCACAGAGAAATAAAGG + Intronic
1012346856 6:98198979-98199001 CATTCACCCCAGACCAATTAGGG + Intergenic
1014822271 6:126003786-126003808 CATACATCACAGAAAAATAAGGG - Intronic
1016626190 6:146172420-146172442 CATTCGGCAAAGAGAAATTAAGG - Intronic
1016720690 6:147293847-147293869 CATTCACCTCAGTGAAAGCATGG + Intronic
1016821339 6:148349075-148349097 CCTTCCCCACAGAGCAAAGAGGG + Intronic
1017144856 6:151225450-151225472 CATTTACTTCAGTGAAATGATGG + Intergenic
1018142457 6:160852797-160852819 CAGTCAACCCAGAGAAACGACGG - Intergenic
1018466709 6:164053516-164053538 CATCCAGCACAGGGGAATGATGG - Intergenic
1019167914 6:170111069-170111091 CATTGACCACAGAGGCGTGAGGG + Intergenic
1021355435 7:19649311-19649333 CAGTGACCACAGAGAAAAAAAGG + Intergenic
1023101076 7:36719324-36719346 CATTCAAGTCAGAGAAAAGATGG + Intronic
1024567965 7:50698575-50698597 CATACAGCACAGTGAAATCACGG - Intronic
1024828000 7:53415277-53415299 CTTTCATTGCAGAGAAATGAAGG - Intergenic
1028167319 7:87552675-87552697 CATTCCCCACTGAGCAATGTTGG + Intronic
1029887581 7:103889375-103889397 CATTCCCAAAAGAGAAATAAGGG - Intronic
1032066670 7:128776376-128776398 GATTCAACACAAAGAAATGGAGG - Intergenic
1032407691 7:131668637-131668659 CCTTCACCCCAGAGAAATTTAGG - Intergenic
1034002817 7:147435064-147435086 CATACAACACAGAGATCTGAAGG + Intronic
1034190942 7:149213221-149213243 ACTTCACCACAGAGAAATTGAGG + Intronic
1034511518 7:151539231-151539253 CAATCACCACACAGAATAGATGG - Intergenic
1035702431 8:1646903-1646925 CTGTCACCACAGAGAAGTGATGG + Intronic
1035899142 8:3438749-3438771 CATTTATCTCAGAGAAGTGAAGG - Intronic
1036678563 8:10853964-10853986 CATTTACCACAGAGAAAAGAGGG + Intergenic
1037765856 8:21771827-21771849 CTTTCCCCACAGAGAAGTGAAGG + Intronic
1041092053 8:54311478-54311500 TATTTACCCAAGAGAAATGAAGG - Intergenic
1041430335 8:57774398-57774420 CATTCAACACATAGAAATAGTGG + Intergenic
1041494105 8:58467150-58467172 CATTCACTATTGATAAATGAGGG - Intergenic
1042403088 8:68372222-68372244 AATTCATTACAGAGAATTGATGG + Intronic
1042796373 8:72667752-72667774 CCTTCCCCACACAGAAATTATGG + Intronic
1043688770 8:83124095-83124117 CTCTCACCATGGAGAAATGATGG - Intergenic
1044326476 8:90864701-90864723 CAATCCTGACAGAGAAATGATGG - Intronic
1044481621 8:92697249-92697271 CATTTACCCAAGAGCAATGAAGG + Intergenic
1049728502 8:144163115-144163137 CATACTCCAGAGAAAAATGAAGG - Intronic
1052378147 9:27741308-27741330 GTTTCACCCCAGAGAAATGCAGG + Intergenic
1053712638 9:40836088-40836110 CATTCAACACAAAGAGTTGAAGG + Intergenic
1054423168 9:64969335-64969357 CATTCAACACAAAGAGTTGAAGG + Intergenic
1054854671 9:69885654-69885676 CATTAAACACACAGAAATGCTGG - Intronic
1056121086 9:83489857-83489879 CGATAAACACAGAGAAATGAAGG + Intronic
1057242590 9:93424593-93424615 CATTCACGACAGCCAAAAGATGG - Intergenic
1059551730 9:115235982-115236004 AATTCCCCAAAGAGAAATTAGGG - Intronic
1060539890 9:124422269-124422291 CATTCAAGACAGAGAGATAAAGG + Intergenic
1061607698 9:131723699-131723721 CATTCACAACAGCCAAAAGATGG - Intronic
1062356403 9:136166100-136166122 CATTATCCACAGAGAAACAAAGG - Intergenic
1186623031 X:11261461-11261483 CAGTCACCAAAGAAAAATGCTGG - Intronic
1186821658 X:13294260-13294282 CTTTTACCACAGAAAAAAGACGG + Intergenic
1187285343 X:17898827-17898849 CAATCACCACAGAGTCAAGAAGG - Intergenic
1187875578 X:23800905-23800927 CATTCTACACAGGGAAATGGCGG + Intergenic
1189757690 X:44287347-44287369 CATTTGCCACACAGAAATGCAGG - Intronic
1192830076 X:74742029-74742051 CATTCTCCAGAGCAAAATGAAGG - Exonic
1194520690 X:94915813-94915835 CATGCAGCACTGAGAAAAGAAGG - Intergenic
1195095316 X:101496081-101496103 CCTTCTCCAGAGAGAAATGCTGG + Intronic
1196536336 X:116849696-116849718 CAGTCACCACAGAGTAATAAAGG + Intergenic
1197995666 X:132369873-132369895 CATGCACAACAGAAAAATGCTGG + Intronic
1199259484 X:145754573-145754595 CATTTACCCTAGAGAAATTAAGG - Intergenic
1199524050 X:148771577-148771599 CAATCACAACAGAGACAAGATGG - Intronic
1199806882 X:151308895-151308917 CATTCATGACAAAGAAATAATGG - Intergenic
1201674410 Y:16563107-16563129 AATTCTTCACAGAGAAATGTCGG - Intergenic
1202305787 Y:23469098-23469120 CTTTCAGCAAAGATAAATGAGGG + Intergenic
1202565022 Y:26201491-26201513 CTTTCAGCAAAGATAAATGAGGG - Intergenic