ID: 1140504825

View in Genome Browser
Species Human (GRCh38)
Location 16:75464615-75464637
Sequence GCTCGTCCCTCATTTCTCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 108}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504825_1140504828 0 Left 1140504825 16:75464615-75464637 CCACAGAGAAATGAGGGACGAGC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504825_1140504826 -10 Left 1140504825 16:75464615-75464637 CCACAGAGAAATGAGGGACGAGC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504825_1140504827 -4 Left 1140504825 16:75464615-75464637 CCACAGAGAAATGAGGGACGAGC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504825 Original CRISPR GCTCGTCCCTCATTTCTCTG TGG (reversed) Exonic
901124409 1:6918931-6918953 GGTCGCCTCTCCTTTCTCTGTGG - Intronic
901331020 1:8408591-8408613 ACTCTGCCCTCCTTTCTCTGTGG - Intronic
903163763 1:21507249-21507271 GCCCGTCCCTCATAGCTTTGGGG + Intergenic
903327148 1:22575889-22575911 GCTCTGCCCTCATTTCTCTGTGG - Intronic
907852352 1:58267651-58267673 GCTCAGCATTCATTTCTCTGGGG - Intronic
914259027 1:145983267-145983289 GCTTGTACCTCATTTTTCTTAGG + Intergenic
914355536 1:146881384-146881406 GCGTGTCCCTCCCTTCTCTGAGG + Intergenic
1065061443 10:21906182-21906204 GTTCCTACCTCATTTCTATGAGG + Intronic
1065693135 10:28355577-28355599 GCTCTTGCCTCACATCTCTGGGG - Intergenic
1067030447 10:42875936-42875958 GCTCGTCCTTCCTTCCACTGTGG + Intergenic
1067040625 10:42951529-42951551 GCTGGAGCCTCATTTCCCTGGGG - Intergenic
1067349934 10:45466474-45466496 GCTTGCCCCTCATTGCTATGAGG + Intronic
1069071473 10:63994377-63994399 GCCCCTTCCACATTTCTCTGTGG - Intergenic
1070747208 10:78941357-78941379 GTTTGTCCATCATTTCACTGTGG - Intergenic
1079103192 11:17554126-17554148 GGACCTCCATCATTTCTCTGAGG - Intronic
1079926653 11:26501820-26501842 ACTCTTTCCTCATTGCTCTGTGG - Intronic
1081598377 11:44475058-44475080 GCTCCTCCCTCTCTTCTCTCTGG - Intergenic
1087480190 11:98690924-98690946 TGTTGTCCCACATTTCTCTGAGG + Intergenic
1088894362 11:114066626-114066648 GCAAGACCCTCATTCCTCTGGGG + Intronic
1091109752 11:132954887-132954909 TCTCCTCCCTGATTTCTGTGTGG - Intronic
1091919619 12:4293921-4293943 TCTCCTGCCTCATTTTTCTGTGG + Intronic
1092118672 12:6028019-6028041 GCACTGCCCTCACTTCTCTGTGG - Intronic
1094100672 12:26758726-26758748 ACTCTTCCCTCATTGGTCTGTGG + Intronic
1097618559 12:61912627-61912649 GCTCGTTTCTCTTTTCTCAGTGG + Intronic
1101435563 12:104661187-104661209 GCTCTTGCCTCATTTGTCAGTGG + Intronic
1102058355 12:109913662-109913684 TCTCCTCCCAGATTTCTCTGCGG - Intronic
1103277817 12:119727940-119727962 GCTGGTAGCTCATTTCTCTCTGG - Intronic
1104107789 12:125680380-125680402 GCTCCTCCCTCACTTCCCAGAGG + Intergenic
1104107913 12:125680768-125680790 GCTCCTCCCTCACTTCCCAGAGG + Intergenic
1104308979 12:127636644-127636666 GCTCTTCCCTCAATTCACTGAGG - Intergenic
1114343413 14:21769251-21769273 AGTCCTCCCTCCTTTCTCTGAGG - Intergenic
1120044968 14:79795415-79795437 CATCCTCCCACATTTCTCTGTGG + Intronic
1122900089 14:104778795-104778817 GCTCTGCCCTCCTTTCTTTGAGG - Intronic
1125736382 15:41929289-41929311 GCCTGTCCCTCCTTCCTCTGGGG + Intronic
1128361508 15:66964955-66964977 GCACGTGCCTCCTCTCTCTGCGG + Intergenic
1138296815 16:55893167-55893189 ACAAGTCCCTCACTTCTCTGGGG - Intronic
1139978483 16:70834059-70834081 GCGTGTCCCTCCCTTCTCTGAGG - Exonic
1140504825 16:75464615-75464637 GCTCGTCCCTCATTTCTCTGTGG - Exonic
1140860610 16:79014434-79014456 GATCGTCCCTCAATTTTCCGTGG + Intronic
1143338018 17:6188044-6188066 TTGCGTCACTCATTTCTCTGTGG + Intergenic
1144321314 17:14123105-14123127 GATCTTCCCACAGTTCTCTGAGG + Intronic
1146592691 17:34141856-34141878 GTTCTTGCCTCATTGCTCTGGGG + Intronic
1152140321 17:78532691-78532713 CCTCCTCCCTCATCTCTATGAGG + Exonic
1155820958 18:30375999-30376021 ACTTGTCCCACATTTCTCTTAGG + Intergenic
1159337588 18:67089976-67089998 GATCTTTCCTGATTTCTCTGTGG + Intergenic
1160606661 18:80056559-80056581 TCATGTCCCACATTTCTCTGAGG + Intronic
1162136374 19:8557840-8557862 GCCAGTCCCTGACTTCTCTGTGG + Intronic
1165407083 19:35637596-35637618 GCTCCTCCCTCAGTTCTCTTTGG + Exonic
1167083418 19:47292709-47292731 TATCCTCCGTCATTTCTCTGAGG + Intronic
1168514435 19:56999788-56999810 GCCTGTCCTTCATTACTCTGAGG - Intergenic
925180906 2:1816431-1816453 GCTCCTCCCTCTCTCCTCTGGGG - Intronic
928277654 2:29917671-29917693 CCTGGTCTCTCCTTTCTCTGAGG - Intronic
928873727 2:36012285-36012307 GTTCCTCCCTCATTTCTCTAGGG + Intergenic
946042719 2:216796242-216796264 GCTCTTCCCCTATTTCTGTGAGG - Intergenic
946766642 2:223046689-223046711 GGTCCTCCCTGATTTCTCTAAGG + Intergenic
948236516 2:236394897-236394919 GCTGGTCCTCCATATCTCTGTGG - Intronic
948491440 2:238315605-238315627 GCTGGGCCCTCATTTCGCAGAGG - Intergenic
1174266663 20:49336898-49336920 GCTCCTCCCTCATTTCCTTTGGG - Intergenic
1177169318 21:17638259-17638281 GCTCGTTCCTCACTTCTCAGGGG + Intergenic
1179396876 21:41048333-41048355 GCTTCTGCCTGATTTCTCTGTGG - Intergenic
1179801143 21:43811971-43811993 GCCAGTCCCTCACTGCTCTGGGG + Intergenic
1182202547 22:28588500-28588522 GCTCCTCTCCCATTTCTCTGTGG - Intronic
1184821494 22:46912145-46912167 TCTCGTCACTCCTTTCTTTGTGG + Exonic
949977847 3:9477129-9477151 GCCTGCCCCACATTTCTCTGGGG + Exonic
950241137 3:11371136-11371158 TCTCCTCCCTCCATTCTCTGGGG + Intronic
951770875 3:26256417-26256439 GCTCATCCATCATTTGTCTTGGG + Intergenic
955793940 3:62615731-62615753 TCTCTTCTCTCATTCCTCTGTGG - Intronic
957352919 3:79049375-79049397 CATAGTCCCTTATTTCTCTGAGG - Intronic
961110774 3:124281356-124281378 GCTTGTCCCAGATTTCCCTGGGG + Intronic
965516496 3:169627284-169627306 GCTGCTGCCTCATTTCTCTGAGG - Intronic
967268651 3:187714625-187714647 ACTGGTCCCTGCTTTCTCTGAGG - Intronic
970137283 4:12939318-12939340 GTTAGTCCCTCATTTTTCAGAGG - Intergenic
971448787 4:26780236-26780258 GATCGTCCCACATTTATTTGGGG + Intergenic
971703315 4:30008026-30008048 CCTGGTCCCTGATCTCTCTGAGG + Intergenic
972739494 4:41877225-41877247 GCTCCTCCCATATTCCTCTGCGG + Intergenic
978683368 4:111410449-111410471 TCTCTTCACTTATTTCTCTGAGG + Intergenic
979276485 4:118820121-118820143 TCTCTTCCCTCATTTATGTGAGG - Intronic
981524965 4:145699976-145699998 GCAAGTCCCTCTTTTCTATGGGG + Intronic
982369050 4:154613318-154613340 GCTCCTGGCTCTTTTCTCTGTGG - Intergenic
982967874 4:161937178-161937200 GCTATTATCTCATTTCTCTGAGG - Intronic
989154305 5:38329652-38329674 GTTCGTCCCCCAGTTCTTTGGGG + Intronic
989168135 5:38450313-38450335 GCTCTTCCCTCACTGTTCTGAGG + Intronic
989724565 5:44572732-44572754 GCTGCTCCCTCATCTCTCTTGGG + Intergenic
990368123 5:55090333-55090355 CCTCTTGCCTCTTTTCTCTGAGG - Intergenic
991440600 5:66644262-66644284 ACCAGTCCTTCATTTCTCTGGGG + Intronic
992386633 5:76290985-76291007 GCCCTTCCCCCATTTCTTTGTGG + Intronic
997217279 5:132123322-132123344 GCTCATGTCTCATTTCTCTTTGG - Intergenic
997306774 5:132843292-132843314 TCTCATCCCTTCTTTCTCTGTGG - Intergenic
999044436 5:148451984-148452006 GTTCACCACTCATTTCTCTGAGG + Intronic
1001280540 5:170383263-170383285 CCTGGTCCCTCATTTGACTGAGG + Intronic
1001292440 5:170473513-170473535 GCCCCTCCCTGATTTCTCAGGGG - Intronic
1003558016 6:7158012-7158034 GCTCATGCCTGACTTCTCTGTGG + Intronic
1012150174 6:95740140-95740162 TCTTCTCCCTCATTTCACTGTGG + Intergenic
1018725649 6:166611678-166611700 GCTCCAATCTCATTTCTCTGTGG + Intronic
1021127226 7:16865471-16865493 GCTCTTCCCGAATTTCTTTGGGG + Intronic
1022536477 7:31101753-31101775 GGTGGTGCCTCATTTATCTGGGG - Intronic
1022573843 7:31479019-31479041 GGTCTTCTCTCCTTTCTCTGGGG - Intergenic
1023629035 7:42144800-42144822 GCAATTCCTTCATTTCTCTGTGG - Intronic
1025080628 7:55979481-55979503 GCCCGTTCCTTAGTTCTCTGTGG + Intronic
1029278178 7:99419921-99419943 GCTCGGCCCCCAGTGCTCTGTGG - Exonic
1037751790 8:21687026-21687048 ACTCCCCCCTCATTGCTCTGTGG + Intergenic
1039424939 8:37477802-37477824 ACTCATCCCTCACTTCTTTGGGG - Intergenic
1047176034 8:122541185-122541207 GCTCCTCTCTCAATTCTCAGGGG + Intergenic
1053146660 9:35716689-35716711 GCTCTTGCATCATTTCTTTGGGG + Intronic
1053279839 9:36812890-36812912 GCTCACCACTGATTTCTCTGGGG - Intergenic
1060187771 9:121574432-121574454 TCTCTTCCTTCATTTTTCTGAGG - Intronic
1060594787 9:124841445-124841467 GCTCTTCCCTGAGCTCTCTGGGG + Intergenic
1062181459 9:135193323-135193345 GCTCTTCCCTGAGTTCTATGTGG + Intergenic
1062424287 9:136498832-136498854 GTTTGGCCCTCACTTCTCTGTGG + Intronic
1187696705 X:21929683-21929705 TCTCATCCCTGATTTGTCTGTGG - Intergenic
1189211450 X:39287408-39287430 GCTCCTGCCTCATTTCTTTCAGG - Intergenic
1190699692 X:52978306-52978328 GCTGTTCCCGCATTTCCCTGGGG - Intronic
1190729784 X:53218063-53218085 TCTAGTCCCTCACTTCACTGGGG + Intronic
1192203724 X:69082787-69082809 GCGTTTCCCACATTTCTCTGTGG - Intergenic
1202176836 Y:22105899-22105921 ACTCTCGCCTCATTTCTCTGTGG - Intergenic
1202214525 Y:22480485-22480507 ACTCTCGCCTCATTTCTCTGTGG + Intergenic