ID: 1140504826

View in Genome Browser
Species Human (GRCh38)
Location 16:75464628-75464650
Sequence AGGGACGAGCGCCCGAAGTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 38}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504814_1140504826 27 Left 1140504814 16:75464578-75464600 CCGCCGCTCCCCTCGCGCTCCAT 0: 1
1: 0
2: 0
3: 17
4: 252
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504825_1140504826 -10 Left 1140504825 16:75464615-75464637 CCACAGAGAAATGAGGGACGAGC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504816_1140504826 19 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504815_1140504826 24 Left 1140504815 16:75464581-75464603 CCGCTCCCCTCGCGCTCCATCCC 0: 1
1: 0
2: 7
3: 109
4: 1146
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504822_1140504826 -3 Left 1140504822 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 3
3: 23
4: 225
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504820_1140504826 4 Left 1140504820 16:75464601-75464623 CCCGTCGCCATTCACCACAGAGA 0: 1
1: 0
2: 4
3: 13
4: 113
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504819_1140504826 8 Left 1140504819 16:75464597-75464619 CCATCCCGTCGCCATTCACCACA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504817_1140504826 18 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504818_1140504826 17 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38
1140504821_1140504826 3 Left 1140504821 16:75464602-75464624 CCGTCGCCATTCACCACAGAGAA 0: 1
1: 0
2: 0
3: 3
4: 130
Right 1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504826 Original CRISPR AGGGACGAGCGCCCGAAGTG CGG Exonic
900627260 1:3614121-3614143 ATGGACGAGCGAGCGCAGTGGGG - Intergenic
902043986 1:13512163-13512185 AGGGATGAGCACCCAGAGTGAGG - Intronic
1067238103 10:44468577-44468599 AGGGAGGTGCGCCCGAAGCAAGG + Intergenic
1067545272 10:47188256-47188278 AGGGACTAGCCCCTGAGGTGAGG + Intergenic
1069456818 10:68560543-68560565 AGGCCCGAGCCCCCGAGGTGAGG - Intergenic
1076351868 10:129821410-129821432 AGGAAAGAGCCCCTGAAGTGGGG - Intergenic
1086408443 11:86519911-86519933 AGGGACGTGTGACTGAAGTGCGG + Intronic
1087717494 11:101625381-101625403 AGGGATGTGCTCCCCAAGTGGGG - Intronic
1096612494 12:52812002-52812024 AGTGATGAGGGCCTGAAGTGTGG + Intronic
1098897840 12:76084032-76084054 AGGGACGAGTCCCCGAGGCGGGG - Intronic
1101253873 12:102958660-102958682 GGGGACGTGCTCCCGAAGGGTGG - Exonic
1103443426 12:120979524-120979546 AGGGAGGAGGGCCCGAAGCTGGG + Intronic
1103541462 12:121669303-121669325 CGGGACGGGCGGCCGGAGTGGGG - Intronic
1103813367 12:123633672-123633694 ACGGAAGTGCGCCGGAAGTGGGG - Exonic
1105814033 13:24017025-24017047 AGTGAGGAGCGCCCGAAGTGTGG + Intronic
1129823667 15:78620663-78620685 AGGGACGGGCGCCCGAGAAGGGG - Intronic
1131406835 15:92171925-92171947 AGGGAGGAGCGCGCTAAGTGAGG - Intronic
1133754373 16:8751522-8751544 ATGCACCAGAGCCCGAAGTGGGG - Intronic
1140504826 16:75464628-75464650 AGGGACGAGCGCCCGAAGTGCGG + Exonic
1142305459 16:89281965-89281987 AGGGACGAGGGCCCGAGGCTCGG - Exonic
1146445381 17:32928360-32928382 GGGGCCGCGCGCCCGAAGTTGGG + Intronic
1152648616 17:81481747-81481769 AGGGCCCAGCGCCTGAAGCGCGG + Intergenic
1155537378 18:26831511-26831533 AGGGAAGAAAGCCCTAAGTGAGG - Intergenic
1166387208 19:42389095-42389117 AGGGAAGGGTGGCCGAAGTGCGG - Intronic
932222616 2:70011392-70011414 AGGGATGAGCGCCTGAGCTGAGG + Intergenic
938310323 2:130285134-130285156 AGGGAGGAGGGCCCGAAGCCTGG - Intergenic
938444607 2:131367235-131367257 AGGGAGGAGGGCCCGAAGCCTGG + Intergenic
1174977333 20:55350082-55350104 AGGGACCAGGGCCCTCAGTGAGG + Intergenic
1176360022 21:5987425-5987447 ATGTACAAGCGCCCGAGGTGGGG + Intergenic
1179763496 21:43551125-43551147 ATGTACAAGCGCCCGAGGTGGGG - Intronic
1180208406 21:46277732-46277754 TGGGACGAGGGCCCTCAGTGTGG - Intronic
1180911069 22:19450664-19450686 AGGGAAGAAAGCCCTAAGTGAGG - Exonic
950579782 3:13854653-13854675 CGGGACGAGGGCTGGAAGTGGGG - Exonic
975673089 4:76801644-76801666 AGGGGCGAGCGCCCAAAGGTAGG - Intergenic
1006983012 6:38160888-38160910 CGGGAGGAGCGCCAGAATTGAGG - Intergenic
1030640943 7:112005798-112005820 AGAGAGGAGAGCCAGAAGTGCGG - Intronic
1034911719 7:155003106-155003128 CGCGCCGAGCGCCCGAAGCGCGG + Intergenic
1035530196 8:345294-345316 AGGAACGAGGGCCAGATGTGGGG + Intergenic
1056413450 9:86354447-86354469 AGCGCTGAGCGCCGGAAGTGGGG - Intronic
1056544251 9:87600850-87600872 AGGGACAAGCGCCCCCAGCGTGG + Intronic
1060414486 9:123420863-123420885 AGGGAGGAGGGCCAGCAGTGGGG + Intronic