ID: 1140504827

View in Genome Browser
Species Human (GRCh38)
Location 16:75464634-75464656
Sequence GAGCGCCCGAAGTGCGGTAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504817_1140504827 24 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504820_1140504827 10 Left 1140504820 16:75464601-75464623 CCCGTCGCCATTCACCACAGAGA 0: 1
1: 0
2: 4
3: 13
4: 113
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504816_1140504827 25 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504822_1140504827 3 Left 1140504822 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 3
3: 23
4: 225
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504815_1140504827 30 Left 1140504815 16:75464581-75464603 CCGCTCCCCTCGCGCTCCATCCC 0: 1
1: 0
2: 7
3: 109
4: 1146
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504821_1140504827 9 Left 1140504821 16:75464602-75464624 CCGTCGCCATTCACCACAGAGAA 0: 1
1: 0
2: 0
3: 3
4: 130
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504825_1140504827 -4 Left 1140504825 16:75464615-75464637 CCACAGAGAAATGAGGGACGAGC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504818_1140504827 23 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74
1140504819_1140504827 14 Left 1140504819 16:75464597-75464619 CCATCCCGTCGCCATTCACCACA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504827 Original CRISPR GAGCGCCCGAAGTGCGGTAG CGG Exonic
906950754 1:50333173-50333195 GAGCGCCCGGAGCCCGGCAGGGG - Intergenic
915350996 1:155225862-155225884 GATCGCCTGAATTGAGGTAGTGG + Intergenic
1069325150 10:67224538-67224560 GAGTGCCCCAACTGCGGAAGTGG + Intronic
1088387599 11:109276318-109276340 GAGCGCCCAAAGTGTGTAAGGGG - Intergenic
1093646790 12:21595337-21595359 GAGTGCCCCAACTGCGGAAGTGG + Intronic
1107184708 13:37505182-37505204 GAGTGCCCCAACTGCGGAAGTGG + Intergenic
1110609792 13:77475581-77475603 GAGCCCACGAAGTGCGGGGGAGG + Intergenic
1110627526 13:77668361-77668383 GAGTGCCCAAACTGCGGAAGTGG + Intergenic
1112035501 13:95492988-95493010 GAGTGCCCCAACTGCGGAAGTGG - Intronic
1113329824 13:109317284-109317306 GAGTGCCCCAACTGCGGAAGTGG + Intergenic
1115835613 14:37398289-37398311 GAGTGCCCCAACTGCGGAAGTGG - Intronic
1115996798 14:39203533-39203555 GAGAGCCCCAATTGCGGAAGTGG + Intergenic
1116049155 14:39781830-39781852 GAGTGCCCCAACTGCGGAAGTGG - Intergenic
1116728967 14:48598057-48598079 GAGCGACAGAAGTGCAATAGTGG + Intergenic
1124380604 15:29161985-29162007 GAGTGCCCAAACTGCGGAAGTGG + Intronic
1128238594 15:66084482-66084504 GAGTGCCCCAAGTGTGGAAGTGG + Intronic
1133881567 16:9787405-9787427 GATAACCCGAAGTGGGGTAGAGG - Intronic
1135468655 16:22709524-22709546 GAGGGCCAGAACTGGGGTAGAGG - Intergenic
1137542365 16:49373642-49373664 TAGCGCCTGAAGAGGGGTAGTGG + Intergenic
1138798100 16:59993842-59993864 GAGTGCCCCAACTGCGGAAGTGG - Intergenic
1140504827 16:75464634-75464656 GAGCGCCCGAAGTGCGGTAGCGG + Exonic
1143427764 17:6853801-6853823 GAGTGCCCCAACTGCGGAAGTGG + Intergenic
1144315047 17:14051779-14051801 GAGTGCATGAGGTGCGGTAGGGG - Intergenic
1150535570 17:66035894-66035916 GAGCTCCCGAAGTGTGATGGGGG + Intronic
1158002492 18:52636017-52636039 GAGCGCCCCAACTGCGGAAGCGG + Intronic
1162101712 19:8342983-8343005 GAGCTCCCGAAGGGCGAGAGGGG + Intronic
1163419473 19:17206091-17206113 CAGCACCCGACTTGCGGTAGAGG - Exonic
1163755774 19:19105467-19105489 GAGCGCCCAAAGTGCGGAGGCGG - Intronic
926916130 2:17893733-17893755 GAGTGCCCCAACTGCGGAAGTGG - Intronic
929805889 2:45144868-45144890 GAGTGCCCAAACTGCGGAAGTGG + Intergenic
931553829 2:63477708-63477730 GAGTGCCCGAAGTGTGAAAGTGG + Intronic
933121246 2:78541449-78541471 GAGTGCCCAAACTGCGGAAGTGG + Intergenic
938598389 2:132812087-132812109 GAGTGCCCCAACTGCGGAAGTGG - Intronic
941627311 2:167844420-167844442 GAGTGCCCCAACTGCGGTAGTGG + Intergenic
942708217 2:178801005-178801027 GAGCGCTAGATGTGAGGTAGAGG - Intronic
943345706 2:186734795-186734817 GAGTGCCCAAAGTCCGGAAGGGG + Intronic
945482701 2:210361480-210361502 GAGTGCCCAAAGTGCGGAAGTGG - Intergenic
945864413 2:215161034-215161056 GAGTGCCCCAACTGCGGAAGTGG + Intergenic
1173566424 20:44041570-44041592 GAGACCCTGAAGTGCGGTTGGGG + Intronic
1178958904 21:37046714-37046736 GAGCGCCCCAACTGCAGAAGTGG + Intergenic
1184105698 22:42366451-42366473 GAGCTCCTGAAGTGGGGCAGTGG + Intergenic
959046862 3:101484553-101484575 GAGTGCCCCAACTGCGGAAGTGG + Intronic
959591842 3:108090713-108090735 GAGCGCCCGAAGTGCAGACGTGG - Intronic
960513031 3:118572623-118572645 GAGTGCCCCAACTGCGGAAGTGG - Intergenic
973816177 4:54621555-54621577 GGGCGTCTGAAGTGGGGTAGGGG - Intergenic
974325129 4:60404408-60404430 GAGCAACCAAAGTGGGGTAGGGG + Intergenic
975680084 4:76867749-76867771 GAGTGCCCTAATTGCGGAAGCGG + Intergenic
976556062 4:86452923-86452945 GAGCGCCCAAACTGTGGAAGTGG + Intronic
977733107 4:100379319-100379341 GAGTGCCTCAACTGCGGTAGAGG + Intergenic
977852602 4:101848174-101848196 GAGTGCCCCAACTGCGGAAGTGG - Intronic
981559609 4:146032914-146032936 GAGTGCCCCAACTGCGGAAGTGG + Intergenic
985240933 4:187930048-187930070 GAGTGCCCAAACTGCGGAAGTGG - Intergenic
993916926 5:93755554-93755576 GAGTGCCCCAACTGCGGAAGCGG + Intronic
994051418 5:95366275-95366297 GAGTGCCCAAAGTGTGGAAGTGG - Intergenic
996325305 5:122266888-122266910 GAGTGCCCCAACTGCGGAAGTGG + Intergenic
1010679210 6:78780634-78780656 GAGTGCCCCAACTGCGGAAGTGG + Intergenic
1015663400 6:135600951-135600973 GAGTGCCCAAACTGCGGAAGTGG - Intergenic
1017190608 6:151649008-151649030 GAGTGCCCCAACTGCGGAAGTGG - Intergenic
1019123595 6:169824667-169824689 GAGTGCCCGAAGTGTGAGAGGGG - Intergenic
1020255045 7:6498190-6498212 GAGCGCCCGAAGTGCTGGCTGGG + Exonic
1023393005 7:39728548-39728570 GGGAGCCCGGAGTGCTGTAGTGG - Intergenic
1027235365 7:76294725-76294747 GAGCGCCGGGGGTGGGGTAGAGG - Intergenic
1028369692 7:90076870-90076892 GTGGGCCTGAAGTGAGGTAGGGG + Intergenic
1031052053 7:116954119-116954141 AAGCGGCCGAAGTGTGGTCGGGG + Intronic
1033259724 7:139832163-139832185 GAGTGCCCCAACTGCGGAAGTGG + Intronic
1041364052 8:57082986-57083008 GAGTGCCCCAACTGCGGAAGTGG + Intergenic
1045486211 8:102633664-102633686 AAGCCACCGAAGTGCTGTAGCGG + Intergenic
1056154177 9:83817951-83817973 GAGCGCCCGAGTTGGGGGAGAGG + Intronic
1056356330 9:85805158-85805180 GAGCGCCCGAGTTGGGGGAGAGG - Intergenic
1056922433 9:90802190-90802212 GAGCGCGGAAAGTGCGGTCGCGG + Intronic
1057119630 9:92559437-92559459 GAGTGCCCCAATTGCGGAAGTGG - Intronic
1057553220 9:96067235-96067257 GAGGGCCAGATGTGCGGCAGCGG + Intergenic
1185734824 X:2488751-2488773 GAACGCCCGGAGTGGGGCAGAGG - Exonic
1187430779 X:19222195-19222217 GAGTGCCCCAACTGCGGAAGTGG - Intergenic
1189879302 X:45472015-45472037 GAGTGCCCCAACTGCGGAAGTGG - Intergenic
1190895597 X:54614735-54614757 GAGCGCCCGAACAGCGGAAATGG - Intergenic
1192561660 X:72131638-72131660 GAGGGACCGAAGTGCGGCAGCGG + Exonic
1193253511 X:79320131-79320153 GAGTGCCCCAACTGCGGAAGTGG - Intergenic
1195734116 X:107995866-107995888 GAGCGCCCAAAGTGTGAGAGGGG + Intergenic
1196235409 X:113274248-113274270 GAGTGCCCCAACTGCGGAAGTGG + Intergenic
1198843112 X:140880369-140880391 GAGTGCCCCAACTGCGGAAGTGG + Intergenic