ID: 1140504828

View in Genome Browser
Species Human (GRCh38)
Location 16:75464638-75464660
Sequence GCCCGAAGTGCGGTAGCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504821_1140504828 13 Left 1140504821 16:75464602-75464624 CCGTCGCCATTCACCACAGAGAA 0: 1
1: 0
2: 0
3: 3
4: 130
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504816_1140504828 29 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504825_1140504828 0 Left 1140504825 16:75464615-75464637 CCACAGAGAAATGAGGGACGAGC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504819_1140504828 18 Left 1140504819 16:75464597-75464619 CCATCCCGTCGCCATTCACCACA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504818_1140504828 27 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504820_1140504828 14 Left 1140504820 16:75464601-75464623 CCCGTCGCCATTCACCACAGAGA 0: 1
1: 0
2: 4
3: 13
4: 113
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504822_1140504828 7 Left 1140504822 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 3
3: 23
4: 225
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504817_1140504828 28 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504828 Original CRISPR GCCCGAAGTGCGGTAGCGGC CGG Exonic