ID: 1140504828

View in Genome Browser
Species Human (GRCh38)
Location 16:75464638-75464660
Sequence GCCCGAAGTGCGGTAGCGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140504825_1140504828 0 Left 1140504825 16:75464615-75464637 CCACAGAGAAATGAGGGACGAGC 0: 1
1: 0
2: 1
3: 6
4: 108
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504822_1140504828 7 Left 1140504822 16:75464608-75464630 CCATTCACCACAGAGAAATGAGG 0: 1
1: 0
2: 3
3: 23
4: 225
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504818_1140504828 27 Left 1140504818 16:75464588-75464610 CCTCGCGCTCCATCCCGTCGCCA 0: 1
1: 0
2: 0
3: 4
4: 83
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504820_1140504828 14 Left 1140504820 16:75464601-75464623 CCCGTCGCCATTCACCACAGAGA 0: 1
1: 0
2: 4
3: 13
4: 113
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504821_1140504828 13 Left 1140504821 16:75464602-75464624 CCGTCGCCATTCACCACAGAGAA 0: 1
1: 0
2: 0
3: 3
4: 130
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504819_1140504828 18 Left 1140504819 16:75464597-75464619 CCATCCCGTCGCCATTCACCACA 0: 1
1: 0
2: 1
3: 9
4: 137
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504816_1140504828 29 Left 1140504816 16:75464586-75464608 CCCCTCGCGCTCCATCCCGTCGC 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40
1140504817_1140504828 28 Left 1140504817 16:75464587-75464609 CCCTCGCGCTCCATCCCGTCGCC 0: 1
1: 0
2: 0
3: 7
4: 98
Right 1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG 0: 1
1: 0
2: 0
3: 3
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140504828 Original CRISPR GCCCGAAGTGCGGTAGCGGC CGG Exonic
905626522 1:39493193-39493215 GCCCGAAGTGGGGGAGCTGTGGG + Intronic
905869416 1:41394670-41394692 GAGGGAAGGGCGGTAGCGGCCGG - Intergenic
910427526 1:87131940-87131962 GCCCGAGGCGCGGTCGCAGCCGG + Intronic
910676504 1:89821397-89821419 GCCCGAGCTGCGGTTGCGGCCGG + Intronic
915545877 1:156597455-156597477 GCCCGAAGTGGGGTAGTAGATGG + Intronic
921839128 1:219809751-219809773 GCAGGAAATGCGGTGGCGGCTGG - Intronic
1079130804 11:17745837-17745859 GCACGAAGTGGGGAAGGGGCCGG - Intronic
1096309176 12:50505191-50505213 GCCTGAAGTGCGGGCGCAGCTGG + Exonic
1133881565 16:9787401-9787423 ACCCGAAGTGGGGTAGAGGGTGG - Intronic
1134539935 16:15056037-15056059 GCCCGAGGGGCGGGGGCGGCGGG - Exonic
1137785456 16:51134398-51134420 GCCCGGAGTGCGGGAGCCCCGGG + Intergenic
1140124403 16:72107793-72107815 GCCCAAGGTGGGGCAGCGGCTGG + Exonic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141989654 16:87602699-87602721 GCCCGCAGCGCGGCAGCCGCAGG + Intronic
1146716293 17:35089319-35089341 GCGCGGAGGGCGGGAGCGGCCGG - Exonic
1150168408 17:62966388-62966410 GCGCGGAGGGCGGTGGCGGCGGG - Intergenic
1151850149 17:76685190-76685212 GCCAGGAGTGCTGTAGAGGCTGG + Intronic
1155593435 18:27454384-27454406 GCAGGAAGTGCTGTAGCGGAGGG - Intergenic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1164644009 19:29844932-29844954 GCCCGCACTGCGGGAGGGGCAGG + Intergenic
1166219133 19:41353903-41353925 GCGCGAAGGGCGGCGGCGGCGGG + Exonic
1168098674 19:54129315-54129337 GCCCGAGGAGCGGTCGCGGATGG - Exonic
929200332 2:39228574-39228596 GCAGGAAGTGCGGAAGCTGCTGG - Intronic
937204382 2:120226038-120226060 GCCAGAGGTGGGGTAGGGGCAGG + Intergenic
939034564 2:137115263-137115285 GCCCTCAGTGCGGCAGCTGCTGG - Exonic
944811065 2:203328200-203328222 GCCGGAAGTGGGGGAGGGGCCGG + Exonic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
946702116 2:222424500-222424522 GCCCGGAGTGCGGGATCGGCGGG + Exonic
1175443791 20:59007236-59007258 GCCCAAAGTGCGGGGTCGGCCGG - Exonic
1176029829 20:63006595-63006617 GCCCGGAGTGCCGTAGCCGCGGG + Exonic
968724860 4:2242082-2242104 GCACGGAGGGCGGTGGCGGCGGG - Exonic
971279992 4:25234577-25234599 GCCCGCGGTGCGGCTGCGGCTGG - Intronic
985888862 5:2700420-2700442 GCCCGAAGGGCGGTGGCCACAGG - Intergenic
995650250 5:114361662-114361684 GCCCGACGTGCTGCAGTGGCTGG + Intronic
995852345 5:116559469-116559491 GCCCCAAGTGCGGATGGGGCAGG - Intronic
1003087132 6:3068948-3068970 GCCCGACTTCCGGTACCGGCGGG - Intronic
1019327525 7:445689-445711 GCCCGCAGTGGGGAAGGGGCAGG - Intergenic
1023000314 7:35801414-35801436 GCCCGGGGCGCGGCAGCGGCGGG + Intronic
1026047976 7:66921248-66921270 GCCCGAACTGAGGCGGCGGCGGG + Exonic
1028369694 7:90076874-90076896 GCCTGAAGTGAGGTAGGGGGAGG + Intergenic
1034895880 7:154876041-154876063 GCACGAAGTGAGGCGGCGGCTGG + Exonic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1060979945 9:127786065-127786087 GCCTGGAGTGCGGCGGCGGCGGG + Exonic
1186789696 X:12984906-12984928 GCCTGAAGTGTGGTAGCGCTGGG - Intergenic