ID: 1140505731

View in Genome Browser
Species Human (GRCh38)
Location 16:75471028-75471050
Sequence GCCCTTAGTGAGGCCGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140505731_1140505739 20 Left 1140505731 16:75471028-75471050 CCTGCCTCGGCCTCACTAAGGGC No data
Right 1140505739 16:75471071-75471093 ACTGCACCCAGCCTAGGGCAGGG No data
1140505731_1140505735 14 Left 1140505731 16:75471028-75471050 CCTGCCTCGGCCTCACTAAGGGC No data
Right 1140505735 16:75471065-75471087 TGAACCACTGCACCCAGCCTAGG No data
1140505731_1140505738 19 Left 1140505731 16:75471028-75471050 CCTGCCTCGGCCTCACTAAGGGC No data
Right 1140505738 16:75471070-75471092 CACTGCACCCAGCCTAGGGCAGG No data
1140505731_1140505740 21 Left 1140505731 16:75471028-75471050 CCTGCCTCGGCCTCACTAAGGGC No data
Right 1140505740 16:75471072-75471094 CTGCACCCAGCCTAGGGCAGGGG No data
1140505731_1140505736 15 Left 1140505731 16:75471028-75471050 CCTGCCTCGGCCTCACTAAGGGC No data
Right 1140505736 16:75471066-75471088 GAACCACTGCACCCAGCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140505731 Original CRISPR GCCCTTAGTGAGGCCGAGGC AGG (reversed) Intergenic