ID: 1140514231

View in Genome Browser
Species Human (GRCh38)
Location 16:75530599-75530621
Sequence CTGTAGGTATGTAAGTAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 653}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140514231 Original CRISPR CTGTAGGTATGTAAGTAGGT GGG (reversed) Exonic
900921977 1:5678650-5678672 GGGAAGGTAGGTAAGTAGGTAGG + Intergenic
900921978 1:5678654-5678676 AGGTAGGTAAGTAGGTAGGTAGG + Intergenic
902322161 1:15675675-15675697 ATGTAGGTAGGTAGGTAGGCAGG - Intergenic
902322163 1:15675683-15675705 AGGTAGGTATGTAGGTAGGTAGG - Intergenic
902322176 1:15675743-15675765 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
902322177 1:15675747-15675769 CAGTAGGTAGGTAGGTAGGTAGG - Intergenic
902322187 1:15675794-15675816 AGGTAGGTATGTAGGTAGGTAGG - Intergenic
902322204 1:15675874-15675896 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
902322216 1:15675930-15675952 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
902322225 1:15675970-15675992 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
902322226 1:15675974-15675996 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
902914635 1:19629360-19629382 CTGTATGTATTTATGTATGTTGG - Exonic
904212901 1:28897543-28897565 CTGTAGGTAGGTAGGTAGGAAGG + Intronic
904853023 1:33473245-33473267 CAGTGGGTAAGTAGGTAGGTAGG - Intronic
905134880 1:35791057-35791079 AAGTAGGTAGGTATGTAGGTAGG + Intergenic
906794939 1:48689376-48689398 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
906794940 1:48689380-48689402 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
906794941 1:48689384-48689406 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
907999107 1:59663160-59663182 CTGTAACCCTGTAAGTAGGTGGG + Intronic
909139477 1:71845738-71845760 ATGTAGGTAGGTAGGTAGGTAGG - Intronic
909502232 1:76347358-76347380 AAGTAGGTAAGTAAGTGGGTGGG - Intronic
909554002 1:76932469-76932491 CTTTAGGTAAGTATGTAAGTAGG + Intronic
909618402 1:77639065-77639087 CGGTAGGTAGGTAGGTAGGTAGG + Intronic
909618403 1:77639069-77639091 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
910537295 1:88312968-88312990 TTGTAGGTAGGTAGGTAGGTAGG + Intergenic
913508724 1:119543176-119543198 CTCCAGGTAAGTAAGTAAGTAGG + Intergenic
916145881 1:161739034-161739056 CTGAAGGTATAGAAGCAGGTGGG + Intergenic
917639661 1:176970557-176970579 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
917639662 1:176970561-176970583 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
917639663 1:176970565-176970587 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
917899215 1:179525476-179525498 ATGTATGTATGTATGTATGTAGG - Intronic
918216156 1:182392904-182392926 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
918271004 1:182899345-182899367 AGGTAGGTATGTAGGTAGGTAGG - Intergenic
918271005 1:182899349-182899371 TGGTAGGTAGGTATGTAGGTAGG - Intergenic
918606114 1:186428155-186428177 CTCTAGCTATGAAAGTAGATGGG + Intergenic
918717591 1:187809660-187809682 ATGTATGTATGTAGGTAGGTAGG - Intergenic
918717592 1:187809664-187809686 TTGTATGTATGTATGTAGGTAGG - Intergenic
921067653 1:211633952-211633974 CTGGAGATATGTGTGTAGGTGGG - Intergenic
922471277 1:225878863-225878885 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
922471278 1:225878867-225878889 GTGTAGGTAGGTAGGTAGGTAGG - Intronic
923073485 1:230588277-230588299 ATGCAGGTAAGTAGGTAGGTAGG + Intergenic
923073492 1:230588321-230588343 GTGTAGGTAAGTAAGTAGGTGGG + Intergenic
923073547 1:230588733-230588755 GTGCAGGTAAGTAGGTAGGTGGG + Intergenic
923073554 1:230588773-230588795 GTGCAGGTAAGTAGGTAGGTGGG + Intergenic
923073570 1:230588869-230588891 GTGTAGGTAAGTAAGTAGGTGGG + Intergenic
923282731 1:232460424-232460446 TTGTAGGTATGAAAGAATGTTGG - Intronic
923469217 1:234275561-234275583 TTGTAGGTAGGTAGTTAGGTAGG + Intronic
923771851 1:236944406-236944428 CTCTGATTATGTAAGTAGGTAGG - Intergenic
923995733 1:239492211-239492233 CTCTAGGTAGGTAGGTAGGTAGG - Intronic
924051582 1:240084926-240084948 CTGTAGGGATGGAAGTGGGTGGG + Intronic
924459602 1:244247235-244247257 CAGTAGGTAGGTAGGTGGGTAGG - Intergenic
1063860195 10:10298686-10298708 AGGTAGGTAAGTAGGTAGGTAGG + Intergenic
1064381533 10:14846221-14846243 TTATAGGTAGGTAGGTAGGTAGG + Intronic
1064589394 10:16873104-16873126 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1064589395 10:16873108-16873130 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1065148176 10:22794055-22794077 CTGTAGGTATATAAGTTTGTAGG - Intergenic
1065252515 10:23830668-23830690 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1065252516 10:23830672-23830694 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1065252517 10:23830676-23830698 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1065252518 10:23830680-23830702 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1065252519 10:23830684-23830706 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1065387719 10:25149927-25149949 CTGCAGGTATGTTAGCAGGCTGG + Intergenic
1066112207 10:32207463-32207485 CTGGAGTGATGTAAGGAGGTGGG + Intergenic
1066122293 10:32301097-32301119 ATGTAGGTACGTAGGTAGGTAGG - Intronic
1068378746 10:56219089-56219111 CTCTAGGTATGTATGTACATAGG + Intergenic
1069085012 10:64128901-64128923 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1070310083 10:75266582-75266604 CTGTATGTATGTAAGGTGGATGG + Intergenic
1070496526 10:77029136-77029158 CTGTAAGTATGTAAGTGTATAGG - Intronic
1070531607 10:77342067-77342089 CTGCAAGGATGTCAGTAGGTTGG - Intronic
1070638235 10:78146288-78146310 AGGTAGGTACGTAGGTAGGTAGG + Intergenic
1073953736 10:108842568-108842590 TAGTAGGTAGGTAGGTAGGTAGG + Intergenic
1073953737 10:108842572-108842594 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1073953738 10:108842576-108842598 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1073953739 10:108842580-108842602 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1073953740 10:108842584-108842606 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1073953741 10:108842588-108842610 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1073953742 10:108842592-108842614 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1075304218 10:121353548-121353570 AGGTAGGTAGGTAAGCAGGTAGG + Intergenic
1075502481 10:122988352-122988374 CTGTATGTTTTTAAATAGGTGGG - Intronic
1076323280 10:129599964-129599986 CTATAGGTAAGTAGGTAGGTAGG + Intronic
1076323282 10:129599972-129599994 AAGTAGGTAGGTAGGTAGGTAGG + Intronic
1076323283 10:129599976-129599998 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1076323284 10:129599980-129600002 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1077676285 11:4195942-4195964 AGATAGGTAGGTAAGTAGGTAGG - Intergenic
1079041582 11:17064732-17064754 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1079041583 11:17064736-17064758 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1079041584 11:17064740-17064762 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1079716287 11:23750426-23750448 AGGAAGGTATGTAGGTAGGTAGG + Intergenic
1082119350 11:48361663-48361685 ATGTATGTATGTATGTATGTAGG + Intergenic
1083188109 11:61029661-61029683 GTGTAGGTAGGTAGGTAGGTAGG + Intergenic
1083718926 11:64594488-64594510 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1083718927 11:64594492-64594514 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1083718928 11:64594496-64594518 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1083718929 11:64594500-64594522 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1085969204 11:81566587-81566609 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1085969205 11:81566591-81566613 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1085969206 11:81566595-81566617 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1085969207 11:81566599-81566621 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1085969208 11:81566603-81566625 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1085969209 11:81566607-81566629 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1085969210 11:81566611-81566633 ATGTAGGTAGGTAGGTAGGTAGG - Intergenic
1085969212 11:81566619-81566641 AGGTAGGCATGTAGGTAGGTAGG - Intergenic
1086143078 11:83520565-83520587 AGCTAGGTAGGTAAGTAGGTAGG + Intronic
1086258984 11:84914932-84914954 ATTGAGGTATGTAAGTGGGTAGG + Intronic
1088144380 11:106657826-106657848 CTGTAGGTTGGTAGGTAGGTAGG - Intergenic
1088504414 11:110514306-110514328 CTGACGGTAGGTAAGTAGGCAGG + Intergenic
1089387765 11:118079316-118079338 CTGTGGGGATGGAAGGAGGTAGG - Intronic
1090239889 11:125174618-125174640 CTGTAGGCAGGTGAGTGGGTGGG + Intronic
1090336830 11:125974339-125974361 TTGTAGGTAGGTAGGTAGGTAGG + Intronic
1090336831 11:125974343-125974365 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1090336832 11:125974347-125974369 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1090497994 11:127233365-127233387 GTGTATGTGTGTAGGTAGGTAGG - Intergenic
1092790369 12:12065606-12065628 CTGTGGGAAGGTAAGTAGATGGG + Intronic
1093285267 12:17252447-17252469 AGGTAGGTAGGTAAATAGGTAGG - Intergenic
1093776434 12:23080470-23080492 TAATAGGTACGTAAGTAGGTAGG + Intergenic
1093863286 12:24194407-24194429 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1093863288 12:24194419-24194441 AGGTAGGTAGGTATGTAGGTAGG + Intergenic
1093863289 12:24194423-24194445 AGGTAGGTATGTAGGTAGGTAGG + Intergenic
1093863291 12:24194431-24194453 ATGTAGGTAGGTAGGTAGGTAGG + Intergenic
1094290817 12:28847671-28847693 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1094332263 12:29307408-29307430 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1094473043 12:30820971-30820993 CTGTAGGTATGTCTTTAGGCAGG - Intergenic
1094555355 12:31494225-31494247 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1094555356 12:31494229-31494251 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1094555357 12:31494233-31494255 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1096028432 12:48388745-48388767 ATATGAGTATGTAAGTAGGTGGG - Intergenic
1096056379 12:48655901-48655923 ATGTATGTGTGTAAGTAGGTGGG - Intronic
1098451708 12:70626402-70626424 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1099116982 12:78639469-78639491 CTGTACATATTTAAGTAGGGTGG + Intergenic
1099739335 12:86611390-86611412 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1099739336 12:86611394-86611416 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1099739337 12:86611398-86611420 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1099830130 12:87831940-87831962 AGGTAGGTAGGTAAGTAGGTAGG + Intergenic
1099830131 12:87831944-87831966 AGGTAGGTAAGTAGGTAGGTAGG + Intergenic
1099931575 12:89081634-89081656 CAGTAGCAATGGAAGTAGGTAGG - Intergenic
1100841035 12:98612021-98612043 AGGTAGGTAGGTAGGTAGGTGGG - Intergenic
1100841037 12:98612025-98612047 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1100931511 12:99615140-99615162 CATTAGGTAGGTAGGTAGGTAGG + Intronic
1102996282 12:117353344-117353366 GTGAAGATAGGTAAGTAGGTAGG - Intronic
1103132625 12:118482359-118482381 CTGGAGGTCTGTAACAAGGTTGG + Intergenic
1103829349 12:123766288-123766310 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1103829350 12:123766292-123766314 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1103908463 12:124339367-124339389 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1103908464 12:124339371-124339393 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1103908465 12:124339375-124339397 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1103908466 12:124339379-124339401 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1103908467 12:124339383-124339405 TGGTAGGTAGGTAGGTAGGTAGG - Intronic
1103908482 12:124339447-124339469 CGTTAGGTAGGTAAGTAGATGGG - Intronic
1104504757 12:129320977-129320999 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1105680371 13:22719855-22719877 ATGTAGGTAGATAGGTAGGTAGG + Intergenic
1107022069 13:35762286-35762308 GTGTAGGTATGTATGTGTGTAGG - Intergenic
1108131136 13:47301852-47301874 AGGTAGGTATGTAGGTAGGTAGG - Intergenic
1108163048 13:47662792-47662814 GTGTATGTATGTATGTAGGCAGG - Intergenic
1109514304 13:63421635-63421657 TTGTAGGTATTTATTTAGGTTGG + Intergenic
1109571790 13:64202122-64202144 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1109571791 13:64202126-64202148 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1109571792 13:64202130-64202152 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1109571793 13:64202134-64202156 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1109571794 13:64202138-64202160 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1109918911 13:69030184-69030206 CTGTATGCATGTAGGTAGGTAGG - Intergenic
1111385837 13:87526200-87526222 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1111711964 13:91828349-91828371 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1111711965 13:91828353-91828375 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1111711966 13:91828357-91828379 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1111711967 13:91828361-91828383 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1111711968 13:91828365-91828387 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1112357134 13:98683101-98683123 ATGTAGGTAGGTAGGTAGGCAGG - Intergenic
1112786924 13:102961393-102961415 AGGTAGGTAGGTAGGTAGGTGGG - Intergenic
1113348202 13:109501877-109501899 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1113348203 13:109501881-109501903 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1113348204 13:109501885-109501907 CAGTAGGTAGGTAGGTAGGTAGG - Intergenic
1114090571 14:19285179-19285201 TGGTAGGTAAGTAGGTAGGTAGG - Intergenic
1114673370 14:24425939-24425961 CTTTATCTATGTAAGTAGGGAGG - Intergenic
1114811826 14:25909788-25909810 ACATAGGTAAGTAAGTAGGTAGG + Intergenic
1117455554 14:55893588-55893610 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1117784888 14:59272649-59272671 ATGTATGTATGTATGTATGTAGG + Intronic
1117928268 14:60808571-60808593 GTATAGGTATGTAGGTAGGCAGG + Intronic
1118072462 14:62260824-62260846 GGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1118818836 14:69331577-69331599 CTGTAGACATGAAAGGAGGTAGG + Intronic
1119091518 14:71786107-71786129 TAGTAGATAGGTAAGTAGGTAGG - Intergenic
1120120256 14:80670407-80670429 GTGTATGTATATAAATAGGTAGG - Intronic
1120166482 14:81207130-81207152 AGGTAGGTAGGTACGTAGGTAGG - Intronic
1120166484 14:81207142-81207164 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1120166485 14:81207146-81207168 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1120166486 14:81207150-81207172 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1120166487 14:81207154-81207176 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1120166488 14:81207158-81207180 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1120166489 14:81207162-81207184 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1120166490 14:81207166-81207188 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1120166491 14:81207170-81207192 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1120440079 14:84525563-84525585 ATGTGGGTAGATAAGTAGGTAGG + Intergenic
1121092952 14:91195509-91195531 CTGAAGGTATGCAGGGAGGTAGG + Intronic
1121114615 14:91334977-91334999 CTGCAGGTATCTGAGAAGGTGGG + Intronic
1123584924 15:21750641-21750663 ATGTATGTATGTATGTATGTAGG + Intergenic
1123820180 15:24021652-24021674 ATGTAGGTAGGTAAGTAGGTAGG + Intergenic
1125799188 15:42429590-42429612 TTTTAGGTATGAAAGAAGGTTGG - Intronic
1126446341 15:48749173-48749195 TGGTAGGTAGGTAAGTGGGTTGG + Intronic
1126544772 15:49861477-49861499 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1126544773 15:49861481-49861503 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1126574411 15:50183012-50183034 CTGTAGGTATAGAAAAAGGTTGG + Intronic
1127357617 15:58215694-58215716 CTGTAGGTAGATAGATAGGTAGG - Intronic
1127553817 15:60067464-60067486 AAGTAGGTAGGTAGGTAGGTAGG + Intergenic
1127553818 15:60067468-60067490 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1128499467 15:68217876-68217898 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1128499468 15:68217880-68217902 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1128499469 15:68217884-68217906 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1128499470 15:68217888-68217910 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1128499471 15:68217892-68217914 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1128499472 15:68217896-68217918 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1129603109 15:77011829-77011851 CTGTAGGTATGGAAAGAGGGTGG - Intronic
1131484134 15:92806572-92806594 GTGTATGTATGTAGGTAGGCAGG + Intronic
1131484137 15:92806610-92806632 GTGTATGTATGTAAGTAGGTAGG + Intronic
1131572906 15:93557119-93557141 ATATAGGTAGGTAGGTAGGTAGG + Intergenic
1131572907 15:93557123-93557145 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1133019297 16:2960020-2960042 AGGTAGGTAGGTAGGTAGGTTGG - Intergenic
1133019298 16:2960024-2960046 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1133163381 16:3927993-3928015 TTGTAGGTAGGTAGGTAGGTAGG - Intergenic
1136660641 16:31757828-31757850 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1138848179 16:60593031-60593053 ATGTAGGTAGGTATGTATGTAGG + Intergenic
1138926122 16:61593276-61593298 CTGGTGGTAGGTAGGTAGGTAGG + Intergenic
1138926123 16:61593280-61593302 TGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1138926124 16:61593284-61593306 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1139314106 16:66053490-66053512 ATGTATGTATATAGGTAGGTAGG - Intergenic
1139826502 16:69761607-69761629 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1140087711 16:71811278-71811300 AGGTAGGTAGGTAGGTAGGTGGG - Intergenic
1140087713 16:71811282-71811304 GTGTAGGTAGGTAGGTAGGTAGG - Intergenic
1140087716 16:71811294-71811316 GTGTAGGTATGTGTGTAGGTAGG - Intergenic
1140310623 16:73844856-73844878 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1140514231 16:75530599-75530621 CTGTAGGTATGTAAGTAGGTGGG - Exonic
1142778454 17:2161038-2161060 TTGTATGTATGTATGTAGGTAGG + Intronic
1142778455 17:2161042-2161064 ATGTATGTATGTAGGTAGGTAGG + Intronic
1142778456 17:2161046-2161068 ATGTATGTAGGTAGGTAGGTAGG + Intronic
1142778457 17:2161050-2161072 ATGTAGGTAGGTAGGTAGGAAGG + Intronic
1143369541 17:6429802-6429824 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1143760483 17:9099529-9099551 AGGTAGGTATATAGGTAGGTAGG - Intronic
1144548520 17:16218978-16219000 CAGTAAGAATGTAAATAGGTAGG - Intronic
1146244076 17:31263037-31263059 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1146244077 17:31263041-31263063 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1146244078 17:31263045-31263067 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1146244084 17:31263077-31263099 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1146244085 17:31263081-31263103 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1146244086 17:31263085-31263107 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1148008351 17:44453477-44453499 TTGTAGGTAGGTAGGTAGGTAGG + Intronic
1149237676 17:54612156-54612178 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1149237677 17:54612160-54612182 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1149237678 17:54612164-54612186 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1149237679 17:54612168-54612190 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1149739447 17:59030861-59030883 CTGTAGGTAGATATGTAAGTTGG - Intronic
1150439956 17:65183111-65183133 AGATAGGTATGTAGGTAGGTAGG - Intronic
1151131466 17:71901580-71901602 AGGTAGATATGTAGGTAGGTAGG - Intergenic
1151266511 17:72960385-72960407 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1151281515 17:73078401-73078423 AGGTAGGTAAGTAAGGAGGTAGG + Intronic
1153299864 18:3583141-3583163 AGGTAGGTAGGTAGGTAGGTCGG - Intronic
1153299865 18:3583145-3583167 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1153299866 18:3583149-3583171 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1153299867 18:3583153-3583175 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1153299868 18:3583157-3583179 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1153299869 18:3583161-3583183 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1153299870 18:3583165-3583187 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1155076688 18:22363498-22363520 GTGTAGGGATGCAAGTAGGAAGG - Intergenic
1155425120 18:25698945-25698967 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1155425121 18:25698949-25698971 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1155425122 18:25698953-25698975 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1155425123 18:25698957-25698979 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1155813348 18:30268701-30268723 AGGTAGATAGGTAAGTAGGTAGG + Intergenic
1156371775 18:36477542-36477564 AGGTAGGTAGGTAGGTAGGTGGG - Intronic
1156371777 18:36477546-36477568 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1156371778 18:36477550-36477572 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1156371779 18:36477554-36477576 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1156371780 18:36477558-36477580 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1156371781 18:36477562-36477584 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1156371782 18:36477566-36477588 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1156371783 18:36477570-36477592 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1156371784 18:36477574-36477596 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1156371785 18:36477578-36477600 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1156690199 18:39698057-39698079 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1156739625 18:40308784-40308806 ATGTATGTATGTATGTATGTAGG + Intergenic
1157272416 18:46286468-46286490 TTGTAGGTATGTACATAGGGTGG + Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159277910 18:66244971-66244993 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1159277911 18:66244975-66244997 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1159277912 18:66244979-66245001 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1159277913 18:66244983-66245005 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1159277914 18:66244987-66245009 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1159310095 18:66696908-66696930 CATTAGGTAGGTAGGTAGGTAGG + Intergenic
1159323086 18:66880199-66880221 AGGTAGGTGTGTAGGTAGGTAGG + Intergenic
1159499019 18:69244790-69244812 AGATAGGTAGGTAAGTAGGTAGG - Intergenic
1159895545 18:73992275-73992297 CTGTCTGTATGTAAGTAGCTAGG - Intergenic
1160112960 18:76051007-76051029 CTCCAGGTGTGTAAGTGGGTTGG - Intergenic
1162203783 19:9040471-9040493 TTGTATGTTTGTAAGCAGGTGGG - Intergenic
1163176908 19:15570762-15570784 AGGTAGGTATATAAGTAGGTAGG - Intergenic
1163290870 19:16378196-16378218 TTGCAGGTAGGTAGGTAGGTAGG + Intronic
1164210615 19:23094421-23094443 CTATAGATAGGTAGGTAGGTAGG + Intronic
1164311355 19:24049085-24049107 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1165735271 19:38171895-38171917 CTGGAGGTAGGTAGGTAGGTAGG + Intronic
1166768272 19:45265304-45265326 ATGTAGGTATGTAGGTGTGTGGG + Intronic
1166907985 19:46127615-46127637 GTATAGGTAGGTAGGTAGGTGGG + Intergenic
927707903 2:25308158-25308180 GTGTAGGTAGGTAGGTAGGTAGG + Intronic
928344494 2:30478689-30478711 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
930077872 2:47422047-47422069 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
930213282 2:48665978-48666000 TTGTAGGTATATAAGTATTTAGG + Intronic
931167108 2:59760179-59760201 CGATAGGTAGGTAGGTAGGTAGG - Intergenic
931203946 2:60128752-60128774 GTGTTGGTAGGTAAGAAGGTAGG - Intergenic
931990734 2:67787634-67787656 ATGAAGGTATGTGAGGAGGTGGG - Intergenic
933103679 2:78293488-78293510 AGGTAGGTATGTAGGTAGGGAGG - Intergenic
933103681 2:78293492-78293514 AGGTAGGTAGGTATGTAGGTAGG - Intergenic
933288450 2:80409462-80409484 CTGTAGCTTTGTTAGTAGTTGGG + Intronic
933450383 2:82441971-82441993 ATGTAGGTATGTGGGTAGATTGG - Intergenic
935585772 2:104798720-104798742 CTGAAGGAATGTGAGTAGATGGG - Intergenic
938539858 2:132277013-132277035 CCGTAGGTAGGTAGGTATGTAGG - Intergenic
938947701 2:136228017-136228039 AGGTAGGTAAGTAGGTAGGTAGG - Intergenic
938947702 2:136228021-136228043 AGGTAGGTAGGTAAGTAGGTAGG - Intergenic
939172724 2:138714192-138714214 CTGTAGGTATGTGCGTACATAGG + Intronic
939694490 2:145307741-145307763 CTCTAGGTGTGTAAGTTGGGCGG + Intergenic
940016638 2:149113172-149113194 CTTTAGATTTGTAAGGAGGTTGG + Intronic
940159592 2:150696978-150697000 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
940159593 2:150696982-150697004 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
940159594 2:150696986-150697008 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
940159595 2:150696990-150697012 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
940159596 2:150696994-150697016 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
940159597 2:150696998-150697020 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
940159598 2:150697002-150697024 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
941535736 2:166720665-166720687 CCCTAGGTATGTAAATAGTTGGG - Intergenic
944965532 2:204927826-204927848 AGGTAGGTAGGTACGTAGGTAGG + Intronic
944965533 2:204927830-204927852 AGGTAGGTACGTAGGTAGGTAGG + Intronic
944965535 2:204927838-204927860 ACGTAGGTAGGTAGGTAGGTAGG + Intronic
945799007 2:214401988-214402010 CTGTGGATATATAAGTTGGTTGG - Intronic
947003376 2:225484249-225484271 CTGTAGGACTGTAAGAAGGATGG + Intronic
1169522946 20:6392739-6392761 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1169522947 20:6392743-6392765 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1169539406 20:6582822-6582844 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1169539407 20:6582826-6582848 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1169539408 20:6582830-6582852 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1169539409 20:6582834-6582856 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1169539410 20:6582838-6582860 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1170265211 20:14459510-14459532 ATGTGTGTATGTATGTAGGTAGG + Intronic
1170910444 20:20561403-20561425 CTGTATGTATGAAAGGAGGCAGG - Intronic
1171070897 20:22067573-22067595 CTGTAGCTAAGTAACTGGGTGGG + Intergenic
1172395667 20:34602623-34602645 ATGTATGTATGTAAGTAGAAGGG + Intronic
1172727464 20:37057008-37057030 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1172727465 20:37057012-37057034 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1172727466 20:37057016-37057038 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1172727467 20:37057020-37057042 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1172727468 20:37057024-37057046 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1172727469 20:37057028-37057050 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1173379050 20:42521047-42521069 ATGTATGTATATAGGTAGGTGGG - Intronic
1173379052 20:42521051-42521073 ATGTATGTATGTATATAGGTAGG - Intronic
1173379057 20:42521116-42521138 GAGTAGGTAGGTAGGTAGGTAGG - Intronic
1173439256 20:43061034-43061056 CTGTAGGTAGGTGGGTAAGTAGG + Intronic
1175528250 20:59651827-59651849 TGGTAGGTAGGTAGGTAGGTAGG + Intronic
1175528251 20:59651831-59651853 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1175528252 20:59651835-59651857 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1175528253 20:59651839-59651861 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1175528254 20:59651843-59651865 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1175528255 20:59651847-59651869 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1175528256 20:59651851-59651873 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1175528257 20:59651855-59651877 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1175558238 20:59890568-59890590 AGGTAGGTAGGTAAGTAGGTAGG + Intronic
1175558239 20:59890572-59890594 AGGTAGGTAAGTAGGTAGGTAGG + Intronic
1175558241 20:59890580-59890602 AAGTAGGTAGGTAGGTAGGTAGG + Intronic
1175558242 20:59890584-59890606 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1177532595 21:22380528-22380550 AGGTAGGTAGGTAAGTAGGTAGG + Intergenic
1177599907 21:23297321-23297343 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1177599908 21:23297325-23297347 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1177944090 21:27445876-27445898 GGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1177944091 21:27445880-27445902 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1177944092 21:27445884-27445906 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1177944093 21:27445888-27445910 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1177944094 21:27445892-27445914 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1178856905 21:36257917-36257939 ATGTAGGTACGTAGGTAGATAGG + Intronic
1178856917 21:36257993-36258015 ATGTAGGTAGGTAGGTAGATAGG + Intronic
1179038547 21:37781872-37781894 CTATATGTAGGTAGGTAGGTAGG - Intronic
1179249059 21:39657688-39657710 AGGTAGGTAGGTAAGTCGGTAGG - Intronic
1180490129 22:15837120-15837142 TGGTAGGTAAGTAGGTAGGTAGG + Intergenic
1181273416 22:21673929-21673951 CTGTAGTGATGTAGGGAGGTGGG + Intronic
1181661738 22:24355462-24355484 AGGTAGGTAGGTAGGTAGGTGGG - Intronic
1181790434 22:25261410-25261432 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1182203087 22:28593471-28593493 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1182203088 22:28593475-28593497 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1182203089 22:28593479-28593501 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1182203090 22:28593483-28593505 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1182203091 22:28593487-28593509 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1182203092 22:28593491-28593513 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1182581215 22:31312869-31312891 CTCTAGATAGGTAGGTAGGTAGG + Intergenic
1182581217 22:31312877-31312899 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1182581218 22:31312881-31312903 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1182581219 22:31312885-31312907 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1182581220 22:31312889-31312911 AGGTAGGTAGGTAGGTAGGTTGG + Intergenic
1182581224 22:31312916-31312938 CTCTAGATAGGTAGGTAGGTAGG + Intergenic
1182581226 22:31312924-31312946 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1182581227 22:31312928-31312950 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1182581228 22:31312932-31312954 AGGTAGGTAGGTAGGTAGGTTGG + Intergenic
1182581232 22:31312959-31312981 CTCTAGATAGGTAGGTAGGTAGG + Intergenic
1184189677 22:42886406-42886428 TGGTATGTATGTAGGTAGGTAGG + Intronic
1184189678 22:42886410-42886432 ATGTATGTAGGTAGGTAGGTAGG + Intronic
1184189679 22:42886414-42886436 ATGTAGGTAGGTAGGTAGGTAGG + Intronic
1184189680 22:42886418-42886440 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1184189681 22:42886422-42886444 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1184189682 22:42886426-42886448 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1184189683 22:42886430-42886452 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1184820169 22:46904146-46904168 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1184820170 22:46904150-46904172 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1184820171 22:46904154-46904176 TGGTAGGTAGGTAGGTAGGTAGG - Intronic
1184973441 22:48043980-48044002 CAGTAGGTAGGTAGATAGGTAGG + Intergenic
949619675 3:5796416-5796438 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
949737935 3:7196033-7196055 CTGTAGGTGGGTAATTAGGTAGG - Intronic
950735711 3:15006470-15006492 ATGTAGGTATGTGAGTGGGCAGG + Intronic
950747213 3:15099958-15099980 CGGTAGGTAGGTAGGTAGGAGGG + Intergenic
950924244 3:16724239-16724261 CTGCATGTATGTTAGTAGATGGG + Intergenic
952716736 3:36487281-36487303 TTGTAGGTAGGTGAATAGGTCGG + Intronic
954550945 3:51481251-51481273 ATGTAGGTATGAATGAAGGTAGG + Intronic
955563450 3:60218856-60218878 ATGTATGTATGTATGTATGTAGG - Intronic
955723369 3:61906777-61906799 CTGTAGGTAGGTAGGTAGGTAGG + Intronic
955723370 3:61906781-61906803 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
955723371 3:61906785-61906807 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
955723372 3:61906789-61906811 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
955723373 3:61906793-61906815 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
955723374 3:61906797-61906819 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
955723375 3:61906801-61906823 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
955723376 3:61906805-61906827 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
955724767 3:61921155-61921177 CTGTAGATAGGTAAGAAGGAAGG - Intronic
956696377 3:71922431-71922453 ATGTAGGTAGTTAGGTAGGTAGG + Intergenic
959244106 3:103841333-103841355 AGGTAGGTAGGTAGGTAGGTCGG - Intergenic
959244107 3:103841337-103841359 CGGTAGGTAGGTAGGTAGGTAGG - Intergenic
959437207 3:106330601-106330623 CAGGAGGTAGGTAGGTAGGTAGG - Intergenic
959476046 3:106813692-106813714 ATTTAGGTATGTATGTATGTAGG - Intergenic
959733792 3:109634151-109634173 CTGTTGGAATTTAAGTAGGATGG - Intergenic
960131446 3:114060474-114060496 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
960648785 3:119922150-119922172 AGGTAGGTAGGTAAGGAGGTAGG + Intronic
960648791 3:119922175-119922197 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
960648792 3:119922179-119922201 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
960726218 3:120672960-120672982 AGGTAGGTAGGTACGTAGGTAGG + Intronic
961090588 3:124107789-124107811 CATTAGGTATGGAAGGAGGTAGG + Intronic
966431154 3:179832623-179832645 GGGTAGGTAAGTAAGTAGGAAGG - Intronic
966431199 3:179832811-179832833 GGGTAGGTAAGTAAGTAAGTAGG - Intronic
966431211 3:179832860-179832882 AAGTAGGTAAGTAACTAGGTAGG - Intronic
966431218 3:179832896-179832918 ATGTAAGTAGGTAGGTAGGTGGG - Intronic
966661729 3:182422014-182422036 CGATAGGTAGGTAGGTAGGTAGG - Intergenic
967333654 3:188318597-188318619 AGGTACTTATGTAAGTAGGTAGG - Intronic
967753650 3:193143342-193143364 CAGTAGTTAGGTAGGTAGGTAGG - Intergenic
968522938 4:1042402-1042424 GTGTAGGTGTGGAAGTGGGTTGG - Intergenic
970560754 4:17279924-17279946 ACGTAGATATATAAGTAGGTAGG + Intergenic
972674806 4:41250044-41250066 CTGTAGGTAGGTAGGTAGGTAGG - Intergenic
972916678 4:43889982-43890004 ATGTATGTATGTATGTATGTAGG - Intergenic
973550541 4:52031339-52031361 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
973550542 4:52031343-52031365 ATATAGGTAGGTAGGTAGGTAGG - Intronic
974356165 4:60815449-60815471 GTGTATGCATGTAAGTATGTAGG - Intergenic
974773187 4:66442857-66442879 GTGTAGACATGTAAGTATGTAGG + Intergenic
974818723 4:67039111-67039133 ATGTAGGTAGGTAGGTAGGTAGG + Intergenic
974920668 4:68235322-68235344 TTGTCTGTAGGTAAGTAGGTTGG + Intronic
975097523 4:70474565-70474587 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
975929305 4:79499438-79499460 GTGAATGTATGTATGTAGGTAGG + Intergenic
976518335 4:85997268-85997290 AGGTAGGTAGGTAAATAGGTAGG + Intronic
976518351 4:85997503-85997525 AGGTAGGTAGGTAAATAGGTAGG + Intronic
976651887 4:87444451-87444473 CAGTAGTTAAGTAAGTAGGTAGG - Intronic
977603719 4:98961208-98961230 CTGTAGGTATTTAAGTTTCTGGG - Intergenic
978521332 4:109618995-109619017 AGGTAGGTAGGTAGGTAGGTTGG - Intronic
978521340 4:109619031-109619053 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
978521341 4:109619035-109619057 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
978521342 4:109619039-109619061 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
978521343 4:109619043-109619065 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
978521344 4:109619047-109619069 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
978521345 4:109619051-109619073 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
978521346 4:109619055-109619077 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
979301445 4:119092120-119092142 TTGTAGGATTGTAAGTAGTTTGG - Intergenic
979601067 4:122586987-122587009 CTGTGGGTAGGTAAATATGTGGG + Intergenic
980246644 4:130254121-130254143 ATGTATGCAGGTAAGTAGGTAGG + Intergenic
980246646 4:130254133-130254155 AAGTAGGTAGGTAAGTAGGTAGG + Intergenic
980246647 4:130254137-130254159 AGGTAGGTAAGTAGGTAGGTAGG + Intergenic
981931190 4:150190936-150190958 ATGTAGATAGGTAGGTAGGTAGG - Intronic
982553162 4:156827714-156827736 GTGTATGTATGTACGTATGTGGG - Intronic
983404192 4:167304659-167304681 GGTTAGGTAGGTAAGTAGGTAGG + Intergenic
983404193 4:167304663-167304685 AGGTAGGTAAGTAGGTAGGTAGG + Intergenic
983404195 4:167304671-167304693 AAGTAGGTAGGTAGGTAGGTAGG + Intergenic
983980983 4:173996839-173996861 GGGTAGGTATTTAGGTAGGTAGG + Intergenic
985219730 4:187691354-187691376 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
986127315 5:4895043-4895065 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
986740176 5:10699179-10699201 AAGTAGGTAGGTAGGTAGGTAGG - Intronic
986969087 5:13311127-13311149 GGGTAGGTAGGTAGGTAGGTAGG + Intergenic
987218602 5:15766047-15766069 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
987218603 5:15766051-15766073 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
987872520 5:23639061-23639083 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
987925112 5:24330843-24330865 CTGTATGTATGTATGTATGTAGG + Intergenic
988128276 5:27072281-27072303 ATATAGTTATGTAAGTAGATAGG + Intronic
988519304 5:31931590-31931612 CTGTAGCTATGGAAGTAGATGGG + Intronic
989245766 5:39252609-39252631 CTGTATGTGTGTTACTAGGTTGG - Intronic
989646620 5:43640427-43640449 CAATTGGTAAGTAAGTAGGTTGG + Intronic
990398590 5:55411865-55411887 ATGTAGGTTTGTAAATAGTTTGG + Intronic
990771096 5:59246320-59246342 CTGTAGGTCTGTGTGTGGGTAGG + Intronic
990819340 5:59819765-59819787 CTGTAGCTATGAAATTAAGTGGG + Intronic
991905199 5:71502862-71502884 ATGTATGTATGTAAGTATGTGGG - Intronic
992983051 5:82197463-82197485 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
992983052 5:82197467-82197489 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
992983053 5:82197471-82197493 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
992983054 5:82197475-82197497 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
992983055 5:82197479-82197501 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
993099859 5:83524539-83524561 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
993099860 5:83524543-83524565 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
993099861 5:83524547-83524569 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
993099862 5:83524551-83524573 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
993099863 5:83524555-83524577 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
993099864 5:83524559-83524581 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
993099865 5:83524563-83524585 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
994022416 5:95043087-95043109 CCGTAGGAATGTAAGCTGGTGGG - Intronic
994588892 5:101748690-101748712 ATGTGTGTGTGTAAGTAGGTAGG - Intergenic
994588899 5:101748731-101748753 ATATAGGTAGGTAGGTAGGTAGG + Intergenic
995001098 5:107131080-107131102 GGGTAGGTAGGTAGGTAGGTAGG + Intergenic
995001099 5:107131084-107131106 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
995001100 5:107131088-107131110 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
999284976 5:150389086-150389108 ATGTACATATGTATGTAGGTAGG - Intronic
1000140632 5:158399803-158399825 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1000140633 5:158399807-158399829 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1000200430 5:159004532-159004554 TAGTAGGTAGGTAGGTAGGTAGG + Intronic
1000200431 5:159004536-159004558 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1000200432 5:159004540-159004562 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1000200433 5:159004544-159004566 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1001404277 5:171464655-171464677 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1001404278 5:171464659-171464681 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1001404279 5:171464663-171464685 CAGCAGGTAGGTAGGTAGGTAGG - Intergenic
1002877051 6:1220014-1220036 CTGTAGGTATGAAGGTAGGGAGG + Intergenic
1003288131 6:4752858-4752880 TTGTAGATAGGTAGGTAGGTAGG + Intronic
1003288133 6:4752870-4752892 AGGTAGGTAGGTATGTAGGTAGG + Intronic
1003288134 6:4752874-4752896 AGGTAGGTATGTAGGTAGGTAGG + Intronic
1003288135 6:4752882-4752904 ATGTAGGTAGGTAGGTATGTAGG + Intronic
1003288136 6:4752886-4752908 AGGTAGGTAGGTATGTAGGTAGG + Intronic
1003339062 6:5202439-5202461 CTGTTTGTATGTAAGGAGGTTGG - Intronic
1004299985 6:14448847-14448869 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1004299986 6:14448851-14448873 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1004299987 6:14448855-14448877 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1004299988 6:14448859-14448881 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1004299989 6:14448863-14448885 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1004317792 6:14605712-14605734 CTGTAGGGATTTAGGTATGTAGG - Intergenic
1005157952 6:22829254-22829276 GTATAGGTAAGTAGGTAGGTGGG - Intergenic
1005187514 6:23179885-23179907 CTGTGGGTGAGTATGTAGGTCGG - Intergenic
1005434091 6:25788973-25788995 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1005639180 6:27778524-27778546 CTGTAAGTATGGAAGGAGGAGGG - Intergenic
1012639164 6:101587436-101587458 AGGTAGGTAGGTAAGTAGGTAGG - Intronic
1012978201 6:105802538-105802560 CTGAAAGTGTGGAAGTAGGTAGG - Intergenic
1013995146 6:116299602-116299624 GTATATGTATGTATGTAGGTAGG + Intronic
1013995147 6:116299606-116299628 ATGTATGTATGTAGGTAGGTAGG + Intronic
1014031299 6:116708251-116708273 TTGTGGGTATGTAAATACGTAGG + Intronic
1014141937 6:117953793-117953815 ATGAAGGTGTCTAAGTAGGTGGG + Intronic
1014638172 6:123874884-123874906 ATGTATGTATGTATGTATGTAGG - Intronic
1015077308 6:129174830-129174852 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1015549515 6:134397558-134397580 AAGTAGGTAGGTAGGTAGGTAGG - Intergenic
1017966233 6:159269407-159269429 ATGTATGTATGTATGTATGTAGG + Intronic
1018621682 6:165735082-165735104 TTGTAGGTAGGTAGATAGGTAGG + Intronic
1018621689 6:165735110-165735132 TGGTAGGTAGGTAGGTAGGTTGG + Intronic
1018621715 6:165735276-165735298 CAGTTGGTAGGTAAGTAGGTAGG + Intronic
1018621716 6:165735280-165735302 TGGTAGGTAAGTAGGTAGGTTGG + Intronic
1019960270 7:4453562-4453584 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1019960271 7:4453566-4453588 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1019960272 7:4453570-4453592 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1019960273 7:4453574-4453596 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1021491800 7:21227137-21227159 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1021491801 7:21227141-21227163 GGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1022995414 7:35750247-35750269 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1022995415 7:35750251-35750273 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1022995416 7:35750255-35750277 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1022995417 7:35750259-35750281 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1022995418 7:35750263-35750285 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1022995419 7:35750267-35750289 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1023736078 7:43237139-43237161 AAGTAGGTAGGTAGGTAGGTAGG + Intronic
1023736079 7:43237143-43237165 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1023736080 7:43237147-43237169 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1023736081 7:43237151-43237173 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1023736082 7:43237155-43237177 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1023736083 7:43237159-43237181 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1023736084 7:43237163-43237185 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1023736085 7:43237167-43237189 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1024401615 7:48929967-48929989 ATGTATGTATGTATGTATGTAGG + Intergenic
1024401616 7:48929971-48929993 ATGTATGTATGTATGTAGGTAGG + Intergenic
1024578562 7:50783461-50783483 GTGTATGTATGTGAGTGGGTGGG - Intronic
1026882701 7:73917663-73917685 TGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1026982957 7:74537492-74537514 ATGTATGTATGCATGTAGGTAGG - Intronic
1027318484 7:76998411-76998433 GTGTAGGTGTGTCTGTAGGTGGG + Intergenic
1027318552 7:76998670-76998692 GTGTAGGTGTGTCTGTAGGTGGG + Intergenic
1028563032 7:92196527-92196549 CTCTAGGTAGGTAGGTTGGTAGG - Intergenic
1029103784 7:98157251-98157273 CGGTAGGTAGGTAGGTAGGTAGG + Intronic
1029103785 7:98157255-98157277 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1029103786 7:98157259-98157281 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1029103787 7:98157263-98157285 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1029103788 7:98157267-98157289 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1029103789 7:98157271-98157293 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1029103790 7:98157275-98157297 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1029160426 7:98547943-98547965 AGGTAGGTATGTAGGTAGGCAGG - Intergenic
1029160430 7:98547963-98547985 AGGTAGGTATGTAGGTAGGCAGG - Intergenic
1029160431 7:98547967-98547989 AGGTAGGTAGGTATGTAGGTAGG - Intergenic
1029160441 7:98548027-98548049 AGGTAGATATGTAAGTAGGTAGG - Intergenic
1029160445 7:98548055-98548077 AGGTAGGTATGTAGGTAGGCAGG - Intergenic
1029160446 7:98548059-98548081 AGGTAGGTAGGTATGTAGGTAGG - Intergenic
1029160457 7:98548111-98548133 AGGTAGATATGTAAGTAGGTAGG - Intergenic
1029160471 7:98548199-98548221 AGGTAGGTAGGTAAGTAGATAGG - Intergenic
1029160476 7:98548227-98548249 AGGTAGGTAGGTAAGTAGATAGG - Intergenic
1029160512 7:98548455-98548477 AAGTAGGTAAGTAGGTAGGTAGG - Intergenic
1029160517 7:98548487-98548509 AGGTAGATATGTAGGTAGGTAGG - Intergenic
1029160533 7:98548583-98548605 AGGTAGATAGGTAAGTAGGTAGG - Intergenic
1031652843 7:124312618-124312640 CCATAGGTATGTGAGTGGGTTGG + Intergenic
1033988157 7:147251436-147251458 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1033988158 7:147251440-147251462 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1034814105 7:154156767-154156789 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1035530902 8:350197-350219 AGATAGGTAAGTAAGTAGGTAGG + Intergenic
1035530951 8:350491-350513 AGGTAGATAGGTAAGTAGGTAGG + Intergenic
1035531008 8:350836-350858 AAGTAGGTAGGTAAGTAGGTAGG + Intergenic
1035531038 8:351019-351041 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1035531108 8:351478-351500 AGATAGGTAGGTAAGTAGGTAGG + Intergenic
1035926448 8:3732974-3732996 AGGTAGGTAGGTAGGTAGGTTGG - Intronic
1035926449 8:3732978-3733000 CTTTAGGTAGGTAGGTAGGTAGG - Intronic
1036542751 8:9734799-9734821 AAGTAGGTAGGTAGGTAGGTAGG - Intronic
1038016829 8:23522668-23522690 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1038016830 8:23522672-23522694 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1038016831 8:23522676-23522698 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1038016832 8:23522680-23522702 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1038016833 8:23522684-23522706 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1038022913 8:23564932-23564954 AAGTAGGTAGGTACGTAGGTAGG - Intronic
1038240554 8:25804225-25804247 GGGTAGGTAGGTAGGTAGGTGGG - Intergenic
1038366678 8:26942875-26942897 AAGTAGGTAGGTAGGTAGGTAGG + Intergenic
1038463570 8:27738572-27738594 GTATATGTATGTATGTAGGTCGG + Intronic
1038463571 8:27738576-27738598 ATGTATGTATGTAGGTCGGTAGG + Intronic
1039427009 8:37494417-37494439 CTGTAGGTGTGTGAGTGTGTGGG + Intergenic
1039859998 8:41448848-41448870 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1040441546 8:47448611-47448633 CAGTAGGTAGGTCAGTAGGGTGG + Intronic
1041317281 8:56577302-56577324 CTATAAGTATGTAAGTACCTAGG + Intergenic
1041962847 8:63639008-63639030 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1041962848 8:63639012-63639034 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1041962849 8:63639016-63639038 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1041962854 8:63639036-63639058 CAGTAGGTAAGTAGGTAGATAGG - Intergenic
1042831750 8:73037303-73037325 AGGTAGGTAGGTAAGTAGATAGG - Intronic
1042831796 8:73038042-73038064 AGGTAGGTAGGTAAGTAGATAGG + Intronic
1043461121 8:80461292-80461314 GTGTATGTGTGTAGGTAGGTAGG + Intergenic
1044357043 8:91234792-91234814 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1044357044 8:91234796-91234818 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1044357045 8:91234800-91234822 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1044357046 8:91234804-91234826 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1044357047 8:91234808-91234830 AAGTAGGTAGGTAGGTAGGTAGG - Intronic
1044697172 8:94935089-94935111 CGGTAGGTAGGTAGGTAGGTAGG + Intronic
1046173439 8:110543696-110543718 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1046173440 8:110543700-110543722 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1046173441 8:110543704-110543726 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1046173443 8:110543708-110543730 AGGTAGGTAGGTAGGTAGGTGGG + Intergenic
1046337362 8:112807490-112807512 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1046337363 8:112807494-112807516 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1046337364 8:112807498-112807520 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1046337365 8:112807502-112807524 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1046337366 8:112807506-112807528 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1046337367 8:112807510-112807532 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1046337368 8:112807514-112807536 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1046337369 8:112807518-112807540 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1048412797 8:134193033-134193055 CAGTAGGTAGGTAGATAGGTAGG + Intergenic
1048880713 8:138870212-138870234 TTGTATGTATGTAGGTGGGTGGG + Intronic
1050571103 9:6939957-6939979 AGGTAGGTAGGTAGGTAGGTTGG - Intronic
1051220503 9:14843497-14843519 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1051220504 9:14843501-14843523 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1051679436 9:19592473-19592495 GGGTAGGTAGGTAGGTAGGTCGG - Intronic
1051679441 9:19592493-19592515 AGGTAGGTAGGTAGGTAGGTGGG - Intronic
1051679443 9:19592497-19592519 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1051679444 9:19592501-19592523 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1051679445 9:19592505-19592527 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1051679446 9:19592509-19592531 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1051679447 9:19592513-19592535 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1051679448 9:19592517-19592539 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1051679449 9:19592521-19592543 AGGTAGGTAGGTAGGTAGGTAGG - Intronic
1051773624 9:20609342-20609364 ATGTATGTATGCAAGTATGTTGG + Intronic
1052524167 9:29591458-29591480 CTGCAGGGAGGAAAGTAGGTAGG - Intergenic
1054977340 9:71163328-71163350 ATATAGGTAGGTAGGTAGGTAGG + Intronic
1054977341 9:71163332-71163354 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1055327394 9:75145224-75145246 AGGTAGGTAAGTAGGTAGGTAGG - Intronic
1055327395 9:75145228-75145250 AGGTAGGTAGGTAAGTAGGTAGG - Intronic
1055395593 9:75870577-75870599 GTGTAGGTAGGTAGGTAGGTAGG + Intergenic
1055395594 9:75870581-75870603 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1055420584 9:76136977-76136999 CTGAAGAAATGTAAGGAGGTTGG - Intronic
1055480307 9:76703065-76703087 ATGTAGGTATTCAAGTAGGTGGG + Intronic
1055859052 9:80726632-80726654 TTATAGGTAGGTAAGTAGGTAGG - Intergenic
1058177958 9:101760067-101760089 CTGCAGGTAGGTAAGTCAGTGGG - Intergenic
1058220538 9:102295000-102295022 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1058220539 9:102295004-102295026 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1058220540 9:102295008-102295030 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1058220541 9:102295012-102295034 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1058220542 9:102295016-102295038 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1058220543 9:102295020-102295042 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1058220544 9:102295024-102295046 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1058220545 9:102295028-102295050 TGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1059208884 9:112492540-112492562 ATGTACATATGTAGGTAGGTAGG - Intronic
1060863213 9:126973376-126973398 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1060892171 9:127195834-127195856 TGGTAGGTAGGTAGGTAGGTAGG - Intronic
1062304733 9:135898675-135898697 TTTTAGTTATGTAAGTAGGTGGG - Intronic
1185789912 X:2920908-2920930 AGGTAGGTAGGTATGTAGGTAGG - Intronic
1185789913 X:2920912-2920934 CGGTAGGTAGGTAGGTATGTAGG - Intronic
1185933575 X:4230415-4230437 AGGTAGGTGGGTAAGTAGGTAGG - Intergenic
1186141763 X:6581992-6582014 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1186141764 X:6581996-6582018 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1186244120 X:7602573-7602595 AGGTAAGTAGGTAAGTAGGTAGG + Intergenic
1186244121 X:7602577-7602599 AAGTAGGTAAGTAGGTAGGTAGG + Intergenic
1186362140 X:8853215-8853237 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1186362141 X:8853219-8853241 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1186362142 X:8853223-8853245 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1186362143 X:8853227-8853249 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1187354082 X:18550333-18550355 CTGTGGGTATGGATGTGGGTGGG - Intronic
1188052059 X:25499760-25499782 CAATAGGTAGGTAAGGAGGTAGG - Intergenic
1188079291 X:25816068-25816090 ATATAAGTAAGTAAGTAGGTAGG + Intergenic
1188343301 X:29031992-29032014 AGGTAGGTAAGTAGGTAGGTGGG - Intronic
1188343303 X:29031996-29032018 AAGTAGGTAGGTAAGTAGGTAGG - Intronic
1188403825 X:29782149-29782171 ATATAGGTAGGTAGGTAGGTAGG - Intronic
1190064073 X:47228683-47228705 CTGTTGGTGGGTAAGCAGGTAGG - Intronic
1191786273 X:64920018-64920040 ATGTAAGTATGTATGTGGGTCGG + Intronic
1192607199 X:72530700-72530722 ATGTATGTAGGTAGGTAGGTAGG - Intronic
1192607200 X:72530704-72530726 GGGTATGTATGTAGGTAGGTAGG - Intronic
1194814998 X:98430425-98430447 TTGTATATATGTATGTAGGTAGG - Intergenic
1196507101 X:116460448-116460470 ATGAAGGTAGGTAAATAGGTAGG + Exonic
1196548895 X:116997733-116997755 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1196548896 X:116997737-116997759 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1196548897 X:116997741-116997763 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1196548898 X:116997745-116997767 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1196548899 X:116997749-116997771 AGGTAGGTAGGTAGGTAGGTAGG - Intergenic
1197231546 X:124009393-124009415 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1197231547 X:124009397-124009419 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1197231548 X:124009401-124009423 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1197231549 X:124009405-124009427 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1197231550 X:124009409-124009431 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1197231551 X:124009413-124009435 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1197231552 X:124009417-124009439 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1197231553 X:124009421-124009443 AGGTAGGTAGGTAGGTAGGTAGG + Intronic
1197339072 X:125243765-125243787 CTGTAGGTGTGGAAGTAGGTGGG + Intergenic
1200227181 X:154424764-154424786 CAATAGGTATATAACTAGGTGGG - Intergenic
1201284397 Y:12366982-12367004 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1201284398 Y:12366986-12367008 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1201284399 Y:12366990-12367012 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1201467509 Y:14299797-14299819 CTGTAGCTTTGTAAGAAGCTTGG - Intergenic
1201633599 Y:16097204-16097226 AGGTAGGTAGGTAGGTAGGTAGG + Intergenic
1201722394 Y:17114267-17114289 ATATAGGTAGGTAAGTAGGTAGG + Intergenic