ID: 1140514732

View in Genome Browser
Species Human (GRCh38)
Location 16:75533712-75533734
Sequence CTGTGTAAAAGGAGAGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 778
Summary {0: 1, 1: 2, 2: 3, 3: 76, 4: 696}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140514727_1140514732 11 Left 1140514727 16:75533678-75533700 CCTGGCCAAAATGCAATTCTTGA 0: 2
1: 1
2: 0
3: 47
4: 466
Right 1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG 0: 1
1: 2
2: 3
3: 76
4: 696
1140514726_1140514732 19 Left 1140514726 16:75533670-75533692 CCATAGCGCCTGGCCAAAATGCA 0: 1
1: 1
2: 11
3: 86
4: 807
Right 1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG 0: 1
1: 2
2: 3
3: 76
4: 696
1140514728_1140514732 6 Left 1140514728 16:75533683-75533705 CCAAAATGCAATTCTTGACTGCC 0: 1
1: 0
2: 0
3: 25
4: 375
Right 1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG 0: 1
1: 2
2: 3
3: 76
4: 696

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140514732 Original CRISPR CTGTGTAAAAGGAGAGAGAA AGG Intronic
902975123 1:20082973-20082995 CTGTTTAAAAGGACAGACACCGG + Intronic
903090545 1:20911817-20911839 CTAAGAAAAGGGAGAGAGAAAGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903401961 1:23060145-23060167 CTGAGCAGAATGAGAGAGAAAGG + Intronic
904310346 1:29625299-29625321 CTGGGTAAACATAGAGAGAAAGG - Intergenic
904674703 1:32191805-32191827 CTGTGTCAGGTGAGAGAGAAGGG - Intronic
905361582 1:37424512-37424534 CTGTGGAGTGGGAGAGAGAAAGG - Intergenic
906160569 1:43646140-43646162 CTGTGTAGAATGAGAGAAGAGGG + Intergenic
906277383 1:44526660-44526682 GTGTGTGAAGGCAGAGAGAAAGG - Intronic
906690480 1:47789601-47789623 CAGAGGAAGAGGAGAGAGAAGGG - Intronic
906713293 1:47948731-47948753 CTGAGGTTAAGGAGAGAGAAAGG - Intronic
906782266 1:48583233-48583255 CTGTGTGAAAGAAGATAGATAGG - Intronic
907335238 1:53695265-53695287 ATGTGTAAAAGGGGAGTGAGAGG + Intronic
907377888 1:54059038-54059060 CTCTGTAAAAAGAAACAGAAGGG - Intronic
907619117 1:55958325-55958347 GTTTGAAAAAGGAGAGAGAGAGG + Intergenic
907652367 1:56307565-56307587 CTGAGGAGAGGGAGAGAGAAGGG - Intergenic
907739916 1:57155197-57155219 CTGTGTATATGGCAAGAGAAAGG + Intronic
907744434 1:57198779-57198801 GTGTTTCAAAGGAGAGAAAAAGG + Intronic
908030165 1:59990619-59990641 CTGGGTAAAAAGGGAGATAAGGG + Exonic
908375498 1:63534748-63534770 CTCTGTAAAAGGGGAAAAAATGG + Intronic
908522227 1:64955515-64955537 CAGTGTAGAAGGAGAGAAATAGG + Intronic
909377896 1:74961161-74961183 CTGTGCAGAAGCAGGGAGAAAGG - Intergenic
909730040 1:78878783-78878805 CTGTGTAAAAGCAGGAAGAAAGG - Intergenic
909805914 1:79874191-79874213 TAGTGTCAAAGGAGAAAGAATGG - Intergenic
909842850 1:80350979-80351001 TAGGGAAAAAGGAGAGAGAAGGG - Intergenic
909979804 1:82085305-82085327 CTGAGTAGGAGGAGAGAGAGGGG + Intergenic
910006993 1:82410003-82410025 AAGAGTAAAAGGAGGGAGAATGG + Intergenic
910290425 1:85595272-85595294 TTGTATGAAAGGACAGAGAAAGG - Intergenic
910686680 1:89924908-89924930 CTGCTTAATAGGGGAGAGAAAGG + Intronic
910938782 1:92510349-92510371 CTTTGGAGAAGGAGAAAGAAAGG - Exonic
911591413 1:99752437-99752459 CTGAGGAGAAGGAGAGAGATTGG + Intronic
911685727 1:100775080-100775102 CATTGTAGAAGTAGAGAGAATGG + Intergenic
912222636 1:107695795-107695817 CAGTGTTAAATGAAAGAGAAAGG + Intronic
912620210 1:111148484-111148506 ATGTTTAAAGGAAGAGAGAAGGG - Intronic
912982178 1:114385403-114385425 CAGTAGAAGAGGAGAGAGAAGGG - Intergenic
914227125 1:145729789-145729811 GTGTGGAAATGGAGTGAGAATGG - Intronic
914423188 1:147548892-147548914 CTTTGCAACAGGAGAGAAAACGG - Intronic
915375803 1:155394289-155394311 ATGAATAAAAGGAGAGAGATGGG + Intronic
915582138 1:156820144-156820166 TTTTGTATAAGGAGAGAGATGGG + Intronic
915702431 1:157808857-157808879 AAGTGCAAAAGGAGAGAGAGGGG + Intronic
915826553 1:159084334-159084356 CTGTGTGAAAGGAGAAGGGAAGG - Intronic
915957107 1:160230316-160230338 CAGTTTGAAAGGAGAGAGAGGGG - Intronic
916030682 1:160875243-160875265 CTGTGTTTCAGGATAGAGAATGG + Intergenic
916087899 1:161284521-161284543 GTGTGGAGAAGGGGAGAGAAGGG - Exonic
916090860 1:161306696-161306718 CTTTGAAAAAGGTGTGAGAAGGG - Exonic
916989838 1:170231236-170231258 TTGTGTAAAATGAGGAAGAATGG - Intergenic
917048132 1:170886407-170886429 CTGTATAAAAGCAGAGTGGAGGG + Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917416209 1:174812729-174812751 CTGTGAAAAAAAAGAGAGTAGGG + Intronic
918294136 1:183139455-183139477 GAGTGTAAAAGGAGGGAGAAAGG - Intronic
918300506 1:183199509-183199531 ATGGATAGAAGGAGAGAGAAAGG - Intronic
918825436 1:189317197-189317219 TTCTGTAAAATGAAAGAGAAGGG + Intergenic
919123746 1:193372123-193372145 GGGTGGAAAAGGAGAGAAAATGG + Intergenic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920415495 1:205796735-205796757 CAGAGTAAAAGGACAGATAAGGG - Intronic
920908617 1:210193600-210193622 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
921261647 1:213389671-213389693 CTGGGTAAAAAGAAAGGGAAGGG - Intergenic
921402625 1:214743043-214743065 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
921847750 1:219902140-219902162 AAGTGAAAAAGAAGAGAGAAAGG + Intronic
922133252 1:222799762-222799784 CTGAGTAAAAGGAGAGTAGATGG - Intergenic
922366428 1:224868736-224868758 CTGGGAAATAGGAGACAGAAGGG + Intergenic
922369060 1:224891538-224891560 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
923750427 1:236741697-236741719 CAGGGTCCAAGGAGAGAGAATGG - Intronic
923772925 1:236953155-236953177 CTGTGAACAAGGACAGAGGATGG - Intergenic
924840231 1:247702141-247702163 CTGTTTGAAAGGAGAGAAGAAGG + Intergenic
1062890229 10:1053937-1053959 CTGAGCAGAAGGAGAGAGATAGG + Intronic
1063469808 10:6275247-6275269 CTCTGGAAGAGGACAGAGAAGGG - Intergenic
1063518169 10:6716876-6716898 GTGAGTAAAAGGAGACAGATGGG + Intergenic
1063545054 10:6972804-6972826 CTGTGTAAAAGGATAGAGAAAGG - Intergenic
1063661672 10:8038400-8038422 CTTTTAAGAAGGAGAGAGAAAGG - Intergenic
1063757490 10:9030637-9030659 CCTTGTTAAAGGAGAAAGAAAGG + Intergenic
1064503405 10:16000311-16000333 TTCTGTAAAATGAGATAGAAAGG - Intergenic
1064602796 10:17010208-17010230 CAGTGTGAAAAGAGACAGAAAGG - Intronic
1065433808 10:25686042-25686064 GTGTGTGTTAGGAGAGAGAAAGG - Intergenic
1065553083 10:26888579-26888601 CTGTTTAAATGGGTAGAGAAGGG - Intergenic
1065766882 10:29038518-29038540 CTGCAGAAAAGGAGAGAAAAAGG - Intergenic
1066550021 10:36545815-36545837 CTCTGTAAAAGGAGGGAGCTAGG - Intergenic
1067119725 10:43463927-43463949 CAGAGGAAAGGGAGAGAGAAAGG - Intronic
1067382422 10:45787269-45787291 CTGGTTAAAAGAAGAGAGCAAGG - Intronic
1067535408 10:47106064-47106086 AAGTGAAAAAAGAGAGAGAAGGG - Intergenic
1067687278 10:48473933-48473955 CTCTCTGAGAGGAGAGAGAAGGG - Intronic
1067890122 10:50127817-50127839 CTGGTTAAAAGAAGAGAGCAAGG - Intronic
1068376233 10:56184788-56184810 GTGTGTAAAAAAAGAGAGAGAGG + Intergenic
1068828958 10:61471111-61471133 CTGTGTAAACCTAGAGCGAATGG + Intergenic
1069659082 10:70111742-70111764 CTTTTTAAAAGGAGAGAGGAGGG + Exonic
1069872162 10:71539874-71539896 CTGTCTTCAAGGAGAGGGAAAGG - Intronic
1070358104 10:75660070-75660092 GTGTGTAAAGAGAGAGAGAGAGG - Intronic
1071019142 10:81031198-81031220 CAGTGAAAAAGGACAAAGAAGGG + Intergenic
1071132740 10:82414279-82414301 CTGAGAAGAGGGAGAGAGAAAGG + Intronic
1071369977 10:84941230-84941252 GTGTCTAAGAGGAGAGAGGAAGG + Intergenic
1071841536 10:89476816-89476838 CTTTGCAAAAGCAGAAAGAAGGG - Intronic
1072118643 10:92387080-92387102 TTGTGTAAGAGGGGAGAAAAGGG - Intergenic
1072528643 10:96297509-96297531 CATTGTAAAAGGAGAGAGGATGG - Intergenic
1072733093 10:97861268-97861290 CTGTGAAAAAGCAGAGAGGCGGG - Intronic
1073275019 10:102302250-102302272 CTGTGGAAAGGGAGAGGGAAAGG + Intronic
1073598990 10:104828361-104828383 CTGAGGAGAAGGAGAGAGATGGG + Intronic
1073685700 10:105751367-105751389 GGGAGTGAAAGGAGAGAGAATGG + Intergenic
1074144495 10:110704618-110704640 CTGTGTAAGAGGAAAGGGAGAGG + Intronic
1075508815 10:123052051-123052073 CTTTGAAAAAGGAGAGAGGCTGG - Intronic
1075695971 10:124435550-124435572 ATGTGCAAAAGAAGAGAGGATGG + Intergenic
1075969535 10:126640718-126640740 CTCTGGACAAGGAGAGAGATAGG + Intronic
1076174426 10:128356347-128356369 ATGTCTAAGAGGAGAAAGAAAGG + Intergenic
1076768469 10:132650573-132650595 CTGTGTAAATGGAGAGAGGTCGG + Intronic
1077447158 11:2601542-2601564 CCGTGTAAAAGGACAAATAATGG - Intronic
1077743229 11:4871307-4871329 CTGTGAAACAGAAAAGAGAATGG + Intronic
1078040344 11:7855806-7855828 CTGGGTAGGAGGAGAGAAAAGGG + Intergenic
1078060019 11:8037231-8037253 ATGTGTCCAAGCAGAGAGAATGG + Intronic
1078348078 11:10569124-10569146 ATGTGTAAAAGGAGACTCAAAGG - Intronic
1078597621 11:12702056-12702078 CTGTGTAAATGGAGAGCTGAAGG + Intronic
1079101844 11:17546955-17546977 CTCTGTAAAAGGAGAGGATAGGG + Intergenic
1079881931 11:25939220-25939242 CTGTCCCAAAGGAGACAGAAGGG - Intergenic
1080051375 11:27862556-27862578 TTATGTAAAAGGAGGCAGAAAGG - Intergenic
1080122888 11:28697651-28697673 CGATGTAGAAAGAGAGAGAAAGG - Intergenic
1080248402 11:30205403-30205425 CTGTGTCAATGGACACAGAAAGG - Intergenic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1080391213 11:31848415-31848437 TTGTGCAAAAGGAGAAAGCAAGG - Intronic
1081002952 11:37696755-37696777 CTTTGTCAAAGCAGAGAGACTGG - Intergenic
1082196180 11:49308966-49308988 CAGTGTAATGGGAGAGAGAATGG + Intergenic
1082667817 11:55995831-55995853 CTGTATAAAGGTAGTGAGAAAGG + Intergenic
1084611916 11:70208712-70208734 CTGTGTAACAGAAGGCAGAAGGG - Intergenic
1085211908 11:74788886-74788908 GTTTGTAAAAGGGGAGAGAGTGG + Intronic
1085304318 11:75476609-75476631 CTGAGGCAAAGGAGAGGGAAGGG - Intronic
1085763923 11:79265835-79265857 CTGGGTAGAAGGTGAGAGACGGG - Intronic
1086139737 11:83483424-83483446 TTTTTTAAAAGAAGAGAGAATGG - Intronic
1086251998 11:84826965-84826987 CTGTGTGACAGGGGAGAGACTGG + Intronic
1086404105 11:86485679-86485701 CTGGGTAAAAGGGGAGAGAATGG - Intronic
1086571597 11:88291287-88291309 TTCTGTAAAAGTAGAGAAAATGG - Intergenic
1086585968 11:88451475-88451497 CTGTCTAAAAGGAGAGAAAGAGG - Intergenic
1086659645 11:89399241-89399263 CAGTGTAATGGGAGAGAGAATGG - Intronic
1086976151 11:93135407-93135429 CTGTGCAAAAGGACAGGGACTGG - Intergenic
1088021560 11:105125710-105125732 CTGTGTAAAAGGAGATATTTTGG - Intergenic
1088029030 11:105223633-105223655 CCAAATAAAAGGAGAGAGAAGGG - Intergenic
1088068336 11:105749323-105749345 CTGTGAAACAGTAGAGAGATAGG + Intronic
1088222506 11:107584565-107584587 CTGGATAGATGGAGAGAGAAAGG - Intergenic
1088687660 11:112298405-112298427 ATGTGGGAAAGGAGAGAGAGAGG + Intergenic
1089069547 11:115688838-115688860 CAATGTAAAAGAAGAGAGAAAGG + Intergenic
1089397287 11:118144740-118144762 CTAAGAAACAGGAGAGAGAAAGG - Intronic
1090172572 11:124617635-124617657 TTCTGTAAAGGGAGAGAGAAAGG + Intronic
1090516002 11:127427654-127427676 ATGTCTCACAGGAGAGAGAAAGG - Intergenic
1091110064 11:132957868-132957890 CTGAGGAGAAGGAGAGAGACTGG - Intronic
1091138030 11:133210396-133210418 CTGGGAAGAGGGAGAGAGAAGGG - Intronic
1091275701 11:134348073-134348095 CTGTGTAAAACCAGAAAGAACGG + Intronic
1091555344 12:1569306-1569328 CTGGTGAAAAGGAGAGGGAATGG - Intronic
1091591965 12:1847677-1847699 CTGTGTAAAAGCAGAGAGAATGG + Intronic
1092404076 12:8204551-8204573 CTGTGAGAAAAGAGAGTGAAGGG - Intergenic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1092645510 12:10566800-10566822 CAGTAAGAAAGGAGAGAGAAAGG - Intergenic
1092929193 12:13299272-13299294 CTTTGTAAAAGGGCAGAGAGAGG + Intergenic
1093230635 12:16538193-16538215 CTGTGTTTTAGCAGAGAGAATGG - Intronic
1093239076 12:16646809-16646831 CTGTGTATGAAGAGAAAGAAAGG + Intergenic
1093476537 12:19561444-19561466 CTGTTTAAAAGGGGTAAGAAAGG + Intronic
1093823005 12:23644669-23644691 CTATGATACAGGAGAGAGAAGGG + Intronic
1094303064 12:28987874-28987896 CGGTGGAGAAAGAGAGAGAATGG - Intergenic
1094325577 12:29234455-29234477 CTGTGAAAAGGGTGAAAGAAGGG - Intronic
1094573510 12:31662853-31662875 CTGAATTAAAGGAGAGCGAAAGG - Intronic
1095130021 12:38529998-38530020 TTGGGTAAAAGGAGACTGAAAGG + Intergenic
1095361960 12:41353039-41353061 CTGGGAAAACGAAGAGAGAAAGG + Intronic
1095972945 12:47916818-47916840 CTGTGGAAAGGGAAAGAGCATGG + Intronic
1096421576 12:51462998-51463020 ATGTGAAATAGAAGAGAGAAGGG + Intronic
1096432136 12:51554724-51554746 CTGAGGAAAGGGAGAGAGATGGG + Intergenic
1096639779 12:52984964-52984986 CTGTCTAAAAAAAGAAAGAAAGG - Intergenic
1096917440 12:55048335-55048357 CTGGGCAAATGGAGAGAGAATGG + Intergenic
1097649209 12:62275145-62275167 ATGGGTAAATGGAGAGAGAGAGG + Intronic
1097662222 12:62443546-62443568 CAGTGAAAAAGTAGAAAGAAGGG - Intergenic
1098165185 12:67689530-67689552 CTGTGTGCAAGCAGAGAGCAGGG + Intergenic
1098205517 12:68105243-68105265 CTGGGTAACAGGACAGAGAAGGG - Intergenic
1099305344 12:80947819-80947841 CTTTCAAAAAGCAGAGAGAAAGG + Intronic
1100484682 12:95013780-95013802 CTATGAAAAAGAAGAGAGACTGG - Intergenic
1100571987 12:95851657-95851679 CTGTATAAAAAGAGAAAGAAGGG - Intergenic
1100813596 12:98363993-98364015 TAGTGTAAAAGTAGAGAGAGAGG - Intergenic
1100932167 12:99621641-99621663 CAGTAGAAAAGGAGAAAGAAGGG + Intronic
1101161165 12:101977856-101977878 GTGTGTAAACGAAGAGAAAAGGG + Intronic
1101240514 12:102833690-102833712 CTGTGTAAAATGTGAGACATTGG + Intergenic
1101454772 12:104819662-104819684 GACTGTAAAAGGAGTGAGAATGG - Intronic
1102249496 12:111376581-111376603 CTGTTTAAAAAGAGAGAGAGAGG + Intergenic
1102273270 12:111558922-111558944 TTGTGTGAAAGTAGACAGAATGG - Intronic
1102380246 12:112459295-112459317 ATATGCAAAAGTAGAGAGAATGG + Intronic
1102420371 12:112798738-112798760 CAGGGAAAAAGGAGAGAGAGGGG - Intronic
1102784348 12:115592043-115592065 CTGTGTAGAAGGAGAGTTAAGGG - Intergenic
1103031252 12:117615198-117615220 GTGTGTAACTGAAGAGAGAAGGG - Intronic
1103732975 12:123041025-123041047 GTGTGTAAACAGACAGAGAAGGG + Intronic
1103920794 12:124398241-124398263 CTGGCTCAAAGGAGAGAAAAGGG - Intronic
1104275860 12:127327196-127327218 GTGTGTAGAAGGAAAGAGGAAGG + Intergenic
1105589642 13:21779465-21779487 CTGAGAAGAAGGAGAGAGATTGG - Intergenic
1106477926 13:30114245-30114267 CTCTGTAAAATGAGAGTGATCGG + Intergenic
1106813763 13:33385508-33385530 CTGTTTAAGAGCAGAGATAAAGG + Intergenic
1106969780 13:35125591-35125613 ATGTGTAAAAGAAGGGACAAGGG - Intronic
1107409283 13:40143556-40143578 GTGAGAAAAAGGAGGGAGAACGG + Intergenic
1107471644 13:40696715-40696737 CAGTGTAAAAGGGGAGAGGGGGG - Intergenic
1107894927 13:44952097-44952119 CTGAGTAAAATAATAGAGAATGG - Intronic
1109515478 13:63438348-63438370 CTGAGGAGAAGGAGAGAGATAGG + Intergenic
1110083666 13:71348693-71348715 CACTATCAAAGGAGAGAGAAGGG + Intergenic
1110798965 13:79672833-79672855 CTCTTAAAAAGTAGAGAGAAAGG - Intergenic
1110939633 13:81332769-81332791 ATGTGTAAAAGGAGTGATAATGG + Intergenic
1111150094 13:84241654-84241676 CTCTCTAAAAAGAGAGAAAAAGG + Intergenic
1111786921 13:92799745-92799767 GTGTGTGAAGGGAGAGAAAAAGG - Intronic
1112302093 13:98239855-98239877 CTGTGCTAGAGGAGAGAGAAAGG + Intronic
1113395003 13:109939282-109939304 CTGTTTAAAAGGCTAGAGAAAGG - Intergenic
1113648983 13:112020775-112020797 CTGAGTAGAGGGAGAGAGACTGG - Intergenic
1114028001 14:18546176-18546198 CTTTGTAAAAGGAAAAATAAAGG - Intergenic
1114221929 14:20704443-20704465 CTGTGTGTAAGGAAAAAGAATGG - Intergenic
1114387716 14:22272240-22272262 CTGTGGAAAATAGGAGAGAAAGG - Intergenic
1114388579 14:22281426-22281448 CTGTGGGAAAGAGGAGAGAAAGG - Intergenic
1115022149 14:28695093-28695115 TTGAATAAAAGGAGAGAGAGAGG + Intergenic
1115200236 14:30845363-30845385 CTTTGTATATGGTGAGAGAAAGG + Intergenic
1115569426 14:34652891-34652913 CTGTGTAAAAGCAGGAAGAAAGG - Intergenic
1115569631 14:34654450-34654472 CTGAGTAAAAGGAGAAAAACAGG - Intergenic
1115899217 14:38126244-38126266 CTGTGTTAAAGGAAATAGGAAGG - Intergenic
1115947658 14:38680706-38680728 TTTTGTATAAGGAGAGAGATAGG + Intergenic
1115953568 14:38749617-38749639 CTGTGTGAAATGAGAGACCATGG - Intergenic
1116187855 14:41621523-41621545 ATGTGTAAAAAGAGTGAGACAGG + Intronic
1117166537 14:53039883-53039905 ATGTGTGAAAGGAAAGAGATTGG - Intronic
1117296283 14:54382618-54382640 CTATGAAGAAGGAGAGAGATGGG - Intergenic
1117413647 14:55473564-55473586 TTGGTTAAAAGAAGAGAGAAAGG + Intergenic
1117519258 14:56534072-56534094 ATGTATAAAAGTAGAGAAAAGGG + Intronic
1117667914 14:58076725-58076747 CTGGGTAAACTGAGAAAGAAGGG + Intronic
1117672142 14:58119051-58119073 CAATGTAGAAGGAGACAGAATGG + Intronic
1118102756 14:62624936-62624958 GTGTGTGAAAGGAAAGAGGAGGG - Intergenic
1118456182 14:65947373-65947395 ATGTGTTCTAGGAGAGAGAAGGG - Intergenic
1119395950 14:74326623-74326645 CTATGTAAAAGGTGGGGGAAGGG - Intronic
1119477376 14:74938962-74938984 CTGTGTGAAAGAAGAGAAAAGGG - Intergenic
1120353341 14:83393304-83393326 TTGTTTAAAAAGAGAGAAAAGGG + Intergenic
1120650422 14:87125424-87125446 CTGAGGAAAAGTAGAGATAAAGG - Intergenic
1120681840 14:87489410-87489432 CTGTAGAAAAGGAGGAAGAAAGG + Intergenic
1121529066 14:94640013-94640035 CTGTGGAAAGGGCGAGAGCAAGG + Intergenic
1122020862 14:98836825-98836847 TTTTGTAAAAAAAGAGAGAACGG - Intergenic
1122436361 14:101703361-101703383 CAGTGTAGAAGGACAAAGAATGG + Intergenic
1122730636 14:103794696-103794718 CTAGGTAAAAGGACTGAGAAAGG + Intronic
1123868370 15:24546215-24546237 CACTGGAAACGGAGAGAGAAAGG + Intergenic
1124029792 15:26000144-26000166 CTATGCAAAAACAGAGAGAAAGG - Intergenic
1124365412 15:29067671-29067693 TTGTGGAAAAGGCGAGAGGATGG - Intronic
1124824088 15:33076065-33076087 TAATGTAAAAGGGGAGAGAAAGG + Intronic
1125061715 15:35433923-35433945 CTGTGGAAGAGAAAAGAGAAGGG + Intronic
1125798987 15:42427825-42427847 TTGAGTAGAAGCAGAGAGAATGG + Intronic
1125807219 15:42503970-42503992 TTGTGTAGAAGGAGATAGAAAGG + Intronic
1126348650 15:47721843-47721865 CTGTGTCCAAGCAGAGAGAATGG - Intronic
1126370690 15:47943448-47943470 AAGAGAAAAAGGAGAGAGAAAGG + Intergenic
1126688624 15:51269811-51269833 CTGTGAAAGAAGAGAGGGAAGGG - Intronic
1126701232 15:51369543-51369565 GAGAGTAAAAGGTGAGAGAAAGG + Intronic
1126851489 15:52799570-52799592 CTGAAAAAAAGGAGAAAGAAAGG + Intergenic
1126967333 15:54069867-54069889 CTGTGGCCAAGGAAAGAGAAAGG - Intronic
1127531842 15:59851041-59851063 CATTCTAGAAGGAGAGAGAAAGG - Intergenic
1127540963 15:59938638-59938660 CTGTAGAAAAGTAGAGGGAAGGG - Intergenic
1127701075 15:61501805-61501827 CTGAGTAAAAACAAAGAGAAAGG + Intergenic
1128332780 15:66766707-66766729 CTGTGTGATAGGTGAGAGGAGGG - Intronic
1128645737 15:69377654-69377676 CTGTGTAAAATGAGAGGGCTTGG - Intronic
1129044495 15:72721815-72721837 CTTTGGAAAAGGAGAAAGCAAGG - Intronic
1129203980 15:74024412-74024434 CTGGGCAATAGCAGAGAGAAGGG + Intronic
1129627951 15:77224877-77224899 CTGTGGAAATGGAAAGAGATGGG - Intronic
1129712967 15:77830505-77830527 CTATGAAAAAGAAGAAAGAACGG + Intergenic
1130010752 15:80151873-80151895 GTGTGTGGAAAGAGAGAGAAGGG - Intergenic
1130121317 15:81050037-81050059 CTGTGGAAATGAAAAGAGAAAGG + Intronic
1130903945 15:88226993-88227015 CTCTGTAAAAGGAGGGAAAGTGG - Intronic
1131729028 15:95259673-95259695 CTGTGTAAATTGAGAGGAAAAGG - Intergenic
1134318370 16:13140179-13140201 CTGTCTAAAAAGAAAGGGAAGGG - Intronic
1135534961 16:23286732-23286754 CCTGGAAAAAGGAGAGAGAACGG + Intronic
1135634901 16:24067204-24067226 ATGTTTAAAAGAAGGGAGAAAGG - Intronic
1136165012 16:28447970-28447992 CTGTGGAAAGTGAGAGAGGAAGG - Intergenic
1136214300 16:28781187-28781209 CTGTGGAAAGTGAGAGAGGAAGG + Intergenic
1137379696 16:47986038-47986060 CTGTGGAAGAGAAGAGAGAGAGG + Intergenic
1138325498 16:56162703-56162725 CTTTGTTGAAGGAAAGAGAAGGG + Intergenic
1139079628 16:63500189-63500211 GTGGGTAAAATGAGAAAGAAAGG - Intergenic
1139095224 16:63697061-63697083 CTTTATATAAGGAGACAGAATGG - Intergenic
1139871594 16:70112912-70112934 CTGTCTAAAAAAAGAGAAAACGG - Intergenic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140159595 16:72474502-72474524 CTATGTAAAAGGAGATACAATGG + Intergenic
1140364341 16:74369574-74369596 CTGTCTAAAAAAAGAGAAAACGG + Intergenic
1140509052 16:75494456-75494478 CTGTGAAAAAGGGAGGAGAAAGG + Intronic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1141472592 16:84249611-84249633 CAGTGTCATAGGGGAGAGAAAGG - Intergenic
1142569654 17:864882-864904 CCGTGTTGAATGAGAGAGAAGGG - Intronic
1143157558 17:4848013-4848035 CTGTTTAAAAGAGGAGAGATGGG + Intronic
1143816855 17:9523682-9523704 CTTTATAAAATGAGTGAGAATGG - Intronic
1144051617 17:11501857-11501879 TAGTGGAAAAGGAGAGAAAAGGG + Intronic
1144556920 17:16290395-16290417 CTGTCTCAAAAGAGAGAGAAGGG - Intronic
1144722243 17:17479492-17479514 CCATCTAAAAGGACAGAGAAGGG + Intronic
1146311876 17:31775701-31775723 GTAAGTAAATGGAGAGAGAAGGG - Intergenic
1146426122 17:32740952-32740974 CTGTGTAAATGAAGGGAGGAAGG - Intronic
1146966857 17:37038763-37038785 CTTTATAAAAGGAGTGGGAAAGG - Intronic
1147390903 17:40108556-40108578 CTATTTAAAAAGAGACAGAATGG + Intergenic
1148443865 17:47726090-47726112 CTCTGTAAAATGAGACAGCAAGG - Intergenic
1148571982 17:48677685-48677707 CTGTGAAAAAGGAGGGAGGGAGG - Intergenic
1148642828 17:49201123-49201145 CTGTGGGAAATGAGGGAGAAGGG + Intergenic
1149137130 17:53381068-53381090 CGGCGTAAAGGGAAAGAGAAAGG - Intergenic
1149145480 17:53486836-53486858 CGGTTTAAAAGGTAAGAGAAAGG - Intergenic
1149356664 17:55846162-55846184 CTGTGTAAAGCCACAGAGAAAGG - Intergenic
1149620471 17:58041075-58041097 CAGTTTAAAAGAAGAGAGAGGGG - Intergenic
1149650812 17:58275336-58275358 CTGCGAAGAAGGAGAGGGAAGGG + Intronic
1149857778 17:60097760-60097782 TTTTGTAAAAGTAGAGTGAAAGG - Intergenic
1149919793 17:60646552-60646574 ATGTGGAAGAGGAGACAGAAAGG - Intronic
1150014272 17:61538050-61538072 CTGAGGAGAAGGAGAGAGACAGG - Intergenic
1150342695 17:64381512-64381534 CTTTGTTAAAAGAGAGGGAAAGG - Intronic
1150724914 17:67643813-67643835 CAGGGTCAAAGCAGAGAGAAGGG - Intronic
1150969754 17:70014194-70014216 CAGTTCAAAAGGAGAAAGAAGGG + Intergenic
1151071296 17:71215723-71215745 CCGTGAAGAAGGAGAGAGAAAGG + Intergenic
1151395699 17:73821270-73821292 CGGTGTAAATGGAAATAGAATGG - Intergenic
1152454544 17:80406072-80406094 CTGTGTAAAAGCAGGAGGAAAGG - Intergenic
1152854344 17:82655668-82655690 CTGTGGCACAGCAGAGAGAAGGG + Exonic
1153143679 18:2003256-2003278 GTGTGTGTAAGGAGACAGAAAGG + Intergenic
1155028106 18:21960685-21960707 CCTGGGAAAAGGAGAGAGAATGG - Intergenic
1155307503 18:24492855-24492877 CTGTGTAACAGGCGAGAGATGGG + Intergenic
1155315426 18:24566467-24566489 CTGTAGACGAGGAGAGAGAAAGG + Intergenic
1155954174 18:31943160-31943182 CTGTGTTAAAGGAGACGGTAGGG + Intronic
1156548295 18:37987798-37987820 TTGAGTAAAAGCAGAGAGGATGG + Intergenic
1156593626 18:38520402-38520424 CTGTGTTAAAGGAGATAGGAAGG + Intergenic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1156802340 18:41131615-41131637 CTTATTAAAAGAAGAGAGAATGG + Intergenic
1157483029 18:48068023-48068045 GAGTGGAAAAGGAGAGAGAGAGG - Intronic
1157804432 18:50647708-50647730 CTGTGGCAAAGGACAGAAAATGG - Intronic
1157943563 18:51955077-51955099 CTGTGTAAAGGGAGGGAAAAGGG + Intergenic
1158333901 18:56394002-56394024 CTGAGTGAGAGCAGAGAGAAAGG - Intergenic
1158767862 18:60477117-60477139 TTGTGTAAATGGTGAGAGATAGG + Intergenic
1158929373 18:62307674-62307696 CTGTTTAAAAGGAATGAGTATGG - Exonic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159248537 18:65842083-65842105 CTGGTTAAAATGAGAGATAAGGG - Intronic
1159685115 18:71409615-71409637 CTGTGAAAAAGCAATGAGAATGG - Intergenic
1159741716 18:72179522-72179544 CCATGATAAAGGAGAGAGAATGG + Intergenic
1159857763 18:73609534-73609556 TTTTGTAAAAGGTGAGAGATGGG - Intergenic
1160073870 18:75653233-75653255 ATGGGGAAAAGGTGAGAGAAAGG - Intergenic
1161088707 19:2347110-2347132 GTGTGTGGAGGGAGAGAGAACGG - Intronic
1161088810 19:2348515-2348537 GTGTGTGGAGGGAGAGAGAACGG - Intronic
1161754177 19:6119484-6119506 CTGTCTCAAAAGAGAAAGAAGGG - Intronic
1162705522 19:12551916-12551938 CAGTGTAACAGGAGGGAGGAGGG + Intronic
1162790290 19:13059318-13059340 GGAAGTAAAAGGAGAGAGAAGGG - Intronic
1162998674 19:14352271-14352293 CTCTGTAAAAACAGAGAGCAAGG - Intergenic
1163482247 19:17563888-17563910 TTTTGTAAAAAGAGAGAGAAAGG - Intronic
1163876762 19:19876536-19876558 CTGTTTTAAAGGACAGAAAAGGG + Intronic
1164314039 19:24071153-24071175 CTATGTAAAAGTCGAGAGTAGGG - Intronic
1164477940 19:28589702-28589724 CTGTTGAAAGGGAGAGAGATGGG - Intergenic
1164984197 19:32636348-32636370 CTCTGTAAAACGACAGAGAGGGG + Intronic
1165501730 19:36194827-36194849 CTGGGTCAAAGGAGGGAGAGAGG - Intronic
1165858800 19:38895770-38895792 CTATTTAAAAAGAGAGAGAAAGG + Intronic
1166502123 19:43349404-43349426 ATGTGTGCAAGGAGACAGAAGGG + Intergenic
1166676567 19:44745026-44745048 CTTTCTAAGAGGAGAGAGTAGGG - Intergenic
1168060274 19:53888027-53888049 CTGTTAAAAAGGAGACAGCACGG - Intronic
925658240 2:6173494-6173516 CTGAGTAGAAGGAGAGAGTGGGG - Intergenic
925998150 2:9308539-9308561 CTGTGTAAAAGGGAACAGGAGGG + Intronic
926724091 2:15984046-15984068 TTGTGTAACAGGAGAGTGAAAGG - Intergenic
927365209 2:22287161-22287183 GAGAGAAAAAGGAGAGAGAATGG + Intergenic
927762102 2:25767189-25767211 CTGTGTAAAGAAAGATAGAAGGG - Intronic
928065700 2:28162412-28162434 CTGGGTAAAAGGTGACAAAAAGG - Intronic
928411933 2:31061006-31061028 CAATGAAAAAGGAAAGAGAAGGG - Intronic
928623971 2:33120322-33120344 GAGGGTAAAAGGAGGGAGAAGGG - Intronic
928935755 2:36676183-36676205 ATTTGTAAAAAGAGAGAGAGGGG + Intergenic
929399466 2:41563282-41563304 CAGAGTAAAGGGAGAGAGGATGG - Intergenic
929420881 2:41788488-41788510 CTTAGAAAAAGGAGAGAGAAGGG - Intergenic
930058214 2:47268220-47268242 CTGAGTACCTGGAGAGAGAAAGG + Intergenic
930347705 2:50205940-50205962 CTTGGGAGAAGGAGAGAGAAGGG + Intronic
930489364 2:52048680-52048702 CTGAGGAAAAGAAGAGAGAAAGG + Intergenic
930508094 2:52309976-52309998 CTGTGTAATGAGTGAGAGAAAGG + Intergenic
931020825 2:58043502-58043524 CTATGTAAAAGAAGACACAAAGG - Intronic
931067831 2:58606790-58606812 CTGTGGAAAAGCAGAGGGGAAGG + Intergenic
931249923 2:60521311-60521333 CTGTGTGAAGCGAGAGAGAGCGG + Intronic
931641134 2:64382085-64382107 CTGTGGAAAGTGAGAAAGAAGGG - Intergenic
931653600 2:64490214-64490236 CTGTTTTAAAGAAGAGAAAAAGG + Intergenic
931918078 2:66980797-66980819 CTTTTTAAAATGACAGAGAAAGG + Intergenic
932074138 2:68647431-68647453 CTGGGTTAAAGGAGAGAGACAGG - Intronic
932200318 2:69820953-69820975 CTGTGTGAAAGAGGAGAGACTGG - Intronic
932432352 2:71683548-71683570 CTATATAAAAGTGGAGAGAATGG + Intronic
932478612 2:72024681-72024703 CTCTGTAAAAGGAGCCTGAAGGG + Intergenic
932708544 2:74046259-74046281 CTGTCTAAAGAGAGAGAGAAGGG - Exonic
933487423 2:82940193-82940215 CTGAGAAGAGGGAGAGAGAAAGG + Intergenic
933582033 2:84138289-84138311 CTGTATGCAAGGAGAGATAATGG + Intergenic
933731638 2:85460758-85460780 CTATGTAAAAGCAGAGGGAACGG + Intergenic
933804572 2:85988816-85988838 CTGTTTAAAAAGGGAGAAAAAGG + Intergenic
934663325 2:96154511-96154533 TAGAGGAAAAGGAGAGAGAAGGG - Intergenic
935583933 2:104783937-104783959 CTCTTTTAAAAGAGAGAGAAAGG + Intergenic
936648520 2:114399970-114399992 CTCTCTAAAAGCAGAGAGATGGG - Intergenic
936719788 2:115237401-115237423 CTGCGGAAAAGGAGATAGATGGG - Intronic
937220884 2:120342838-120342860 CTGTGGAAAGGGAGAGAATATGG - Intergenic
937284307 2:120740669-120740691 GTGTGAAAAAGGCCAGAGAATGG - Intronic
938118183 2:128616216-128616238 CGGTGGAACAGGAGAGCGAAGGG - Intergenic
938815362 2:134898085-134898107 TTATTTAAAAAGAGAGAGAATGG + Intronic
938879371 2:135568884-135568906 ATGTGTAAGAGGACAGCGAAGGG + Intronic
939156498 2:138531195-138531217 ATTTTTAAAAGGAGAGAAAAAGG - Intronic
939211682 2:139183611-139183633 CTGTCTAAAAAGACAGAGAGAGG - Intergenic
939238691 2:139531379-139531401 CTGTGTGGAAGGAGAGAGATTGG + Intergenic
939833988 2:147105713-147105735 ATTTTTAAAAAGAGAGAGAAAGG - Intergenic
940259198 2:151763141-151763163 CTGTGTAAATTCAGAGAGAAAGG - Intergenic
941078469 2:161033075-161033097 CTCTGTCAAAGGAAAGGGAAAGG + Intergenic
941173686 2:162170766-162170788 CTCTGTGAAAGAAGAGAAAAGGG - Exonic
941391030 2:164914890-164914912 GTGTGTGGAAGGAGAGAGTATGG + Intronic
941503760 2:166313959-166313981 CTGAGGAAAGGGAGAGAGATAGG + Intronic
941598831 2:167513347-167513369 CTTTGTAAAAGGGGAAACAAAGG + Intergenic
942677232 2:178440658-178440680 CTGGGAAAATGGAGAGAGATGGG - Intronic
942747788 2:179255106-179255128 CTGAGGAGAAGGAGAGAGACAGG - Intronic
942974718 2:182001865-182001887 TTGTGTATAAGGTGAGGGAAAGG - Intronic
943799597 2:192041789-192041811 CCGTAGAAAAGGAGAGAGATGGG + Intronic
943961289 2:194265948-194265970 TTCTGTAATAAGAGAGAGAAAGG + Intergenic
944032383 2:195251144-195251166 CTGTGGAATTAGAGAGAGAAAGG + Intergenic
944041326 2:195358177-195358199 CAGTGTAAAAGGAGAGTCCAAGG + Intergenic
944072399 2:195687030-195687052 ATGAGTAAAAGGAGAGAAAGTGG + Intronic
944082144 2:195799877-195799899 CTGTGGAAAAGAAGAAGGAAAGG + Intronic
944287683 2:197970243-197970265 GTGTGTAAAAAGAGAGAGCATGG + Intronic
945634209 2:212326855-212326877 CTGTCTGTAAGGATAGAGAATGG + Intronic
946286330 2:218706290-218706312 CCATATAAAAGTAGAGAGAATGG + Intergenic
946338316 2:219053223-219053245 CTGTGTAAAAGGGCAGAGCCTGG + Intergenic
946555309 2:220849836-220849858 CTGGCTAAAAGGATAGAGTAAGG + Intergenic
946907175 2:224428640-224428662 TTGTGTATAAAGAGAGAGAATGG - Intergenic
947065426 2:226219085-226219107 CTTTGTGAAGGGAGAGAGGAAGG - Intergenic
947942414 2:234069743-234069765 CGGGGGAGAAGGAGAGAGAATGG + Intronic
948645787 2:239403041-239403063 CTGTGTATAAGGAGAAAGGTGGG + Intergenic
1169958041 20:11127774-11127796 TTGTGTCAAAGGAGAGAGTTGGG - Intergenic
1170293793 20:14801783-14801805 CTATGAAAAAGGAAAGTGAAAGG + Intronic
1171062514 20:21979824-21979846 CTATGTAAAAGGACTGAGGAAGG + Intergenic
1171258672 20:23711396-23711418 CTCTGTGAAAGGAAAGAGAACGG + Intergenic
1172136360 20:32689414-32689436 GTGTCTATAAGGAGAGAGGAAGG + Intergenic
1172236349 20:33378265-33378287 CTGAGGAAAGGGAGAGAGATGGG + Intronic
1172438300 20:34946099-34946121 CTGTGATCAAGAAGAGAGAATGG + Intronic
1172840899 20:37902413-37902435 CTTTGTAATGGGAGAGAGACAGG - Intergenic
1172970750 20:38871499-38871521 GTGGGAAGAAGGAGAGAGAAGGG + Intronic
1173171240 20:40725737-40725759 CTGTCTTTAAGGAGAAAGAAGGG - Intergenic
1173181157 20:40807307-40807329 CTGAGTAACTGGAGAGTGAATGG + Intergenic
1173212762 20:41049591-41049613 CTTTGAAAAGGGAGAGGGAAAGG - Intronic
1173349753 20:42233927-42233949 CAGTGTGAAAGGACAGAGGATGG - Intronic
1173563526 20:44022969-44022991 ATATGTAAGAGGAGAGAGAGAGG + Intronic
1173652540 20:44675989-44676011 CTGAATAAAAGGAGAGAAATAGG - Intergenic
1173688152 20:44938488-44938510 CTGTGTCAAAGGTGACAGACAGG + Intronic
1173997842 20:47353061-47353083 CTCTGCCACAGGAGAGAGAAGGG + Intronic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174333265 20:49838105-49838127 ATATGTAAGAGGATAGAGAAGGG + Intronic
1174960058 20:55146034-55146056 GTCTGTAAAAGGAGGCAGAATGG + Intergenic
1175624365 20:60478167-60478189 CTGTGTCAGGAGAGAGAGAAAGG - Intergenic
1176665920 21:9687650-9687672 CTGGGAAAAAGGAAAGACAAAGG - Intergenic
1176741968 21:10613120-10613142 GATTGTAAAAGGAAAGAGAACGG - Intergenic
1177483026 21:21718019-21718041 CTCTGTAAACTGAGAAAGAAAGG - Intergenic
1177619666 21:23570821-23570843 CTCTGTAAAAGCAAAGAGAGAGG - Intergenic
1178008479 21:28253425-28253447 GTGTGAAAAAGAAGAGAGATGGG + Intergenic
1178014843 21:28332545-28332567 ATGTGTAAAGAGAGAGGGAAGGG - Intergenic
1178016695 21:28355053-28355075 CTCTGTACTAGGAGAGAGAGAGG + Intergenic
1178028546 21:28496468-28496490 AGGTGTAGAAGGAGAGGGAAAGG - Intergenic
1178264831 21:31133270-31133292 CAGAGTAATAGGAAAGAGAAGGG - Intronic
1178319407 21:31593891-31593913 ATGTGGAAAAGGAAAAAGAAAGG - Intergenic
1178511945 21:33212737-33212759 GTGTGTAGAGGGAGAGAGAAGGG + Intergenic
1179403502 21:41106649-41106671 CTGTCTTACAAGAGAGAGAAAGG + Intergenic
1180058893 21:45374728-45374750 CTCTGTGGAAGGGGAGAGAACGG - Intergenic
1180452126 22:15473231-15473253 CTTTGTAAAAGGAAAAATAAAGG - Intergenic
1180931547 22:19595746-19595768 CTCTGGAATAGGAGAGAGACAGG + Intergenic
1181573219 22:23779054-23779076 CTGGGCAAATGGAGAGGGAAAGG - Intronic
1182466817 22:30522043-30522065 CTCTGTAAAAAGAAAGAAAAAGG - Intergenic
1183756828 22:39775059-39775081 CTATGTAATAGCAGAGAAAATGG - Intronic
1184714346 22:46272465-46272487 CTGTGGTAAAGGAAAGAGAGGGG - Intronic
1184723979 22:46332390-46332412 CTGTGTACCAGGAGAGGGAGTGG - Intronic
949492802 3:4605640-4605662 CTGTGTAAAAGGTTAGCAAAAGG + Intronic
949694927 3:6683253-6683275 CTGTCTAATTGGAGAGAGAGAGG + Intergenic
950095258 3:10325292-10325314 TTTTGTAAAAGAAGAGTGAAGGG + Exonic
950167736 3:10814544-10814566 CTGAATTTAAGGAGAGAGAAAGG + Intergenic
950222483 3:11206853-11206875 CTGTGGAAAGGGACAGACAAGGG + Intronic
950713133 3:14828125-14828147 ATGTGTGGAAGGAGAGAGAGGGG + Intronic
950955588 3:17050152-17050174 TTCTGTATAAGGAGAGAGATAGG - Intronic
951005523 3:17611377-17611399 GAGTTTAAAAGAAGAGAGAATGG + Intronic
951430002 3:22595791-22595813 GTGTGGGACAGGAGAGAGAAAGG + Intergenic
951508655 3:23477927-23477949 CAGAGTGACAGGAGAGAGAAGGG - Intronic
951521278 3:23612611-23612633 CTGTGAAAAAGGAGAGAGAGGGG + Intergenic
952160049 3:30684293-30684315 ATGTCCAAAATGAGAGAGAAGGG + Intronic
952297482 3:32074068-32074090 CTGTGTAAGAGCAGGAAGAAAGG - Intronic
952651514 3:35733037-35733059 TTATTTAAAAAGAGAGAGAAGGG - Intronic
953483968 3:43277011-43277033 CTGAGGAAAGGGAGAGAGATGGG - Intergenic
953651197 3:44806526-44806548 CTGAGAATGAGGAGAGAGAAAGG + Intronic
954185084 3:48910792-48910814 CTGAGTAAATGGAGAGAGAGTGG + Intergenic
954569379 3:51627767-51627789 CTGTGTAAGAGGAGAGGGAAAGG + Intronic
955267818 3:57464199-57464221 CTGTGGACAAGCAGAGACAAAGG + Intronic
956030079 3:65028085-65028107 CTGAGTAAAAAGAAAGAGAAAGG + Intergenic
956916925 3:73881351-73881373 ATGTGTAAACAGAGAGAGACTGG - Intergenic
957485040 3:80849978-80850000 CTGTGTGAAAAGACAGAGAAGGG + Intergenic
957503222 3:81084760-81084782 GTGTGCAAAAGAAGGGAGAAGGG + Intergenic
958755748 3:98247706-98247728 CTGTGTAACAGCAGGAAGAAAGG - Intergenic
958968006 3:100580292-100580314 CTGTATAATAGGAAAGTGAAGGG + Intergenic
958990881 3:100843430-100843452 CTGTATGACAGAAGAGAGAAGGG + Intronic
959721693 3:109498020-109498042 CTGAGGAAAGGGAGAGAGACGGG + Intergenic
960206949 3:114913754-114913776 TTGTATATAATGAGAGAGAAGGG + Intronic
961548394 3:127652214-127652236 ATGTGGAAAAGGCGAGAGATGGG + Intronic
961615297 3:128174663-128174685 CTGTTTAAAACAGGAGAGAAAGG + Intronic
962047620 3:131777289-131777311 CTGTATAAATGCAGACAGAAAGG + Intronic
963490343 3:145992357-145992379 GTGTGTAGAAAGAGAGAGAGGGG + Intergenic
963547780 3:146683521-146683543 CTTTGTAAATGCAGAAAGAATGG - Intergenic
963989834 3:151640307-151640329 GTGGGAAAAAGGGGAGAGAATGG - Intergenic
964660517 3:159115310-159115332 TGGTGAAAAAGGTGAGAGAATGG + Intronic
964805255 3:160602700-160602722 CTGTCTTAAAATAGAGAGAAAGG - Intergenic
965588625 3:170341966-170341988 CTGAGTAACAGAAAAGAGAAAGG + Intergenic
966061366 3:175760387-175760409 CTGAGTAAGGGGAGAGGGAAAGG + Intronic
966087681 3:176089239-176089261 CTGTGTTTTAGGAGAGACAAAGG + Intergenic
967214397 3:187198307-187198329 CTGTGCAAAAGGAGAAAGCCAGG - Intronic
967776158 3:193388148-193388170 TTGAGTAAGAGGTGAGAGAATGG - Intergenic
968412433 4:401688-401710 CTGTGTAAGAGCAGGAAGAAAGG + Intergenic
968714931 4:2149780-2149802 GTGTCTAAAAAGAGAGAGAGAGG + Intronic
968903294 4:3440906-3440928 CTGTGCAGAGGGAGAGAGAATGG - Intergenic
970105318 4:12575992-12576014 TAGTGGAAAAGGAGAGAAAAGGG + Intergenic
970285944 4:14515046-14515068 CCATGGAAAAGGAGAGAGACTGG + Intergenic
970819583 4:20197051-20197073 CTGTGTAAGAGCAGGAAGAAAGG - Intergenic
972302562 4:37798838-37798860 GTGTCTAAAAGGAAAGAGAAAGG + Intergenic
972753173 4:42013714-42013736 TTTTGTAAATGGCGAGAGAAGGG - Intronic
972758864 4:42081561-42081583 CTGTATAAAATGTGAGACAATGG + Intronic
973022303 4:45218965-45218987 CTTTCTAAAAGTAGAGAAAATGG - Intergenic
974652772 4:64776720-64776742 GTGTGCACAGGGAGAGAGAAAGG - Intergenic
974811479 4:66951901-66951923 GTGAGAAAAATGAGAGAGAAAGG - Intergenic
974827494 4:67149941-67149963 CTGTGCCAAAGGAGAGAGTTTGG + Intergenic
974833689 4:67220621-67220643 CTGTGTAGAAGAAGAAACAATGG - Intergenic
974883289 4:67785768-67785790 CTGTGTAAAATGAACCAGAAGGG - Intergenic
975249169 4:72157368-72157390 CTGCTCAAAAGGAGAGAAAATGG - Intergenic
975765370 4:77661983-77662005 TTGTGTAATAGGAGCAAGAATGG - Intergenic
977059093 4:92234162-92234184 ATGGGAAAAAGAAGAGAGAAAGG - Intergenic
977069699 4:92369331-92369353 CTGTGGAAAAAGACATAGAAAGG + Intronic
977494502 4:97758220-97758242 ATGTGTAAAAGAAAAGGGAAAGG + Intronic
977912003 4:102548132-102548154 ATGTGGAGAAAGAGAGAGAAAGG + Intronic
978421974 4:108542666-108542688 AGGTGAAAAAGGAGAGAGAGTGG - Intergenic
978723853 4:111947029-111947051 CTTTGTAAAAGGGCAGAGACTGG + Intergenic
978755687 4:112300521-112300543 CTATGTGAAAGAAGAGAGGACGG + Intronic
978885892 4:113766004-113766026 CTGTGTAAAATGAGAAAAAAAGG - Intergenic
979590328 4:122471783-122471805 CTGGGGAAAGGGAGAGAGACAGG - Intergenic
979657665 4:123215470-123215492 ATCTGTAAAAGGAGAGGGACTGG - Intronic
979792949 4:124808975-124808997 CTCTGTGAAAGGTGAGAGAAGGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980060476 4:128123461-128123483 CTGGGTAAAGGGATAGAGAATGG - Intronic
980081446 4:128349030-128349052 CTGTGAAAAAACAGAAAGAATGG - Intergenic
980255000 4:130368223-130368245 CTCTGTATAAAGAGAGAGAATGG + Intergenic
980535480 4:134115363-134115385 GTGTGTACAAGTAGAGAGAGGGG + Intergenic
980739094 4:136927937-136927959 CTCTGTAAAAGAACAGACAATGG + Intergenic
980740009 4:136938293-136938315 CTGGGTAAGTGGAAAGAGAAGGG + Intergenic
980952927 4:139399566-139399588 TTGTGAAAAATGTGAGAGAAAGG - Intronic
981013493 4:139950502-139950524 CTGTGAAAAAGGTGATAGGAGGG - Intronic
982455123 4:155600487-155600509 CTGAGTAACAGGAGAGATGATGG + Intergenic
982825463 4:159999019-159999041 TTGTATAAAAGGAGAGTCAAAGG + Intergenic
982833787 4:160096876-160096898 CAGTGCAAAAGGAGAAAAAAAGG - Intergenic
983317845 4:166154836-166154858 GTGGCTAAGAGGAGAGAGAAGGG + Intergenic
983745896 4:171199719-171199741 CTTTGTATAAGGTGAGAGACAGG - Intergenic
983891623 4:173035553-173035575 GTGTGTATGAGGAGAGAGCATGG - Intronic
983993986 4:174158954-174158976 CTATGGAAAAGCAGGGAGAAGGG + Intergenic
984022087 4:174497951-174497973 CTGTCTCAAAAGAGAGAGAAGGG - Intronic
984171569 4:176366256-176366278 CAGTAAAAAAGGAGAAAGAAAGG - Intergenic
984423997 4:179560243-179560265 TTGTGAAAAAGGAGAAAAAAAGG - Intergenic
984770175 4:183430579-183430601 CTGTGGGACAGCAGAGAGAAGGG + Intergenic
984964717 4:185129734-185129756 CTGTGAAAAAAGAAAGAAAAGGG - Intergenic
985088079 4:186334853-186334875 CTGAGAAAAGGGAGAGAGATGGG - Intergenic
985411650 4:189691909-189691931 CTGGGAAAAAGGAAAGACAAAGG - Intergenic
986070506 5:4278308-4278330 CTGTATAAAAGAAAAGAGAGAGG - Intergenic
986077231 5:4350577-4350599 CTTTCTAGAAGGAGAGAGAGAGG - Intergenic
986291749 5:6405489-6405511 CTGTATTAAAACAGAGAGAATGG - Intergenic
986460857 5:7970792-7970814 GGATGGAAAAGGAGAGAGAAGGG - Intergenic
986650578 5:9959523-9959545 CTCTGTTAAAGGAGGGAGCAGGG + Intergenic
987074826 5:14371379-14371401 ATGTACAAAAGGAGAGAGAATGG + Intronic
987246344 5:16053084-16053106 CTGAGTAAAAGGGAAGAAAAAGG - Intergenic
987752766 5:22063373-22063395 CTGTGTGATGGAAGAGAGAAGGG - Intronic
987779370 5:22413903-22413925 ATGTATAAAGAGAGAGAGAAAGG - Intronic
987970413 5:24936864-24936886 CTGTTAAAAAGGAAAGAAAAAGG + Intergenic
988512354 5:31875913-31875935 CTGTGAAAAAGGAGTATGAAAGG - Intronic
988655521 5:33207306-33207328 CTGAGGAGAGGGAGAGAGAAGGG - Intergenic
988669768 5:33368837-33368859 CTGAGGAGAGGGAGAGAGAAAGG + Intergenic
989596933 5:43164953-43164975 CTGTTTCAAAGGAGAGAGAGAGG - Intronic
990716206 5:58639957-58639979 CTGTGGATAAAGAAAGAGAATGG - Intronic
991168610 5:63593852-63593874 GTATGCAAAAGGAGAGAGATAGG - Intergenic
991229378 5:64313299-64313321 ATGGGTAAAGGGAGAGAGGAAGG - Intronic
991500893 5:67276149-67276171 CTGTATAAAAGTTGAGAAAATGG - Intergenic
992163573 5:74026219-74026241 CTGTGTAGCACGGGAGAGAAGGG + Intergenic
992408142 5:76479060-76479082 CGGTGTAAAAGGGGTGAGTATGG - Intronic
992480890 5:77151712-77151734 CTGTCTGGAAGGAGTGAGAAGGG - Intergenic
992785748 5:80168969-80168991 CTGTGTAAAAGTTGAATGAAAGG - Intronic
993074551 5:83212506-83212528 CTGGGACAAAAGAGAGAGAAAGG + Intronic
993458928 5:88159264-88159286 ATCTGGAAAAGGAGATAGAATGG + Intergenic
993746634 5:91606914-91606936 CTGTGAAAAAAGGGAGTGAAAGG + Intergenic
993882790 5:93382397-93382419 CTGTGTAAAAGGAGGCACAGAGG - Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
994044277 5:95290708-95290730 CCATGTCAAAGAAGAGAGAAAGG + Intergenic
994409857 5:99393236-99393258 CAGTATAAAAGGACAAAGAAGGG + Intergenic
994483965 5:100372039-100372061 CAGTATAAAAGGACAAAGAAGGG - Intergenic
994614532 5:102087324-102087346 CTTTCTTAAAAGAGAGAGAAAGG + Intergenic
995150341 5:108836786-108836808 GAGGGGAAAAGGAGAGAGAAAGG - Intronic
995256885 5:110057041-110057063 CTCTTTAACAGGAGAGAAAAAGG + Intergenic
995287795 5:110411385-110411407 CTATCAAAAAGGAGAAAGAAAGG - Intronic
995902754 5:117089593-117089615 ATGAATAAAAGGAAAGAGAATGG + Intergenic
996429544 5:123357374-123357396 ATGTGTAATTGGAGAAAGAATGG - Intronic
996619291 5:125480452-125480474 ATGTGTAAAAAGAGAGAAAAGGG - Intergenic
996842210 5:127859659-127859681 CAGAGAAAAAGAAGAGAGAATGG - Intergenic
996873301 5:128215619-128215641 CTATGGAAAAGGAGACAGCAGGG + Intergenic
997157919 5:131578343-131578365 CTGTGTAAGAGCAGGAAGAAAGG - Intronic
997527920 5:134565399-134565421 CTGGATGAAAGGAGAGGGAAGGG + Intronic
997872608 5:137518457-137518479 CTCTGTCAAAAGAGAAAGAAAGG + Intronic
998262421 5:140641699-140641721 CAGAGGAAAAGGAGAGAGAGGGG + Exonic
998350813 5:141499511-141499533 ATGTACAAAAGTAGAGAGAATGG + Intronic
999042982 5:148435896-148435918 CTGAGGAAAGGGAGAGAGACAGG + Intronic
999250977 5:150182161-150182183 CTGTGCAAGAGAAGAGAGAAGGG - Intronic
999610476 5:153364030-153364052 CTGTGAAAAAGGACAGATACAGG - Intergenic
999675791 5:154001264-154001286 CAGAGTAAAAGGACAGAGAATGG + Intronic
999854882 5:155583421-155583443 CTCTGTAAAATGAGAGAAGAGGG - Intergenic
1000425975 5:161092335-161092357 ATCTGTAAAATGGGAGAGAAGGG - Intergenic
1002254569 5:177949749-177949771 CAGAGGAAAAGGAGAAAGAATGG - Intergenic
1002483422 5:179518063-179518085 CAGAGGAAAAGGAGAAAGAATGG + Intergenic
1002508398 5:179696725-179696747 ATGTGAAAAAGCACAGAGAAAGG - Intronic
1002611545 5:180421969-180421991 CGGTGTAAAAGGAGAGGGTGTGG + Intergenic
1002804883 6:563381-563403 CTGTGTAAATGGGAAGGGAATGG - Intronic
1002817922 6:696128-696150 CTGTGTAGTAGGAGAGTGAGCGG + Intergenic
1002887037 6:1306849-1306871 ATGTATAAAAGTAAAGAGAAAGG - Intergenic
1003045972 6:2733035-2733057 CTGTGTGAAAGCAGATAGAAGGG - Intronic
1003271440 6:4611185-4611207 CTGTTCATAAGGAGAGAGAAAGG + Intergenic
1003579284 6:7325080-7325102 CTGTGGGAGTGGAGAGAGAAGGG - Intronic
1003664476 6:8097745-8097767 CTATGTACAATGAGAGAAAATGG + Intronic
1003698748 6:8439079-8439101 CTGTGTCAAAGAAGGAAGAAAGG - Intergenic
1003899763 6:10643503-10643525 CTGTCTAAACGTAGAGATAATGG - Intergenic
1004908780 6:20261721-20261743 CTTTGAAAAAGGAAAAAGAATGG - Intergenic
1005014112 6:21361205-21361227 CTGGCTAAAAGGGGAGTGAAAGG - Intergenic
1006358205 6:33573037-33573059 GTGTCTATAAGGAGAGAGGAAGG + Exonic
1006487772 6:34358173-34358195 CTCTGAAAAAGAAGAGTGAAGGG - Intronic
1006670170 6:35725490-35725512 CTGGGTGATGGGAGAGAGAAAGG + Intronic
1007219651 6:40268494-40268516 CAGTGTGAAAGGAGAGGGCAGGG + Intergenic
1007726765 6:43921503-43921525 ATGTGTACCAGGACAGAGAAGGG + Intergenic
1008444114 6:51568805-51568827 CTCTATAAAAGCAGAGAAAAAGG - Intergenic
1010044389 6:71423822-71423844 TTTTGTAAAAGGAGAGTTAAAGG - Intergenic
1010072990 6:71766021-71766043 ATATGTAAAAGGAGAGGAAAAGG + Intergenic
1010175768 6:73026314-73026336 CTGGGTAAAAGGAGAGGGATAGG - Intronic
1010388017 6:75304613-75304635 ATGAGAAAAAGGAAAGAGAAGGG + Intronic
1010466740 6:76176187-76176209 CAGAGAAAAAGGACAGAGAAAGG + Intergenic
1011026370 6:82873718-82873740 TTTTGTAATAGGAGAGAGATTGG - Intergenic
1011265657 6:85515496-85515518 CTGTGAAAAGGGAGAAAGAGGGG + Intronic
1011371250 6:86639139-86639161 TTGTGTAAAAGCCAAGAGAAAGG - Intergenic
1011704985 6:89992160-89992182 CTTTGTAAAAAGAAACAGAAAGG - Intronic
1011791797 6:90906966-90906988 CTGTGGAAAGAGAAAGAGAAAGG - Intergenic
1013340372 6:109208610-109208632 TTTTGTATATGGAGAGAGAAGGG + Intergenic
1013700463 6:112762946-112762968 CTGTAAAATAGGAGAGAAAAAGG + Intergenic
1013995908 6:116307692-116307714 CTGTGTAAGAGGGTAGAGAGGGG - Intronic
1014318787 6:119899426-119899448 ATGTGTAACAGGATAGAAAATGG - Intergenic
1014411841 6:121134349-121134371 AAGTGTGAAAGGAGAGAGAATGG - Intronic
1014967669 6:127775818-127775840 ATGATTAAAAAGAGAGAGAAAGG - Intronic
1015056810 6:128912346-128912368 TTGTGTAAAAAGAGGGAGAAAGG - Intronic
1015106220 6:129539786-129539808 CAGTGACAAAGAAGAGAGAAAGG + Intergenic
1015238176 6:130994384-130994406 CTGTGCAACAGGAGAGGGCAGGG + Intronic
1016017681 6:139203294-139203316 GGCTGTGAAAGGAGAGAGAAAGG - Intergenic
1016192134 6:141282539-141282561 CTGTGTAAAAGGAGATGGGATGG - Intergenic
1016220467 6:141663708-141663730 CTGTGGAAAGGTAGAAAGAAAGG - Intergenic
1016324406 6:142883180-142883202 CTCTGCACATGGAGAGAGAAAGG + Intronic
1016616939 6:146061058-146061080 CTGTGGAGAGGGAGAGAGATGGG + Intronic
1016634462 6:146271468-146271490 CTGTGGAAAAGGAGACAAAGGGG + Intronic
1017142536 6:151204751-151204773 CTGGGTGAAAGGTAAGAGAAAGG - Intergenic
1017523359 6:155221482-155221504 CTGTTTCAATGGAGAGAAAAAGG - Intronic
1018346600 6:162905292-162905314 CTGTGTGAATGGAGTGGGAAGGG + Intronic
1018883357 6:167907552-167907574 CTTTGTAAAAACATAGAGAAAGG + Intronic
1018919043 6:168158223-168158245 CTTTGTTAAAGGAGACAGAGGGG - Intergenic
1019026836 6:168972910-168972932 GTGTGTGTATGGAGAGAGAAAGG - Intergenic
1019224288 6:170497524-170497546 CTGTTAAAAAGGAGGGATAATGG - Intergenic
1019941679 7:4297177-4297199 CTGAGTTAAAGGTGAGAGAAGGG - Intergenic
1020100162 7:5389927-5389949 ATCTGTAAAAGGAGAGACCAGGG + Intronic
1020626183 7:10582432-10582454 CTGAGTAGAGGGAGAGAGATGGG - Intergenic
1022073234 7:26938832-26938854 CAGTGTAGAACGAGAAAGAAGGG - Intronic
1022666431 7:32415769-32415791 CTGTGGAAAAAGTGACAGAATGG + Intergenic
1023240049 7:38134106-38134128 AGGTGTCAAAGGAGAGTGAATGG + Intergenic
1023496152 7:40799475-40799497 CAGAGTAAAAGGATAGACAAGGG + Intronic
1023988031 7:45109291-45109313 AAGAGAAAAAGGAGAGAGAAGGG + Intronic
1024062032 7:45704985-45705007 CTGTGGAAAAGGAGAGTGCAAGG - Intronic
1024210346 7:47197901-47197923 CTATGTAAAGGGAGACAGGAAGG - Intergenic
1024228118 7:47343903-47343925 CTATGGAGAAAGAGAGAGAATGG + Intronic
1024425939 7:49226652-49226674 GGTTGTAAAATGAGAGAGAAAGG - Intergenic
1024904893 7:54366030-54366052 CAGTGTAAAAGGAAAAAGAGAGG - Intergenic
1025160320 7:56653763-56653785 CTGTGATAAAGGACAAAGAAAGG - Intergenic
1026840035 7:73665390-73665412 CTGTCTAAAAAGAAAGTGAAGGG + Intergenic
1027385347 7:77654347-77654369 CTGTGGAAAGGAAAAGAGAAGGG - Intergenic
1027808229 7:82857679-82857701 ATGTGTAAAATGAGATAAAATGG + Intronic
1028574020 7:92325987-92326009 CTTTGCAACAGGAAAGAGAAAGG + Intronic
1028642034 7:93053323-93053345 CAGAGAAAAAGAAGAGAGAATGG - Intergenic
1029409315 7:100398579-100398601 CTGGGTGAATGGATAGAGAAGGG - Intronic
1030494238 7:110277376-110277398 CTTTGTAAAAGGGGTGAGATAGG + Intergenic
1031072272 7:117174949-117174971 CTTTGTAAGAGGAGTGAGAGAGG - Intronic
1031541022 7:122994574-122994596 CAGTGGAAAAGGATAGAGAAAGG + Intergenic
1031789861 7:126088543-126088565 GAGTGAAAAAAGAGAGAGAACGG + Intergenic
1032928338 7:136636172-136636194 ATGTTTAAAAGGCAAGAGAATGG - Intergenic
1033112502 7:138593702-138593724 CTAAGGAAAAGGAGAGAGAAGGG + Intergenic
1033383094 7:140843576-140843598 CAGAGTAAAAGCAGAGAGATGGG - Intronic
1033453679 7:141483398-141483420 CTGAGAAGAAGCAGAGAGAAAGG - Intergenic
1033904875 7:146190821-146190843 CTGTTTAGAAAGAGAGAGAAGGG - Intronic
1034063466 7:148114356-148114378 CTTTGTAAAAGGAGTGAAAATGG + Intronic
1034690353 7:153008699-153008721 CTGGGAAAAAGGAGAGAAATGGG + Intergenic
1034934887 7:155192566-155192588 CTGTGTGAGAGGAGAAAGGAAGG + Intergenic
1035426049 7:158774562-158774584 TTGTGTAAGAGAAAAGAGAAAGG - Intronic
1035576773 8:713074-713096 CTGTGACAACTGAGAGAGAACGG - Intronic
1035659364 8:1335192-1335214 CGGTGTAGACTGAGAGAGAAAGG - Intergenic
1036603408 8:10284588-10284610 CTAGGTCAAAGGAGAGATAATGG - Intronic
1037684902 8:21130383-21130405 CTCTTTAGCAGGAGAGAGAATGG + Intergenic
1038154520 8:24976044-24976066 CAGGGTAGCAGGAGAGAGAATGG - Intergenic
1038489024 8:27956310-27956332 ATATATAAAAGGAGAGAAAAGGG + Intronic
1038892549 8:31742792-31742814 CTCTGTGAGAGGAGAAAGAATGG + Intronic
1038998616 8:32954219-32954241 GTGTGTAATAGAAAAGAGAAAGG + Intergenic
1039225127 8:35379757-35379779 GTGTGTATGAGGAGAGACAAAGG + Intronic
1039547832 8:38422404-38422426 CTCTTAAAAAAGAGAGAGAAGGG - Intronic
1040073578 8:43207097-43207119 ATCTGTAAGAGGAGAGAGAGAGG + Intergenic
1040562120 8:48532430-48532452 CTGTGTTAAAGAAGAGAGTGTGG - Intergenic
1041280083 8:56199890-56199912 ATGAGCAAAAGGAGAGAGAATGG + Intronic
1041714844 8:60923556-60923578 ATGCACAAAAGGAGAGAGAAAGG + Intergenic
1041851628 8:62399577-62399599 TTGTATAAAAGAAGAAAGAATGG + Intronic
1042187253 8:66149042-66149064 CTGTCTCAAAGAAGAAAGAAAGG + Intronic
1042890326 8:73602914-73602936 TTCAGTAAAAGAAGAGAGAAAGG + Intronic
1043772494 8:84223059-84223081 CAGGGCAAAGGGAGAGAGAAAGG - Intronic
1043778742 8:84305493-84305515 TTGTGTAAAATGTGAGAAAAGGG + Intronic
1043944763 8:86237524-86237546 CTGAGGAAAAGGAAAGAGACAGG + Intronic
1044454097 8:92371845-92371867 TAGTGTAAAAAAAGAGAGAAAGG + Intergenic
1044460492 8:92438859-92438881 CTGAGTAAAAGAAGACAGCAAGG - Intergenic
1044512382 8:93097358-93097380 CAGTGGCAAAGGAGGGAGAAAGG + Intergenic
1044552498 8:93527761-93527783 CTATGTATAAGGTGAGAGATGGG + Intergenic
1044629197 8:94262473-94262495 TTTTTTAAATGGAGAGAGAAGGG - Intergenic
1044787502 8:95809996-95810018 CTGTGAAAGAAGAGAGAAAAGGG - Intergenic
1045376659 8:101581095-101581117 CTGTCTACATGGAGAGAGACTGG + Intronic
1045679631 8:104644835-104644857 GTGTGTAAAAAGAAAGAAAAAGG - Intronic
1045784518 8:105904732-105904754 ATCTGCAAGAGGAGAGAGAAGGG - Intergenic
1046060777 8:109136913-109136935 TTTTGTATAAGGTGAGAGAAGGG + Intergenic
1046115668 8:109780310-109780332 CTGAGTAGGAGGAGAGAGAGGGG - Intergenic
1046141748 8:110103150-110103172 TTGGGAGAAAGGAGAGAGAAGGG - Intergenic
1046581949 8:116103926-116103948 CAGGGTAAAAGGAGAGAAAGTGG - Intergenic
1048092683 8:131258581-131258603 ATTTGTAAGAGGACAGAGAAAGG + Intergenic
1048288916 8:133164714-133164736 CTGTGGAGAAGGACAGTGAATGG - Intergenic
1048954117 8:139520301-139520323 CTTTGTATAGGGTGAGAGAAAGG + Intergenic
1049370944 8:142266638-142266660 CTGTGGAACAGCACAGAGAAAGG - Intronic
1051421352 9:16892497-16892519 TTGTGTAAAAAAGGAGAGAAAGG + Intergenic
1051684816 9:19647031-19647053 GTGTGGAAAGAGAGAGAGAAAGG - Intronic
1052026138 9:23575447-23575469 CTATGTAAAATAAGAGATAAAGG + Intergenic
1052187962 9:25621557-25621579 CAGTGTAAAATCAGAGAAAAGGG + Intergenic
1052423692 9:28276238-28276260 CTGTGTACATGAAGAGAGGATGG - Intronic
1052976150 9:34411768-34411790 CCATATAAAAGTAGAGAGAATGG + Intronic
1055494113 9:76837562-76837584 ATGTGGAAAAGGATAGAGCAGGG + Intronic
1055636715 9:78286453-78286475 CTGTGTAAAGGAGGAGGGAAGGG + Intergenic
1056311109 9:85341877-85341899 CTGTGTTAAAGGAAGGTGAATGG - Intergenic
1056448907 9:86695681-86695703 CTGAGTAAAGGAAGAGAGATAGG + Intergenic
1056484190 9:87037947-87037969 CTGTTTTATAGCAGAGAGAATGG + Intergenic
1056942505 9:90967400-90967422 ATGTGTAAAAGGAGAAAGGGAGG - Intergenic
1057307529 9:93920876-93920898 CTGAGAAAATGGAGAGAGACAGG - Intergenic
1058284492 9:103159289-103159311 CAGTCAAAAAGGAGAAAGAAGGG - Intergenic
1058949544 9:109890868-109890890 CTGTTTCAAAGGAGATAAAAAGG - Intronic
1058984400 9:110197808-110197830 CTGTGTAAACACAGACAGAAGGG + Intronic
1059217203 9:112575148-112575170 CTGTGTTAACTGAGGGAGAAAGG - Exonic
1059770936 9:117424890-117424912 TAGTGTTAAAGCAGAGAGAAAGG - Intergenic
1059811658 9:117861895-117861917 ATGAGTAAAAGGGAAGAGAAGGG - Intergenic
1060562644 9:124559315-124559337 CTGTCTAAAAGTAGAATGAATGG - Intronic
1060828335 9:126699034-126699056 ATGTGCAAAAGGAGAAAGAGGGG - Exonic
1061207602 9:129173891-129173913 CTGTGGTAAAGGAGAGTGGATGG - Intergenic
1061733630 9:132636788-132636810 CAGTGAATAAGGAGAAAGAAAGG + Intronic
1061784316 9:133017005-133017027 CTGTGGAAAGGGAGAGAGATGGG - Intergenic
1203660178 Un_KI270753v1:34111-34133 CTGGGAAAAAGGAAAGACAAAGG + Intergenic
1203670946 Un_KI270755v1:11073-11095 CTGGGAAAAAGGAAAGACAAAGG + Intergenic
1185774087 X:2788077-2788099 CTGTCTCAAGAGAGAGAGAAAGG + Intronic
1186817446 X:13251912-13251934 CTGTGAAAATGAAGAGAGGAGGG - Intergenic
1186914811 X:14207955-14207977 CTGTGTAGAGGGGGAGAGATGGG + Intergenic
1186976437 X:14911531-14911553 GTGTGTAAAAAGAAAGAGGAAGG + Intronic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187311024 X:18142878-18142900 CTGAGGAGAAGGAGAGAGACAGG - Intergenic
1187839313 X:23470555-23470577 TTGAGGAAAAGGAGAGAGACAGG - Intergenic
1187986375 X:24816936-24816958 TTATGTAAAAGTAGAGAGCATGG + Intronic
1188096432 X:26028848-26028870 CACTGTTAGAGGAGAGAGAATGG + Intergenic
1188291446 X:28393611-28393633 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1188454173 X:30343240-30343262 CAGAGTAATAGCAGAGAGAAAGG + Intergenic
1188671431 X:32886731-32886753 CTGTCTAAAAGGAAACAAAATGG + Intronic
1189271775 X:39757107-39757129 ATGTGCAAAAGAAGAGAGTATGG - Intergenic
1189314255 X:40042603-40042625 CTATATAAAAGGTGAAAGAATGG + Intergenic
1189591578 X:42517986-42518008 GTGTGTAAAAAAATAGAGAAGGG - Intergenic
1189648233 X:43157907-43157929 CCCTGTGGAAGGAGAGAGAAAGG + Intergenic
1190828718 X:54042353-54042375 CTTTGTAACAGGAAAGAAAAGGG + Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1192179824 X:68909437-68909459 CAGGGTAAAAGGAAAGAGAGTGG + Intergenic
1192248177 X:69389829-69389851 TCGTGTTAAAGGAGAGAGACTGG - Intergenic
1192666463 X:73092972-73092994 TTGTGTATAAGGTGAGAGATAGG + Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1193711224 X:84882712-84882734 ATGAGGGAAAGGAGAGAGAAGGG + Intergenic
1194386270 X:93259157-93259179 CTGTGTAAAAGTGCAAAGAAGGG - Intergenic
1194580248 X:95663095-95663117 ATGAGGAAAAGGAGAGAGAGAGG - Intergenic
1194760500 X:97790375-97790397 CTGTTTAAAAATAGAGAGAGAGG - Intergenic
1195065602 X:101235760-101235782 GTGTGAACAAGGGGAGAGAAGGG - Intronic
1195377310 X:104240318-104240340 CTGGGTGAAAGGGGAGAAAATGG + Intergenic
1195497653 X:105555872-105555894 CTCTTTAAAAGGGGAGAAAAAGG - Intronic
1195777377 X:108422359-108422381 CTGTCTAAAAAGAAAGAAAAAGG + Intronic
1195910881 X:109887399-109887421 CAGTGTCAAGGGAGAGAAAAAGG - Intergenic
1195942732 X:110179017-110179039 GTGTGGAAGATGAGAGAGAAAGG + Intronic
1196071195 X:111524383-111524405 ATGAGTAAAAGGAGAGAGTAAGG + Intergenic
1196969356 X:121092016-121092038 CTGTTCAAAAAGAGAGAGCAGGG - Intergenic
1197127503 X:122964789-122964811 CTGAGTACTAGGTGAGAGAAAGG + Intergenic
1197163632 X:123351614-123351636 CTGACTTAAAGGAGAAAGAAGGG - Intronic
1198281417 X:135146520-135146542 CTGAGGAGAAGGAGAGAGATGGG + Intergenic
1198289542 X:135225996-135226018 CTGAGGAGAAGGAGAGAGATGGG - Intergenic
1198321761 X:135524483-135524505 CTGTGAAAAAAGAGAAACAATGG - Intronic
1198384367 X:136114550-136114572 CTGTGGAACAAGAGAGAGAGTGG - Intergenic
1199577599 X:149328401-149328423 CTGAGTAGAAGGAGAGAGATGGG - Intergenic
1200645753 Y:5781358-5781380 AGGGGGAAAAGGAGAGAGAAAGG - Intergenic
1200743018 Y:6875756-6875778 GGGAGTAAAAGGAGAGAGAAGGG + Intergenic