ID: 1140515540

View in Genome Browser
Species Human (GRCh38)
Location 16:75538773-75538795
Sequence CCACATCCTCAGGAGGTGAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140515532_1140515540 25 Left 1140515532 16:75538725-75538747 CCTGCTTGGGATCAGGAAGCAGC 0: 2
1: 0
2: 2
3: 13
4: 227
Right 1140515540 16:75538773-75538795 CCACATCCTCAGGAGGTGAATGG 0: 1
1: 0
2: 1
3: 20
4: 237
1140515535_1140515540 1 Left 1140515535 16:75538749-75538771 CCATGTGTTCTTGGAGGAGACTG 0: 2
1: 0
2: 2
3: 42
4: 438
Right 1140515540 16:75538773-75538795 CCACATCCTCAGGAGGTGAATGG 0: 1
1: 0
2: 1
3: 20
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140515540 Original CRISPR CCACATCCTCAGGAGGTGAA TGG Exonic
900582879 1:3417959-3417981 CCCCATCCTCAGGAAGGGCAAGG + Exonic
902559773 1:17270225-17270247 ACACATCCTCAGGACCTGGAAGG - Exonic
902846688 1:19116360-19116382 CCACCTCCTCTGGAGGGGAATGG + Intronic
904809082 1:33151567-33151589 CCTCATCCCCAGGAGGTGACAGG + Intronic
904869916 1:33610419-33610441 CCACATCCACAGGTGATGGATGG + Intronic
905428447 1:37902867-37902889 CCAGCTACTCAGGAGGTGAAGGG + Intronic
906290046 1:44613984-44614006 CCACAGCCTCTGGAGCTGCAAGG + Intronic
907673466 1:56497287-56497309 TCACATCCCCAGGAGGAAAAAGG - Intronic
908569357 1:65392603-65392625 CCACATCCTCAGGGGGTGGAGGG - Exonic
909433382 1:75615286-75615308 CTCCATCCTCAGGAGGAGATTGG - Intergenic
910501991 1:87902981-87903003 ACACATCTTCAGGAGGAGGAAGG + Intergenic
910816419 1:91296031-91296053 CCAGCTACTCGGGAGGTGAATGG - Intronic
911041151 1:93592040-93592062 CCACATGTTCAGGAAGTGAAGGG - Intronic
911088149 1:93996611-93996633 CCAGATCCTCAGGGGTTAAATGG + Intronic
911521603 1:98936511-98936533 CCTGATCCTCAGGATGTGCATGG + Intronic
911688973 1:100809559-100809581 GAACATCTTCAGGAGGTAAAAGG + Intergenic
912267766 1:108175579-108175601 CCAGGTACTCAGGAGGTGAGAGG + Intronic
913180996 1:116321357-116321379 CCACATTCTTAGGCGGTAAATGG + Intergenic
913599145 1:120406041-120406063 CCACGTCCTCAGGAGGAGGGAGG + Intergenic
913936947 1:125064474-125064496 CCACAGCCTCAGGGGTTGACTGG - Intergenic
914088232 1:144473579-144473601 CCACGTCCTCAGGAGGAGGGAGG - Intergenic
914310379 1:146460631-146460653 CCACGTCCTCAGGAGGAGGGAGG + Intergenic
914591730 1:149112511-149112533 CCACGTCCTCAGGAGGAGGGAGG - Intergenic
914901711 1:151714670-151714692 GCACATCCTGAGGAGGGGCAGGG + Exonic
915025494 1:152826029-152826051 TCAGCACCTCAGGAGGTGAATGG - Intergenic
916262400 1:162855418-162855440 CCACATCCTAATAAGTTGAAAGG - Intronic
916524569 1:165597666-165597688 CTACTTCCTCAGAAGGTGGAAGG + Intergenic
920502502 1:206494150-206494172 TGACATCCTCAGGAGGTGTAGGG + Intronic
920567800 1:206989453-206989475 CGACTTCCTCCTGAGGTGAAAGG + Intergenic
920650315 1:207832658-207832680 CCACATACTTTGGAGGTGAGAGG + Intergenic
921127710 1:212192387-212192409 AGACATCTTCAGTAGGTGAATGG + Intergenic
924320394 1:242842958-242842980 CCACAGCACCAAGAGGTGAAAGG - Intergenic
924422274 1:243920754-243920776 CTGCATCCTCAGGAGCTTAAGGG - Intergenic
1063766022 10:9141457-9141479 CCACAACAGCAGGAGGTGAGCGG - Intergenic
1064603740 10:17017501-17017523 CCATATCCTGAGGAAGGGAAGGG + Intronic
1066540999 10:36446904-36446926 TCACATCCTCAGGCGCTGAAAGG + Intergenic
1069539012 10:69279263-69279285 CCTCTTCCTCATGTGGTGAAGGG + Intronic
1069721335 10:70551398-70551420 CCACAGCCTCTGGATGTAAATGG + Intronic
1071394903 10:85213386-85213408 CCACACCCCCTGGAGGGGAATGG - Intergenic
1071397568 10:85238556-85238578 TCACATCCGGAGGAGGTGAGGGG + Intergenic
1071508093 10:86245062-86245084 CCATCGCCTCAGGAGGAGAAAGG - Intronic
1072589269 10:96812538-96812560 CCAGCTACTCAGGAGGTGGAAGG + Intergenic
1074010287 10:109471906-109471928 CCACACCCTGAGCAGGTGAGAGG + Intergenic
1074431953 10:113401813-113401835 CTGCATCCTCAGGTGGTGAAAGG + Intergenic
1074693730 10:116029475-116029497 CCACAGCCCCAGAAGGTGGAGGG + Intergenic
1076218076 10:128711597-128711619 CCTCATTCTCAGGAGGGGAGAGG - Intergenic
1077063927 11:630311-630333 AAACGTCCTCAGCAGGTGAATGG - Intergenic
1077506562 11:2932314-2932336 CCACGGCCTTAGGAGGTGAGAGG + Intergenic
1080245534 11:30175793-30175815 GCAAATCCTCAGGAAGTGACTGG - Intergenic
1081872000 11:46387377-46387399 CCAGCTACTCAGGAGGTGAGAGG - Intergenic
1082258788 11:50061836-50061858 CCACCTCCTCAGGAGGCTGAGGG - Intergenic
1083932649 11:65854326-65854348 CCACATCTAGAGGAGGTCAAAGG + Intronic
1084549327 11:69831441-69831463 CCACCTCCTCAGAAGGTGCATGG + Intergenic
1084603647 11:70160676-70160698 GGACATCCTCAGGTGGTGCAGGG - Intronic
1085028274 11:73253042-73253064 CCACATCCTCAAGTGGTGACAGG + Intergenic
1085121490 11:73970176-73970198 CCACAGCCTCAGGGTGTGCAGGG + Exonic
1085173703 11:74468825-74468847 CCAGTTACTCAGGAGGTTAAGGG - Intergenic
1085594779 11:77799391-77799413 CCAGCTACTCAGGAAGTGAAAGG + Intronic
1087298114 11:96400728-96400750 CCACATGAGCAGAAGGTGAAAGG - Intronic
1088013415 11:105031225-105031247 CCACATCCTCAGGCTCAGAAGGG - Exonic
1089054738 11:115576472-115576494 CCAGATACTCAGGAAGGGAAAGG - Intergenic
1090921322 11:131208382-131208404 CCAAATGGTCAGGATGTGAAGGG + Intergenic
1093699037 12:22196976-22196998 CCACACTCTCAGGATGTAAAAGG - Exonic
1098019686 12:66140650-66140672 CCAGCTACTCAGGAGGTGGAGGG + Intronic
1098122641 12:67257621-67257643 CCACACCCACAGTAGCTGAAAGG + Intergenic
1099317128 12:81098069-81098091 GCACATCTTTAGGATGTGAAAGG - Intronic
1101785121 12:107875826-107875848 CCTCTTCCTTAGGAGGTTAATGG - Intergenic
1101841788 12:108332863-108332885 CCACCTACTCAGGAGGTGGGAGG + Intronic
1102425162 12:112838342-112838364 CCACATCCTCAGAATGCCAACGG - Intronic
1102596763 12:113998825-113998847 CCACATCTTCACATGGTGAAAGG - Intergenic
1103513508 12:121491203-121491225 CCACTTCCTTAGGAGAAGAAAGG - Intronic
1104608246 12:130205479-130205501 CCACATCCTGAGAAGGGGACAGG + Intergenic
1105627515 13:22127110-22127132 ACACATCCTCAGGGATTGAAGGG - Intergenic
1106619680 13:31361384-31361406 CCATATCCTCAGCAGGGCAAGGG - Intergenic
1107290639 13:38849192-38849214 CAAAATCATCAGGAGGAGAAAGG - Intronic
1109523847 13:63548288-63548310 CTGCATCCTCACAAGGTGAAAGG - Intergenic
1114469878 14:22953256-22953278 TCAGCTCCTCAGGAGGTGGAAGG - Intronic
1115712469 14:36066054-36066076 CCACATCCTCACGTGGTGGAAGG - Intergenic
1116798133 14:49413590-49413612 CAGTATCCTGAGGAGGTGAAAGG - Intergenic
1118367287 14:65106686-65106708 CCAAAGCCTCAGGAGGTAGAGGG - Intergenic
1119805651 14:77480389-77480411 CCAAATCCTCAGGGTGTGCAGGG + Intronic
1122907525 14:104808595-104808617 CCACAACAGCTGGAGGTGAAGGG - Intergenic
1123490013 15:20773506-20773528 CCACAGCCTGAGGACGTGATAGG + Intergenic
1123546514 15:21342593-21342615 CCACAGCCTGAGGACGTGATAGG + Intergenic
1125607440 15:40949161-40949183 ACAGATCCTCAGGAGATGAGAGG + Intergenic
1125936264 15:43638923-43638945 CCAGGTCCTGACGAGGTGAACGG + Exonic
1127881396 15:63161585-63161607 CCACACCCTTCTGAGGTGAAGGG - Intergenic
1129163532 15:73761570-73761592 CTCCATCCTCACGTGGTGAAAGG - Intergenic
1129311833 15:74718243-74718265 CCACATAGCCAGGAGCTGAAGGG - Intergenic
1129706887 15:77799450-77799472 CCACACCTCCAGGAGGTAAAGGG + Intronic
1130690024 15:86074232-86074254 CTGTATCCTCAGGTGGTGAAAGG + Intergenic
1131834752 15:96379214-96379236 CCATATACTCAGGATGAGAAAGG - Intergenic
1134067552 16:11238873-11238895 CCACATTCTAAGGAGCTGGAGGG - Intergenic
1134649869 16:15899826-15899848 CCACTTCCTCAGGTGCTCAAGGG + Intergenic
1134826324 16:17287370-17287392 CCACAGCCCCAGGAGGTGGGAGG - Intronic
1135405546 16:22195076-22195098 CCACAGCCTCAGGACGAGCACGG + Intergenic
1135633273 16:24052864-24052886 CTGCATTCTCAGGAGGTTAAGGG - Intronic
1136107692 16:28042096-28042118 TCACATCACCAGGAGGTGAGAGG + Intronic
1137484955 16:48882955-48882977 CCACATCCACTGGAGGTGTGGGG - Intergenic
1138499598 16:57431419-57431441 CCACATGCTCAAGAGGCCAACGG + Intronic
1139446915 16:67003713-67003735 CCACCTCCTTAGAAGGTGATAGG + Intronic
1140515540 16:75538773-75538795 CCACATCCTCAGGAGGTGAATGG + Exonic
1143677176 17:8442892-8442914 CCACCTACTCGGGAGGAGAATGG - Intronic
1144024595 17:11266845-11266867 GCACATCCTCTGGGGATGAAAGG + Intronic
1145888361 17:28397912-28397934 CCACATCATCAGAAAGTCAAAGG + Exonic
1147927620 17:43955188-43955210 CCACCTGCCCAGGAGGAGAAAGG + Intronic
1148030958 17:44620648-44620670 CCAGCTACTCAGGAGGTGAAGGG - Intergenic
1149073737 17:52574491-52574513 CCACATCCTGAGGGAGGGAAGGG - Intergenic
1150603901 17:66675221-66675243 CCACATCCTCACACGGTGGAAGG + Intronic
1151240006 17:72750181-72750203 TCACATCCCCAGGAAGTGGATGG + Intronic
1151301728 17:73232040-73232062 CCAGATCCTCAGGCGACGAATGG + Intronic
1151342512 17:73481067-73481089 CAGCAGCCTCAGGAGGGGAAGGG + Intronic
1152378845 17:79931810-79931832 CCACATCAGCAGGAGGTGAGTGG + Intergenic
1152830450 17:82494132-82494154 CCACTCCCTCAGGAGAGGAAGGG + Intergenic
1153412591 18:4810407-4810429 CTCCATCTTTAGGAGGTGAAAGG - Intergenic
1155304590 18:24466453-24466475 ACACATACTCTGGAGATGAAAGG + Intronic
1162102040 19:8344737-8344759 CCTCAGCCTCAGGAGGTGCTAGG - Intronic
1162529626 19:11228477-11228499 CCACAACCTAGGGAGGTGAGAGG - Intronic
1165396917 19:35569531-35569553 TGACCTGCTCAGGAGGTGAAGGG - Intergenic
1166087332 19:40485695-40485717 CCAGATACTCAGGAGGTGGGAGG + Intronic
1166740361 19:45111001-45111023 CCAAGTCCTCAGTAGGTGACAGG - Intronic
1168707756 19:58479631-58479653 CCACATCCGCAGGAGGAGTGGGG + Exonic
925580615 2:5406523-5406545 CCACAGCCTCAGCAGGCTAAAGG + Intergenic
927742225 2:25581874-25581896 GCACACACTCAGGAGGTGCATGG + Intronic
927930276 2:27039408-27039430 CCATTTCCTCAGGAGTTAAAAGG - Intronic
928374513 2:30764041-30764063 CCACATCCTCCTTAGCTGAATGG + Intronic
928654016 2:33430824-33430846 TCACATCCTCAGGATTAGAAAGG - Intergenic
928718297 2:34089242-34089264 CCAGCTACTCAGGAGGTCAAAGG - Intergenic
929299326 2:40284848-40284870 CCACTTCTTCAAGAGGTAAAAGG + Intronic
930714917 2:54584505-54584527 CCACACCTTCAGTAGGTGAAAGG + Intronic
931219622 2:60277471-60277493 ACACAACCTCAGGATCTGAAGGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936463401 2:112727284-112727306 CCACAGCCTTAAGAGGTGGATGG + Intronic
937216820 2:120318291-120318313 CCACTTCCTCTGGGGGTAAAGGG + Intergenic
941270945 2:163428050-163428072 CCAAATCTTCAGGAAATGAAAGG - Intergenic
942381516 2:175396304-175396326 CCACATCCTTAGGAGGCAGATGG + Intergenic
944557316 2:200900329-200900351 CCAAATCCTTTGGAGGTGTAAGG - Intronic
944738536 2:202589831-202589853 CTACAGCCTGAGGAGGTGCAAGG + Intergenic
945334801 2:208579558-208579580 CAGCAGCCTCAGGAGGTGAGAGG - Intronic
946096279 2:217277224-217277246 CCGTATCCTCAGGTGGTGGAGGG + Intergenic
946611590 2:221464152-221464174 CCAGATCCTGGGGAGGGGAAAGG - Intronic
946944479 2:224806717-224806739 CCAGCTACTCAGGAGGTTAAGGG - Intronic
947752396 2:232539849-232539871 CCACAGCCTCAGGGGATGGAGGG + Intronic
1170900403 20:20456925-20456947 CCAGCTCCTCAGGAGGTGGGAGG - Intronic
1173320815 20:41985343-41985365 CCACACCAGCAGGAGGTGAGTGG + Intergenic
1174483626 20:50847928-50847950 CCAGCTACTCAGGAGGTGGAAGG + Intronic
1179208882 21:39309334-39309356 CCAGCTACTCAGGAGGTGGAGGG + Intronic
1179397268 21:41052648-41052670 GTTCATCCTCAGGAGCTGAATGG - Intergenic
1182088360 22:27577037-27577059 CCAAAGCCTCATGAGCTGAATGG - Intergenic
1183696901 22:39428690-39428712 GCACATTCTAAGGAAGTGAAGGG - Intronic
1184034675 22:41912840-41912862 CCCCATCCCCAGCAGGTGCAGGG + Intronic
1184632018 22:45789122-45789144 GCACATCTTCATGAGCTGAAAGG + Intronic
950652927 3:14418898-14418920 CCACTTCCTCAGGCTGGGAACGG + Intronic
950752658 3:15142853-15142875 CAACATCCTTAGAAGGTTAATGG + Intergenic
950844624 3:16002622-16002644 TCACATCTTCATGAGGAGAATGG + Intergenic
953783878 3:45896175-45896197 CCACAGCCTCAGGGATTGAAAGG - Intronic
955944801 3:64182588-64182610 CTGCATCCTCAGGTGGTGAAAGG - Intronic
956527524 3:70181381-70181403 CAGCAACCTCAGGAGTTGAAGGG + Intergenic
957198934 3:77107135-77107157 CGGCATCCTCACAAGGTGAAAGG + Intronic
963042112 3:141077674-141077696 CCTCACCCTTAGGAGATGAACGG - Intronic
963084385 3:141423087-141423109 CCGTATCGTCAGGAGCTGAAGGG - Intronic
963173726 3:142277386-142277408 CTGCATCCTCACGTGGTGAAAGG - Intergenic
963292509 3:143506337-143506359 CTACTTCCTAAGGAAGTGAATGG + Intronic
963900159 3:150726064-150726086 CCAGCTACTCAGGAGGTGGAAGG - Intergenic
966855515 3:184191323-184191345 CCAGATCCTCAGGCTGTAAAGGG + Intronic
967537464 3:190623375-190623397 CCACATGATCATTAGGTGAATGG - Exonic
967747522 3:193074509-193074531 CCACATGTTGAGGAGGTGATTGG - Intergenic
968887937 4:3345514-3345536 CCACATCATCAGGAAGTGACTGG + Intronic
969560247 4:7942155-7942177 ACACAACCTCAGGGAGTGAAAGG + Intergenic
972304251 4:37816891-37816913 CCACATCCTCAGAATGTGTGAGG - Intergenic
976618477 4:87102505-87102527 CCTCATCCTTAGAATGTGAAGGG + Intronic
978955502 4:114607815-114607837 CCAAGACATCAGGAGGTGAATGG - Intronic
978957323 4:114630511-114630533 CCACATGCTGAGGAGAAGAATGG + Intronic
979720724 4:123897020-123897042 CCACATCCTTAGCAGGTTATAGG - Intergenic
980919740 4:139071403-139071425 CCAGCTGCTCAGGAGGTGAGAGG - Intronic
981566943 4:146111794-146111816 CCACATCCCCAGGAGTCCAAGGG + Intergenic
981642747 4:146964047-146964069 CCACATCCTCATGTGGTAGAAGG + Intergenic
981693918 4:147540140-147540162 GCACAGCCTCAGGAGGGGAGGGG - Intronic
981918813 4:150064398-150064420 CGACAACCTTGGGAGGTGAATGG + Intergenic
983564795 4:169138383-169138405 CAACATCCTCATGAAATGAAGGG + Intronic
984954307 4:185030469-185030491 CCTTATCCTCACCAGGTGAAGGG + Intergenic
985931291 5:3059604-3059626 CCACCTCCTCAGGAAATGAATGG + Intergenic
988794066 5:34636045-34636067 CCGCATCATCAGATGGTGAAAGG + Intergenic
989963618 5:50443789-50443811 CCACGTCCTCTGGAAGTTAAAGG - Intergenic
990435437 5:55785751-55785773 CCTCATCCTCAGGTGGAGGAGGG - Exonic
993247454 5:85468746-85468768 GCAAATCTTCAGAAGGTGAAGGG - Intergenic
993757903 5:91754019-91754041 CTACATACCCAGGAGTTGAATGG - Intergenic
995211466 5:109544564-109544586 CCAGATACTCAGGAGGTTAAGGG - Intergenic
995437199 5:112149975-112149997 TAACATCCTCAGTAAGTGAATGG + Intronic
995583629 5:113624625-113624647 CCACACCCTGAGGAAGGGAAGGG + Intergenic
996660490 5:125996841-125996863 CCAGCTACTCAGGAGGTTAAGGG + Intergenic
997744477 5:136287210-136287232 CCACCTCCTAAAGAGGTGGAAGG - Intronic
998182387 5:139954491-139954513 CCACTTCCTCAGCAGGAGAGTGG - Intronic
998391223 5:141788243-141788265 GCAGATCCTCTGGAGGGGAAAGG + Intergenic
998518313 5:142776632-142776654 CCAAATCATCAGCTGGTGAATGG - Intronic
999323128 5:150626841-150626863 GCACATCCTTAATAGGTGAATGG + Intronic
999859825 5:155633505-155633527 CCACAAACTCAGGAGGGGTAGGG - Intergenic
1002174361 5:177393217-177393239 CCTTATCCTCAGGGGGTGTAAGG - Intronic
1002390824 5:178910391-178910413 CAACATCCTCAGGAGATGGTGGG - Intronic
1002594693 5:180314210-180314232 CCTCATCCTCAAGAGGAAAATGG - Intronic
1002810431 6:623021-623043 CCTCATCCTCAGAAGGAGCAGGG + Intronic
1003277388 6:4664340-4664362 CCACCTCCTCAGGCCGTGACTGG + Intergenic
1003394895 6:5744596-5744618 CCACATCCTCAGCAGCTTATCGG + Intronic
1003420716 6:5956155-5956177 CGACATCCATGGGAGGTGAATGG + Intergenic
1004289156 6:14350748-14350770 GCACAACCCCAGGAGGGGAAAGG + Intergenic
1004714379 6:18203166-18203188 CCAGCTACTCAGGAGGTGAGAGG + Intronic
1005193967 6:23260577-23260599 CCACATGCTCAGGAAGATAAAGG - Intergenic
1006345026 6:33473904-33473926 CCAGCTACTCAGGAGGTGAGAGG + Intergenic
1007615902 6:43179715-43179737 CCAGCTACTCAGGAGCTGAAGGG - Exonic
1007730856 6:43945103-43945125 ACACACCCTCAGGAGGGAAATGG - Intergenic
1007936082 6:45733248-45733270 CCAAAACCTCAGGAGGGAAAAGG - Intergenic
1009610681 6:65937197-65937219 CCAGCACCTCAGGAGGTCAAGGG - Intergenic
1009878706 6:69538547-69538569 CCACATTCTCTGGAGGACAAAGG + Intergenic
1013559846 6:111293097-111293119 CCAGCTACTCAGGAGGAGAATGG + Intergenic
1015569218 6:134604489-134604511 CCACAAGCTCAGGAGGTGCAGGG - Intergenic
1015725031 6:136290988-136291010 CCACATCCTGAGGTGGTAATGGG - Intergenic
1016048884 6:139508812-139508834 CAGCACCCTTAGGAGGTGAATGG + Intergenic
1016897400 6:149066823-149066845 CCAAATACTCAGGAGGTTGAGGG + Intronic
1017925105 6:158904287-158904309 CTACATCCTCAGGAAAAGAATGG + Intronic
1021853852 7:24834295-24834317 CCAAATCCTCACAAGGTGACTGG + Intronic
1021930689 7:25578359-25578381 CCACTTCCTCAGGAGGCCCAGGG + Intergenic
1022654237 7:32304277-32304299 CCATATCCTCATGAGGAGATGGG - Intergenic
1022735052 7:33068390-33068412 CCAAATCAACATGAGGTGAATGG + Intergenic
1026695062 7:72583881-72583903 CCATATCCTCAGGAAGTAGAAGG + Intronic
1027057516 7:75060266-75060288 CCTATTCCTCAGCAGGTGAATGG - Intronic
1029671085 7:102031430-102031452 CCACATTCTCAGTAGGATAATGG + Intronic
1029902994 7:104061815-104061837 CTACATCCTCATGTGGGGAATGG - Intergenic
1030009058 7:105147900-105147922 CCAAATGTTCATGAGGTGAAGGG - Intronic
1032034588 7:128512488-128512510 CCAGATCCTCCTGGGGTGAAGGG + Intergenic
1032097523 7:128947015-128947037 CAACATCCTCTGCAGCTGAAGGG - Exonic
1033285112 7:140034828-140034850 CCAAATCCTCAGGATGAGTATGG - Intronic
1035935564 8:3834300-3834322 CCACATCCACAGAGGGTAAAGGG - Intronic
1036963367 8:13269950-13269972 CCAGCTACTCAGGAGGAGAATGG + Intronic
1037072521 8:14669241-14669263 CCAGCTACTCAGGAGGTGAGAGG + Intronic
1037519378 8:19665126-19665148 CCACCTACTCAGGAGGTTGATGG - Intronic
1040948972 8:52916773-52916795 TCACATCCTCAGCAGCTGAGAGG + Intergenic
1042046419 8:64657395-64657417 CAACATCCCCAGGAGGTGTTCGG + Intronic
1042201433 8:66282474-66282496 AGACAACCTCAGGAGGAGAAAGG - Intergenic
1042897859 8:73691177-73691199 CCACAAACTCAAGAGGTAAAAGG + Intronic
1044532068 8:93318471-93318493 CAACAGTGTCAGGAGGTGAAAGG - Intergenic
1045401189 8:101819914-101819936 CCACAGGTTCAGGAGGTGACAGG - Intronic
1049414524 8:142489167-142489189 CCCCAGCCACAGGATGTGAAGGG + Intronic
1055556341 9:77477426-77477448 CCATATTCTCAGCAGGGGAATGG - Intronic
1055590685 9:77810358-77810380 CCACATACTTAGTAAGTGAATGG - Intronic
1057275710 9:93675091-93675113 CCACATTCTCAGGGGCTGGAGGG - Intronic
1057465564 9:95311127-95311149 CCAGCTACTCAGGAGGAGAATGG + Intronic
1058845726 9:108957234-108957256 CCAGCTACTCAGGAGGTGGAAGG - Intronic
1059652172 9:116325084-116325106 CCACTTCCTCTGGTGGAGAAAGG - Intronic
1061901888 9:133677271-133677293 CCACATCCTCCAGGGGTGAGAGG + Intronic
1062506971 9:136882550-136882572 CCCCATCCTCAGGCAGTGAGAGG + Intronic
1062656520 9:137606637-137606659 CCACAGCCTCAGGCGGTGCAGGG - Intronic
1186895781 X:14003239-14003261 CCACATTCACAGGAAGTGGAAGG - Intergenic
1192733034 X:73820025-73820047 CCAGACCCTGAGTAGGTGAAGGG - Intergenic
1192978968 X:76318661-76318683 CCACATCCACAGGAAATGAGGGG - Intergenic
1195974153 X:110507710-110507732 CCAAAACTTCAGTAGGTGAATGG + Intergenic
1197374276 X:125663377-125663399 CCCCATCCTCAGGAGTTGCTAGG - Intergenic
1199425000 X:147691177-147691199 CCACATCCTCACATGGTAAAAGG + Intergenic
1199788854 X:151130920-151130942 CCACATCCTCAGCAGGGCAAGGG + Intergenic
1201521341 Y:14877358-14877380 CCAGATACTCAGGAGGTTGAGGG + Intergenic