ID: 1140517407

View in Genome Browser
Species Human (GRCh38)
Location 16:75553978-75554000
Sequence ATGTGATAGGGGATGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 467}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140517407 Original CRISPR ATGTGATAGGGGATGGTGGG AGG (reversed) Intronic
900509341 1:3051200-3051222 ATGGGTGAGTGGATGGTGGGTGG - Intergenic
900584578 1:3426310-3426332 ATGTGTTAGGGGCTGGTGCTGGG - Intronic
900658066 1:3769942-3769964 CTGTGGTAGGGGGTTGTGGGGGG + Intronic
901386176 1:8910766-8910788 GTGTGGTGGGGGATGGAGGGGGG + Intergenic
902087060 1:13871416-13871438 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
902268971 1:15289479-15289501 AGGGGATATGTGATGGTGGGGGG - Exonic
904370331 1:30044081-30044103 CAGTGATAGGTGATGGTGTGAGG - Intergenic
904465856 1:30707214-30707236 ATGTGAAGGTGGGTGGTGGGGGG - Intergenic
904472321 1:30743575-30743597 ATGTCATAGGGGAAGGGTGGAGG - Intronic
905481776 1:38266703-38266725 ATGGGAAAGGGGATGGTGTCGGG + Intergenic
906641168 1:47441377-47441399 ATGTGTTAGGGGGTGGCGGGGGG - Intergenic
907325410 1:53634897-53634919 ATGAGATGGGGGATGGAAGGCGG - Intronic
907386524 1:54129142-54129164 GTGGGATAGGGGATGGGGTGGGG + Intergenic
907445693 1:54506417-54506439 CTGTGATGGGGGAGGGTGTGTGG + Intergenic
908819750 1:68073046-68073068 ACTTGATGGTGGATGGTGGGAGG - Intergenic
912769565 1:112451312-112451334 ATGTGACAGAGAATGGTGGTGGG - Intronic
914445935 1:147750840-147750862 ATGGGGTGGGGGATGGTGGTAGG - Intergenic
914826563 1:151141754-151141776 ATGGGATGGGGGTTGGGGGGTGG + Intronic
915255851 1:154627919-154627941 ACGTGGTGGGGGAGGGTGGGGGG - Intronic
915476922 1:156158515-156158537 ATGTGAGAAGGGATGCTTGGGGG - Intronic
915526157 1:156477436-156477458 ATGTGATAGGGCTTGGTGATGGG + Intronic
916258401 1:162814516-162814538 AAGTGGGAGGGCATGGTGGGAGG + Intergenic
916860606 1:168800505-168800527 CTGTGATGGGGCATGGTGGGTGG + Intergenic
917592098 1:176486913-176486935 ATGTGAGAGGGGGAAGTGGGTGG + Intronic
918249937 1:182693965-182693987 ATTTGAGAGTGGAAGGTGGGAGG + Intergenic
918539141 1:185608821-185608843 ACTTGAGAGGGGAGGGTGGGAGG + Intergenic
918948622 1:191105470-191105492 ATCTGAGAGTGGAGGGTGGGAGG - Intergenic
920577573 1:207072742-207072764 AAGTGTTGGGGGATGGAGGGCGG + Exonic
920689517 1:208135151-208135173 ATTTCTTAGGGGGTGGTGGGGGG + Intronic
920873202 1:209811203-209811225 AGGTGATCTGGGGTGGTGGGGGG - Intergenic
921839142 1:219809799-219809821 AGGTGGTAGGGGATGGTCGTAGG + Intronic
924085497 1:240447255-240447277 GTGTGTTGGGGGATGTTGGGAGG + Intronic
924227396 1:241933210-241933232 ATGTGGTAGTGGGTGGTGGGAGG - Intergenic
924348210 1:243092502-243092524 AGGTGATGGGAGAGGGTGGGAGG + Intergenic
1063369856 10:5514127-5514149 CTGTGCTGGGGGGTGGTGGGTGG - Intergenic
1063558562 10:7104379-7104401 ACTTGATGGGGGAAGGTGGGAGG - Intergenic
1063752262 10:8963613-8963635 ACTTGATGGGGGAAGGTGGGAGG + Intergenic
1064125704 10:12658416-12658438 AAGTGATAGGGGAGGGGGGCAGG + Intronic
1064952589 10:20870572-20870594 ATTTCCTTGGGGATGGTGGGTGG + Intronic
1066701637 10:38135857-38135879 TTGTGAGAGGGACTGGTGGGAGG - Intergenic
1066724843 10:38380199-38380221 AAGTGGGAGGGCATGGTGGGAGG + Intergenic
1067142082 10:43666594-43666616 ATGGGATGGGGGATGGTTAGGGG - Intergenic
1067556644 10:47277751-47277773 ATGTGACAGTGGCTGGTGGTTGG - Intergenic
1068576939 10:58694710-58694732 ATGTGTTTGGGGGTGGTGGTGGG + Intronic
1069752723 10:70754481-70754503 ATGTGGTGGAGGATGGAGGGCGG + Intronic
1070560585 10:77563727-77563749 ATGTGTTAGGGGAGGATGAGAGG - Intronic
1070601594 10:77870013-77870035 ATGGGATGGGGGATGGGGGATGG - Intronic
1070782136 10:79143776-79143798 GTGTGATAGGGGCTGGGGGGTGG + Intronic
1071602447 10:86964916-86964938 ATGTGAGAGGGGGTTGTAGGGGG - Intronic
1072443941 10:95481410-95481432 ATGAGATTGGGGTGGGTGGGAGG - Intronic
1073822095 10:107275437-107275459 TTGTGCTAGGAGATGGAGGGAGG - Intergenic
1074248334 10:111716619-111716641 ATGTCATAAGGGATGGGGGAAGG + Intergenic
1074328629 10:112479652-112479674 ATGAGTTACGGGAAGGTGGGGGG - Intronic
1074925539 10:118066111-118066133 ATGTGGTAGGGAACAGTGGGTGG + Intergenic
1075454945 10:122579070-122579092 ATGTGATATTGGAGGGTGGAGGG + Intronic
1076515270 10:131042067-131042089 ATAAGATAGGGTATGGGGGGCGG + Intergenic
1078718333 11:13860638-13860660 AGGTGACTGGGGATGGAGGGAGG - Intergenic
1079130887 11:17746348-17746370 CTGTGGTTGTGGATGGTGGGTGG - Intronic
1080624043 11:34012584-34012606 ATGCTATTTGGGATGGTGGGTGG + Intergenic
1080694183 11:34586648-34586670 CTGTGATTGCGTATGGTGGGAGG + Intergenic
1082895311 11:58183827-58183849 ATATGATAGGAAATGTTGGGTGG + Intergenic
1083048011 11:59754066-59754088 ATGTGTTAGGGGAAGGAGGTGGG + Intronic
1083130167 11:60617687-60617709 ACGTGATGGTGGATGGTGGGAGG - Intergenic
1083188358 11:61031509-61031531 ATGGGATATGGTATGTTGGGTGG - Intergenic
1083427026 11:62593530-62593552 TTGTGAAAGGGGATGGGGAGGGG - Exonic
1083614029 11:64017776-64017798 AGGTGATGGGGGGAGGTGGGGGG - Intronic
1083793038 11:64998246-64998268 TTCTGATAGGTGATGGTGGCTGG + Intergenic
1083866821 11:65459662-65459684 ATGATAAAGGAGATGGTGGGGGG - Intergenic
1086167947 11:83801299-83801321 AGGGGATAGAGGAGGGTGGGAGG - Intronic
1087022299 11:93615632-93615654 ATCTGTTAGGTGATGTTGGGTGG - Intergenic
1088165824 11:106935594-106935616 ATTTGATAGGCCAAGGTGGGTGG + Intronic
1088325373 11:108595394-108595416 AAGAAATAGGGGGTGGTGGGAGG + Intergenic
1089554344 11:119307434-119307456 ATCTGATGGGGGCTGGGGGGTGG - Exonic
1090172621 11:124617990-124618012 ATGTGTTGGGGGATGGGGGTAGG + Intronic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091840503 12:3617067-3617089 GAGTGAGAGGGGATTGTGGGGGG + Intronic
1092200040 12:6575812-6575834 TTGTGTTGGGTGATGGTGGGAGG - Intronic
1092525898 12:9310199-9310221 GTGTGACTGGCGATGGTGGGTGG + Intergenic
1092541395 12:9421610-9421632 GTGTGACTGGCGATGGTGGGTGG - Intergenic
1093281346 12:17200299-17200321 ATTGGATGGAGGATGGTGGGCGG - Intergenic
1094511653 12:31100886-31100908 GTGTGACTGGTGATGGTGGGCGG + Intronic
1095099842 12:38169134-38169156 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1095655909 12:44668703-44668725 ATGTGAGTAGTGATGGTGGGTGG - Intronic
1095942876 12:47737997-47738019 AAGTGGTGGGCGATGGTGGGTGG - Intronic
1095943092 12:47739053-47739075 ATGGGATGGGGGATGGAGGCAGG + Intronic
1096950012 12:55458642-55458664 ACTTGAGAGGGGAGGGTGGGTGG + Intergenic
1097651494 12:62303602-62303624 ATGTGGCGGGGGATGGGGGGAGG - Intronic
1098282965 12:68879988-68880010 AGGTGATGGGGGAAGGTGAGGGG + Intronic
1098353842 12:69591031-69591053 TTCTGATAGGGGCTGGTGGTAGG + Intronic
1098705470 12:73684186-73684208 TTGTGATGGGGGATGATGTGTGG - Intergenic
1098898278 12:76086593-76086615 AAGTTATAGGGGTTGGTGGGGGG - Intergenic
1099238237 12:80107942-80107964 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
1099732616 12:86525255-86525277 AGGAGAGAGAGGATGGTGGGAGG - Intronic
1100295954 12:93261366-93261388 ATGTGATGGGGGGAGGGGGGAGG - Intergenic
1100514579 12:95314712-95314734 ATGTGAGGGAGGATGGTTGGTGG + Intergenic
1100532712 12:95474798-95474820 ACGTGAAACGGGATAGTGGGAGG - Intronic
1101324537 12:103703530-103703552 AGGTGTGTGGGGATGGTGGGGGG + Intronic
1101674597 12:106906536-106906558 GTGTGGTTGGGGATGGTGGGTGG - Intergenic
1102460433 12:113096625-113096647 ATGTGGCAGGGGAGGGAGGGAGG + Intronic
1103097534 12:118144181-118144203 TTCTGATGGGGGGTGGTGGGTGG + Intronic
1104038322 12:125113880-125113902 AGGTAATAGGGCATAGTGGGTGG + Intronic
1104746112 12:131211399-131211421 ATTGGTTAGGGGATGGTGGGGGG + Intergenic
1107317699 13:39151262-39151284 ATGTAAAAGGGAAAGGTGGGGGG + Intergenic
1107362514 13:39635056-39635078 ATGTCATAAAGGTTGGTGGGGGG + Intergenic
1107513499 13:41107581-41107603 AGGTGGTGGGGGTTGGTGGGGGG - Intergenic
1107628170 13:42312588-42312610 ATGGGTGAGGGGATGTTGGGGGG - Intronic
1109645781 13:65253044-65253066 ATCAGAGAGTGGATGGTGGGAGG - Intergenic
1110184473 13:72656991-72657013 AGGTGAGGGGAGATGGTGGGTGG + Intergenic
1110583375 13:77158689-77158711 TTTTGATAGGGCAAGGTGGGAGG - Intronic
1110834622 13:80069368-80069390 ACTTGACAGGGGATGATGGGTGG + Intergenic
1111282451 13:86044552-86044574 ATGGGCTAGGGGGTGGGGGGAGG + Intergenic
1112111479 13:96304513-96304535 ATGTGACTGATGATGGTGGGAGG + Intronic
1112826722 13:103400175-103400197 GTGGGATAGGGGGAGGTGGGAGG - Intergenic
1113149464 13:107246050-107246072 ATGAGATAGAGGAGGGTGGGCGG - Intronic
1113263580 13:108592513-108592535 GTTGTATAGGGGATGGTGGGTGG + Intergenic
1113872036 13:113565438-113565460 ATGTCAGAGGGGAGGGTCGGAGG - Intergenic
1114255750 14:21000174-21000196 TCCAGATAGGGGATGGTGGGAGG - Intronic
1114839564 14:26247444-26247466 ATGAGGTAGGGCATGGAGGGTGG - Intergenic
1115488290 14:33934181-33934203 CTGGGAATGGGGATGGTGGGAGG - Intronic
1116023538 14:39489105-39489127 ATGTGTTAGAGGAAGGAGGGCGG - Intergenic
1116641239 14:47466163-47466185 ATGTGAGGGTGGAGGGTGGGAGG + Intronic
1116859070 14:49979255-49979277 GGGTGGTGGGGGATGGTGGGCGG - Intergenic
1117893502 14:60451686-60451708 ATGGGGTAGGGGGTGGGGGGAGG + Intronic
1118305806 14:64654291-64654313 ATGTGGTAGAGGATGGTCGTGGG - Intergenic
1118667855 14:68089666-68089688 GGGGGAAAGGGGATGGTGGGAGG - Intronic
1118705337 14:68475069-68475091 ATGAGATAGAGAATGGTGGTGGG + Intronic
1119196796 14:72723178-72723200 GTGAGATAGGGGCTGGGGGGAGG - Intronic
1119984686 14:79123989-79124011 GTGTGATATGGGATGGAGTGGGG - Intronic
1121238351 14:92410034-92410056 ATTTGAGGGGGGAAGGTGGGAGG + Intronic
1121447535 14:93988242-93988264 ATGAGAGAGGGGATGGAAGGAGG + Intergenic
1121447614 14:93988491-93988513 ATTGGATAGGGGATGGGAGGAGG + Intergenic
1121447633 14:93988540-93988562 ATGGGAGAGGGGATGGGAGGAGG + Intergenic
1121936705 14:98026308-98026330 ATGAGTGAGTGGATGGTGGGTGG + Intergenic
1122099065 14:99392992-99393014 AGATGATAGGGGAAGGTAGGGGG + Intergenic
1122879849 14:104685836-104685858 ATGGGTAAGTGGATGGTGGGTGG + Intergenic
1123225492 15:17020742-17020764 ATGTGAAAGTGGATAGTTGGAGG + Intergenic
1123632984 15:22274979-22275001 ATAGGATGGGGGATGGTGGGTGG - Intergenic
1123632995 15:22275006-22275028 ATAGGATAGTGGATGATGGGTGG - Intergenic
1124056666 15:26246498-26246520 CTTTGATAGGGGATGTGGGGAGG - Intergenic
1124150988 15:27178009-27178031 ATCTCCTGGGGGATGGTGGGTGG + Intronic
1126017768 15:44369358-44369380 ATGTGATAGAGAGTGGTGGGAGG - Intronic
1126018104 15:44372989-44373011 ATGTGATAGAGAGTGGTGGGAGG - Intronic
1126455299 15:48855026-48855048 ATGTGAGAGTGAAGGGTGGGAGG + Intronic
1127390413 15:58500751-58500773 ATGAGAAGGGGGGTGGTGGGGGG - Intronic
1127528329 15:59816290-59816312 ATGGAATGGGGGATGTTGGGGGG - Intergenic
1127623139 15:60753512-60753534 ATGTGATAAGGGATGAAGGGTGG - Intronic
1128028468 15:64459960-64459982 TAGTGATAGAGGATGGTGAGGGG + Intergenic
1129513914 15:76144848-76144870 ATGTAACAGGGCATTGTGGGCGG - Intronic
1130121296 15:81049960-81049982 ATATGTTAGGAGCTGGTGGGGGG - Intronic
1130762946 15:86839634-86839656 ATCTGCTAAGGGATGGTGGGTGG - Intronic
1131423377 15:92326086-92326108 CAGTGATGGGGGATGGTGGGTGG + Intergenic
1131610568 15:93956940-93956962 AAGTGATAGGGAATTGTGTGTGG + Intergenic
1132803476 16:1765293-1765315 ATGTGGCAGTGGACGGTGGGAGG + Intronic
1135052435 16:19203846-19203868 ATGGGATGGGGGTTGGTGGATGG + Intronic
1135528952 16:23236087-23236109 ATGTGACAGGGGGTAGTGGGAGG + Intergenic
1135624590 16:23982752-23982774 CTGTAATAAGGGAGGGTGGGAGG + Intronic
1135648526 16:24185435-24185457 GTATGACAGGGGAGGGTGGGAGG - Intronic
1137458117 16:48633816-48633838 ATGTTGTGGGGGATGGTGTGAGG + Intergenic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1138499221 16:57428628-57428650 ATGTGGTTGGGGATGGAAGGGGG + Exonic
1138600597 16:58051814-58051836 GTAAGATAGGGGAGGGTGGGAGG - Intergenic
1138967773 16:62106668-62106690 AATTGATAGGGGTTGGTTGGGGG + Intergenic
1139191532 16:64869126-64869148 ATGTGAGAGGGGAGAGAGGGTGG - Intergenic
1139620065 16:68132274-68132296 TGGTGATAGAGGATGGAGGGTGG + Intronic
1139643686 16:68311622-68311644 ATGTGATAGGAGATGAGGAGCGG + Exonic
1140068310 16:71627760-71627782 GTGAGCTAGGGGAGGGTGGGGGG + Intronic
1140213255 16:72987384-72987406 CTTTGATCGGGGAGGGTGGGAGG - Intronic
1140295084 16:73702162-73702184 GTGTGAACGGGGAGGGTGGGGGG - Intergenic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1140719221 16:77755810-77755832 AAGTCATAGGGGATGGTCTGGGG - Intergenic
1140779773 16:78284115-78284137 ATCTGAGAGGTGGTGGTGGGTGG + Intronic
1140780320 16:78290281-78290303 ATGGGATGGGGGGTGGGGGGGGG - Intronic
1142735684 17:1897552-1897574 TTGTGAGCGGGGATGGGGGGGGG - Exonic
1142771214 17:2098371-2098393 ATGTGAAAGGGAATAGTTGGTGG - Intronic
1142825721 17:2508963-2508985 AGGTGAAAGGCGATGGTGGGAGG - Intronic
1143118725 17:4594674-4594696 CTGTGATTGGGGATGGGGGTAGG + Intronic
1143150331 17:4803868-4803890 ATGTGGCTGGGGATGGTGGCGGG - Intergenic
1143870479 17:9954459-9954481 CAGTGATGGGGGATGGGGGGTGG + Intronic
1144150268 17:12436288-12436310 GTGTGCTAGTGGATGGAGGGTGG + Intergenic
1144196025 17:12896102-12896124 ATGGGATAGGGGGAGGGGGGAGG + Intronic
1144752127 17:17656193-17656215 ATGAGGTGGGGGCTGGTGGGAGG - Intergenic
1147335597 17:39725405-39725427 GTGTGATGGGGGGTGTTGGGAGG + Intronic
1147460313 17:40564089-40564111 TTGTGATGGGGGGTGGTGGAGGG + Intronic
1147968286 17:44205974-44205996 AGGAAATAGGGGGTGGTGGGAGG + Exonic
1148048415 17:44757993-44758015 GTGTGGTAGGGCATGGTGGGTGG - Intergenic
1148157770 17:45433149-45433171 AGGGGGTGGGGGATGGTGGGAGG - Intronic
1148393668 17:47291542-47291564 AGGGGAGAGGGGTTGGTGGGAGG + Intronic
1150024035 17:61652836-61652858 ATGTGGTAAGGTTTGGTGGGAGG - Intergenic
1150542027 17:66111703-66111725 ACTTGAGAGGGGAGGGTGGGAGG + Intronic
1151162335 17:72176031-72176053 ATGTGTTGGGGGAAGGGGGGAGG - Intergenic
1151593061 17:75059363-75059385 TTGTAAAAGGGGATAGTGGGTGG + Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152123824 17:78434636-78434658 ATGGGATAGAGGATGGGGGATGG + Intronic
1152123831 17:78434655-78434677 ATGGGATAGAGGATGGGGGATGG + Intronic
1153204788 18:2686728-2686750 ATGTGATTGTAGATGTTGGGAGG + Intronic
1153300236 18:3585890-3585912 ATGTGATAAGTGGGGGTGGGAGG + Intronic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154082547 18:11272674-11272696 TTGTGACAGGGACTGGTGGGAGG + Intergenic
1154177432 18:12094405-12094427 ATGTGATGGGGGACTGTGGTGGG + Intronic
1154177487 18:12094551-12094573 ATGTGATGGGGGACTGTGGTGGG + Intronic
1154308985 18:13253193-13253215 AGGTGACAGGAGAAGGTGGGAGG + Intronic
1155046249 18:22105959-22105981 ATGTGAAAGGGGAGAGTGGAAGG - Intergenic
1155096271 18:22559381-22559403 AAGAGACAGGGGTTGGTGGGGGG + Intergenic
1155513534 18:26600864-26600886 ATGTGGTTGGGGATGGAAGGGGG - Intronic
1155587620 18:27385639-27385661 ATGTGCCAGGGGCTGATGGGAGG + Intergenic
1156608390 18:38696553-38696575 ATGTGAGGGGTGATGGGGGGTGG + Intergenic
1157018399 18:43747349-43747371 ACTTGACAGGGGAAGGTGGGAGG + Intergenic
1157393519 18:47323036-47323058 TTGAGAGAGGGGAGGGTGGGTGG - Intergenic
1157812802 18:50709663-50709685 ATGTCATTGGGGATGGGGGAAGG + Intronic
1158508992 18:58073682-58073704 ATGTGCTGGAGGCTGGTGGGAGG + Intronic
1159795467 18:72837945-72837967 CTGTCATAGGGGATGGTGATGGG - Intronic
1159795478 18:72838004-72838026 CTGTCATAGGGGATGGTGATGGG - Intronic
1159795488 18:72838063-72838085 CTGTCATAGGGGATGGTGATGGG - Intronic
1160626443 18:80210890-80210912 GTGTGTTTGGGGATGGGGGGTGG - Intronic
1161347644 19:3776215-3776237 ATGTGTGAATGGATGGTGGGTGG + Intergenic
1161347731 19:3776547-3776569 ATGTGTGAGTGGATGGTAGGTGG + Intergenic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161473260 19:4471978-4472000 AGGTGAAAGGGAAAGGTGGGAGG - Intergenic
1161485156 19:4531561-4531583 ATGGGACAGGGGGCGGTGGGGGG + Intronic
1161619776 19:5291965-5291987 ATGTGAAAGGGTATGCTGGGTGG - Intronic
1161699506 19:5787190-5787212 AGGTGGTGGGAGATGGTGGGAGG + Intronic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1163655073 19:18541117-18541139 CTGTGATGGGGTATGTTGGGGGG + Intronic
1164596021 19:29530988-29531010 AAGGGATTGGGGATGGGGGGCGG + Intronic
1164655177 19:29915863-29915885 ATGGGGTCGGGGATGGGGGGAGG - Intergenic
1165149870 19:33753991-33754013 AGGAGATGGGGGATGGTGGGGGG - Intronic
1166304934 19:41932336-41932358 GAGGGATCGGGGATGGTGGGCGG - Intergenic
1166359666 19:42247888-42247910 ATGTGTTGGGGGGTGGGGGGCGG - Exonic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1167566593 19:50261186-50261208 ATGGGGCAGGGGATGATGGGGGG - Intronic
1168535134 19:57162815-57162837 ATGTGGTAGGCCAAGGTGGGTGG - Intronic
925426135 2:3750227-3750249 ATGCGATAGGGGCTGTTGAGGGG - Intronic
926238319 2:11066804-11066826 ATGGGATGGGGGAAGGAGGGAGG - Intergenic
926397065 2:12454303-12454325 ATTTGATAGGGGAAGCTGGCAGG - Intergenic
926564030 2:14450357-14450379 ATTTGATAAGGGATAGAGGGTGG - Intergenic
927062164 2:19433831-19433853 ATGTGATATGGTATCCTGGGTGG - Intergenic
928320219 2:30277438-30277460 AGAGGATAGGGGATGCTGGGTGG + Intronic
928613976 2:33018184-33018206 ATGTGGTAGGGTAAGGGGGGTGG - Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929023412 2:37576192-37576214 ACCTGAGAGGGGAGGGTGGGAGG - Intergenic
929057173 2:37888411-37888433 ATGTGATGGGGGAAGATGGCGGG + Intergenic
929862249 2:45689387-45689409 ATGGGATTGGGGGTCGTGGGAGG - Intronic
929916123 2:46137297-46137319 ATGTGATCTGAGATGTTGGGTGG - Intronic
931202864 2:60117030-60117052 ACTTGATGGGGGATGGTGGTTGG - Intergenic
933019059 2:77167800-77167822 ATGGGATGGGGGAAGGTGGGAGG + Intronic
933232297 2:79822904-79822926 ATCTGAATGGGGATGGTGGTAGG - Intronic
933335428 2:80952181-80952203 ATCTGAAAGTGGAGGGTGGGAGG - Intergenic
933898052 2:86829041-86829063 ATGTGACAGGGGTTGGTGTGGGG - Intronic
934048596 2:88191424-88191446 CTTGGATAAGGGATGGTGGGAGG - Intergenic
934979956 2:98831473-98831495 AGGTGACAGGGGAAGGTGTGTGG + Intronic
936263747 2:110983615-110983637 TTGTGATAGGTGATTGTGGGTGG - Intronic
938202682 2:129388276-129388298 ATGTGGTAGGGAATGCTGAGGGG - Intergenic
938927977 2:136061703-136061725 TTGAGATAGGGCCTGGTGGGAGG + Intergenic
938999561 2:136718376-136718398 TTGAGATAGGGGCTGGAGGGAGG + Intergenic
942050811 2:172139095-172139117 ACCTGATGGGGGAGGGTGGGAGG + Intergenic
942520089 2:176794676-176794698 ATGTGATAGGGGCTGGGGCAGGG - Intergenic
943629044 2:190230260-190230282 AAGTAAATGGGGATGGTGGGTGG + Intronic
944314295 2:198268872-198268894 ATCTGATGGGGGAGGCTGGGAGG - Intronic
944605542 2:201348625-201348647 GTGTGTAAGGGGGTGGTGGGGGG - Intronic
944925426 2:204459093-204459115 ATGGGAGAGGAGAGGGTGGGAGG - Intergenic
946062076 2:216951197-216951219 ATTTGATGGTGGAGGGTGGGAGG - Intergenic
947374876 2:229485585-229485607 ATGATATATGGGTTGGTGGGGGG - Intronic
947517681 2:230821781-230821803 ATTTGATGGGGGATTGTGGTAGG - Intergenic
948188781 2:236042697-236042719 ATGTGAGTGCGGATGGGGGGTGG + Intronic
949062466 2:241969254-241969276 ATGTGATGGGTGATGGAGTGTGG + Intergenic
949062540 2:241969606-241969628 ATGTGATGGGTGATGGAGTGTGG + Intergenic
1169466375 20:5844452-5844474 ATGTGTTTGGGGATGGCTGGAGG + Intronic
1169700777 20:8444181-8444203 ATGTGGTGGGGGGAGGTGGGAGG - Intronic
1170579911 20:17690909-17690931 TGGTGATGGGGGATGGGGGGAGG + Intergenic
1170653231 20:18261876-18261898 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1170762868 20:19266031-19266053 AAGGGAGAGGGGATGCTGGGAGG + Intronic
1170894097 20:20398658-20398680 ATGTGCTCGGAGATGGGGGGTGG + Intronic
1170987327 20:21270387-21270409 ACGTGATGGTGGAGGGTGGGAGG - Intergenic
1171281561 20:23903700-23903722 ACTTGAAAGGGGAGGGTGGGAGG + Intergenic
1172254848 20:33508572-33508594 ATGGGAAAGTGGAGGGTGGGAGG - Intronic
1172351866 20:34249305-34249327 AGGAGATAGGGGATTGGGGGCGG - Intronic
1172916039 20:38444567-38444589 ATGTGGTAGGGGTTGGAGGGTGG - Intergenic
1173400825 20:42724472-42724494 TTGGGGTAGGGGATGGTGGAGGG - Intronic
1173504121 20:43573771-43573793 CTGTGTTTGGGTATGGTGGGTGG + Intronic
1173574215 20:44100034-44100056 AAGAGATAGAGGATGGAGGGTGG + Intergenic
1175249860 20:57602788-57602810 ATTTGGTGGGGCATGGTGGGAGG - Intergenic
1176132893 20:63503729-63503751 CTGTGGGAGGCGATGGTGGGCGG - Intergenic
1176864770 21:14041004-14041026 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1177908513 21:27000832-27000854 ACTTGAAAGGGGATGGTGGGAGG + Intergenic
1178127367 21:29529636-29529658 ATGTGATTAGTGATGGTGGTTGG + Intronic
1178337710 21:31758626-31758648 AGGTGATGGGGGCTGGTGGGGGG - Intergenic
1178793670 21:35723473-35723495 ATGTGAGAGGGGTTGGGGGGGGG - Intronic
1182475033 22:30572666-30572688 AGGTGAGGGGTGATGGTGGGAGG - Intronic
1182717109 22:32365926-32365948 ATCGGATGGGGGACGGTGGGAGG + Intronic
1183279504 22:36924400-36924422 CTGGGAGAGGGCATGGTGGGTGG - Intronic
1183379171 22:37482263-37482285 AGGTGTTAGTGGCTGGTGGGTGG - Intronic
1183716468 22:39536094-39536116 ATGGGCTAGGGGAGGGAGGGCGG - Intergenic
1184478984 22:44736353-44736375 GTGTCCAAGGGGATGGTGGGAGG - Intronic
1185063730 22:48620616-48620638 ATAGGATGGGGGATGGTGGGTGG - Intronic
949958834 3:9294368-9294390 ATCAGATGGTGGATGGTGGGAGG + Intronic
950576872 3:13837342-13837364 ATGTGAGAGGGGCTGATGCGGGG - Intronic
950909543 3:16574677-16574699 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
951179773 3:19645531-19645553 AAGTTATAGGGGTTGGTGTGAGG + Intergenic
951529780 3:23687395-23687417 AGCTGTTAGGGGCTGGTGGGAGG + Intergenic
951771157 3:26259100-26259122 ATGTGGAAGCGGGTGGTGGGGGG - Intergenic
952003350 3:28810933-28810955 ATTTGATTGGGGGTGGTTGGAGG - Intergenic
952041395 3:29266217-29266239 GAGTGAGTGGGGATGGTGGGAGG + Intergenic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
953872481 3:46639270-46639292 ATGTGTTTGGGGATGGGGGTGGG + Intergenic
954473443 3:50720284-50720306 ATGTGAGGGTGGGTGGTGGGAGG - Intronic
954645856 3:52131132-52131154 ATTTGGGAGAGGATGGTGGGCGG - Intronic
955273298 3:57523137-57523159 ATTTGATAGGCCAAGGTGGGAGG + Intronic
956121352 3:65969341-65969363 CTGTGTTAGGGGCTGGGGGGTGG + Intronic
956218544 3:66877131-66877153 AAGAGATTTGGGATGGTGGGGGG + Intergenic
956596594 3:70973840-70973862 ATGTGTTGGGGGGTGGGGGGGGG - Intronic
956901344 3:73719234-73719256 ATATGATAGGGGATGTTGAATGG + Intergenic
957178027 3:76838226-76838248 ACTTGAGAGTGGATGGTGGGAGG + Intronic
957426126 3:80041394-80041416 ATGTGTGTGGGGTTGGTGGGGGG + Intergenic
957495522 3:80986565-80986587 ACTTGAGAGGGGATGGTGGGAGG - Intergenic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958089602 3:88859201-88859223 ATGTGAAAAATGATGGTGGGTGG - Intergenic
958111478 3:89152388-89152410 ATGTGAAAGGAGGTTGTGGGTGG - Intronic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
960355603 3:116649299-116649321 ATGTGATACGGGTTGGTGGGTGG + Intronic
960435200 3:117618212-117618234 ATTAGAGAGGGGAGGGTGGGAGG + Intergenic
961393799 3:126572080-126572102 ATGAGATAGGGCATGGAGGCCGG - Intronic
961524440 3:127487647-127487669 AGGTGTGAGGGGAGGGTGGGGGG - Intergenic
962047931 3:131780664-131780686 ATTTGAGAGTGGAGGGTGGGAGG + Intronic
962063500 3:131954638-131954660 ATGGGATGGGGGAAGGTGGGAGG - Intronic
962330277 3:134472097-134472119 ATTTGATGGGGGTGGGTGGGGGG - Intergenic
962470326 3:135702064-135702086 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
962973310 3:140424872-140424894 CTGTGGTAGGGGAGGGTGGGTGG + Intronic
963053491 3:141162953-141162975 ATTTGATGGGGGAGGGTGGGAGG + Intergenic
963756873 3:149243607-149243629 ATGTGATGGGGAAGTGTGGGTGG + Intergenic
964487057 3:157196931-157196953 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
964515281 3:157500926-157500948 TTGTGATATGGGTTGTTGGGAGG + Intronic
964767584 3:160193584-160193606 ATGAGATGGGGGCTGGTGGGGGG + Intergenic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
967148643 3:186627927-186627949 TTGAGATATGGGATTGTGGGAGG - Intergenic
967787628 3:193514624-193514646 ATGTGTTACGGGATGGCTGGGGG - Intronic
967851234 3:194084034-194084056 ATGTGAGAATGGATGGGGGGCGG + Intergenic
969154476 4:5198361-5198383 ATCTGATGGGGCATGGTGGTGGG + Intronic
969429321 4:7145027-7145049 AGGTCATGGGGGATGATGGGAGG - Intergenic
969911566 4:10451928-10451950 ATGTGAAAAGGAAAGGTGGGTGG + Intronic
970678648 4:18481997-18482019 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
971254983 4:25006231-25006253 GGGTGATAAGGGATGGTGGGAGG - Intronic
972371784 4:38431080-38431102 ACATGTTAGGGCATGGTGGGAGG + Intergenic
972893948 4:43595674-43595696 ATGTGTTTGGGGGTGGGGGGTGG - Intergenic
973563978 4:52165348-52165370 GTGTGAGGGGGGAGGGTGGGGGG - Intergenic
973773927 4:54229003-54229025 ATGGGATGGGGGGTGGTGGAAGG - Intronic
974099785 4:57403883-57403905 AGGTGAGAAGGGATGGTAGGAGG + Intergenic
974439117 4:61894309-61894331 ATGGTATAGGAAATGGTGGGTGG + Intronic
974512275 4:62858735-62858757 AGATGATAGAGGCTGGTGGGAGG - Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975716419 4:77209703-77209725 ATGTGCTGCGGGGTGGTGGGTGG + Intronic
976692550 4:87884105-87884127 ATGTTAGAGGGCCTGGTGGGAGG - Intergenic
977832117 4:101607055-101607077 ATGTGGGAGGGACTGGTGGGAGG + Intronic
978448001 4:108799434-108799456 ATATGAGAGGGGATTGAGGGTGG + Intergenic
978620435 4:110631340-110631362 ATGTAATATGGGATGGAGGGGGG - Intronic
978669713 4:111232196-111232218 ATGTGGTAAGGCATGGCGGGGGG + Intergenic
978768035 4:112424832-112424854 ATGTGACAGAGAATGGTGAGGGG + Intronic
979199280 4:117957477-117957499 AAGTGTTAGGTGATGGTGTGAGG + Intergenic
980302973 4:131017811-131017833 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
980594972 4:134942486-134942508 ATGTGATATAGGATGGTTAGTGG - Intergenic
980595245 4:134946930-134946952 ATGTGATAAAGAATGGCGGGAGG - Intergenic
980947530 4:139337275-139337297 ATGTGATAGTGGTAGGTGGTGGG + Intronic
981554735 4:145980564-145980586 ATGACAGAGGGGAAGGTGGGGGG + Intergenic
982062784 4:151621543-151621565 GTGTGGCAGGGGGTGGTGGGGGG + Intronic
982136815 4:152280109-152280131 GTGGGATAGGCGATGGTGAGGGG + Intergenic
983237848 4:165200052-165200074 ATGGGATAGATGATGGTGTGTGG - Intronic
983747415 4:171219025-171219047 AGGTGGTAGGGCCTGGTGGGAGG + Intergenic
984736668 4:183115020-183115042 ATTTGAGAGTGGAAGGTGGGAGG - Intronic
984815368 4:183831124-183831146 GCGTGAGGGGGGATGGTGGGGGG + Intergenic
985591739 5:769026-769048 ATGTGATTGGTGCGGGTGGGGGG + Intergenic
985609654 5:879985-880007 ATGTGATTGGTGCAGGTGGGGGG + Intronic
985831569 5:2237577-2237599 ACCTGAGAGGGGAGGGTGGGAGG + Intergenic
985832519 5:2244787-2244809 ATTTGCTAGGTGATGGTGAGTGG - Intergenic
986816219 5:11414746-11414768 ATTTGAGAGTGGAGGGTGGGAGG - Intronic
988209073 5:28179067-28179089 ATCTGAGGGTGGATGGTGGGAGG + Intergenic
988871073 5:35390572-35390594 ATGGGAAAGTGGAGGGTGGGAGG + Intergenic
989082286 5:37635814-37635836 ATGTGTCATGGGAGGGTGGGAGG + Intronic
990138451 5:52675891-52675913 TTGGGGTAGGGGATGGTCGGGGG + Intergenic
990976311 5:61564696-61564718 ATGTGAGAGGGGATGATGCAAGG + Intergenic
991368553 5:65894520-65894542 ATGTGATAGAGGGTGGGGGTGGG - Intergenic
991642647 5:68770178-68770200 ATGTGGCAGGGGAAGGAGGGAGG - Intergenic
992607453 5:78473621-78473643 AAAAGATAGGGGAAGGTGGGAGG - Intronic
994535970 5:101029796-101029818 ACTTGAGAGGGGAGGGTGGGAGG + Intergenic
994938222 5:106284390-106284412 ATGGGGTAGGGGATGGTTTGGGG + Intergenic
995034935 5:107522780-107522802 ATGTGATAGAGCATAGTGGCTGG - Intronic
995458037 5:112372599-112372621 AAGTGACTGAGGATGGTGGGTGG + Intronic
996775679 5:127130098-127130120 GTGTGATTGGGTCTGGTGGGAGG - Intergenic
998400368 5:141845707-141845729 GTGTGAAGGGGGAGGGTGGGTGG - Intergenic
999370508 5:151052318-151052340 CTGAGCTAGAGGATGGTGGGGGG + Intronic
999516087 5:152302985-152303007 ATGTCATGGGGAATGGTGGTGGG - Intergenic
1000418411 5:161009242-161009264 AGATGCTAGGGGATGGTGGTGGG - Intergenic
1000698186 5:164415600-164415622 ACTTGAGAGGGGAGGGTGGGAGG - Intergenic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1002223842 5:177704219-177704241 TTGAGGTAGGGCATGGTGGGAGG + Intergenic
1002433460 5:179217740-179217762 ACTTGCTAGGGGATGGTGTGAGG + Intronic
1002657834 5:180766575-180766597 ATCTGAAGGTGGATGGTGGGAGG + Intergenic
1002974560 6:2061254-2061276 GTGTGAGTGAGGATGGTGGGTGG - Intronic
1003651967 6:7969038-7969060 AGGTGATAGAGAATGATGGGAGG - Intronic
1004016854 6:11739450-11739472 ATTTTATGGAGGATGGTGGGGGG - Intronic
1005399240 6:25414760-25414782 ATGTGGAAGGGGATGGGGGTTGG - Intronic
1005992672 6:30913321-30913343 ATCTGGTCGGTGATGGTGGGGGG - Exonic
1006636364 6:35464098-35464120 ATGTGAGAATGGATGGTGGTGGG + Intronic
1006880237 6:37332598-37332620 ATTTGGTAGTGGAGGGTGGGGGG + Exonic
1006912075 6:37570061-37570083 ATGGGAATGGGGATAGTGGGTGG - Intergenic
1007221083 6:40279510-40279532 AGGTGATAGAGCCTGGTGGGAGG - Intergenic
1007394539 6:41570063-41570085 GTGTGTCAGGGGGTGGTGGGGGG - Intronic
1008500224 6:52173763-52173785 AAGTGGTAGGGTATGGGGGGAGG - Intergenic
1010923360 6:81712362-81712384 ATCTGAGAGTGGAAGGTGGGAGG + Intronic
1012609191 6:101194445-101194467 ATGTGGTCGGGGAAGGGGGGAGG + Intergenic
1013176868 6:107685322-107685344 ATGTGAAAGTGGATTTTGGGAGG + Intergenic
1013864456 6:114678480-114678502 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1015288845 6:131515009-131515031 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1015395156 6:132725607-132725629 ACTTGAGGGGGGATGGTGGGAGG - Intronic
1015480246 6:133700638-133700660 CTGGGATTGGGGAGGGTGGGAGG - Intergenic
1015590304 6:134816640-134816662 ATGTGATCTGGGCTGGAGGGTGG + Intergenic
1017918923 6:158854891-158854913 TGGTGGTAGGGGGTGGTGGGTGG + Intergenic
1018187643 6:161280879-161280901 ATGCTTTAGGGGTTGGTGGGGGG - Intergenic
1018771534 6:166975303-166975325 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1018891515 6:167986274-167986296 ATGTGAGCGTGGACGGTGGGAGG + Intergenic
1020531037 7:9335945-9335967 GTGGGGTAGGGGATGGGGGGAGG - Intergenic
1020870751 7:13625662-13625684 ATGGGATTGGGGGTGGGGGGAGG + Intergenic
1021446885 7:20743653-20743675 ATGTGGTGGTGGGTGGTGGGGGG - Intronic
1021724259 7:23534290-23534312 ATGTGAGAGGGTGTGGTGGGAGG - Intergenic
1022102831 7:27179328-27179350 CTGCGATAGGGGGTTGTGGGAGG - Intronic
1022830323 7:34059387-34059409 CTGGGGGAGGGGATGGTGGGGGG + Intronic
1022956588 7:35386685-35386707 AGGGGGTGGGGGATGGTGGGGGG - Intergenic
1024106258 7:46089983-46090005 ACTTGATAGTGGAGGGTGGGAGG - Intergenic
1025603112 7:63017873-63017895 ATGTGATATCCAATGGTGGGGGG - Intergenic
1025972342 7:66339099-66339121 AAGTGTTGGGGGGTGGTGGGTGG + Intronic
1026677748 7:72442164-72442186 AGGTGAGAGGTGATGGTGGCTGG - Intronic
1028457487 7:91054379-91054401 AGGTGATAGCTGATGGTGGGTGG - Intronic
1029599185 7:101553809-101553831 ATGTGGTAGAGGATGGATGGAGG + Intronic
1030056219 7:105586030-105586052 ACTTGACAGGGGAGGGTGGGAGG + Intronic
1030185257 7:106755385-106755407 ACTTGATAGGGGAGGGTGGGAGG + Intergenic
1030234847 7:107247214-107247236 ACTTGACAGGGGAGGGTGGGAGG + Intronic
1030349220 7:108464483-108464505 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1031342665 7:120623329-120623351 AGGGGATAGGGGATGGTGAAGGG - Intronic
1031427291 7:121621188-121621210 ATGTGGTGGGGGTTGGGGGGTGG + Intergenic
1031939294 7:127770249-127770271 AAGTAAATGGGGATGGTGGGTGG + Intronic
1032168786 7:129566908-129566930 CTGTGGTAGGGGATGGTGGGGGG - Intergenic
1033275086 7:139965703-139965725 ATGTGATAGCTGGTTGTGGGGGG + Intronic
1034297871 7:149990253-149990275 ATGGGAAAGGGGCTGATGGGTGG - Intergenic
1034434230 7:151055497-151055519 ATGGGATATGGGATTGGGGGAGG - Intronic
1034808153 7:154106600-154106622 ATGGGAAAGGGGCTGATGGGTGG + Intronic
1036926257 8:12909140-12909162 ATGTTGTAGAGGGTGGTGGGTGG - Intergenic
1037411387 8:18601976-18601998 ACTTGTTAGGGGCTGGTGGGTGG - Intronic
1038982477 8:32775095-32775117 ATGCGAGAGGGGATGGAAGGAGG - Intergenic
1039635475 8:39159887-39159909 GTGTGAGATGGGATGGTAGGTGG + Intronic
1039904514 8:41776277-41776299 ATGTGATAGTGATTGGTGGCTGG - Intronic
1039988868 8:42470728-42470750 CTTTGAGAGGTGATGGTGGGTGG + Intronic
1040484214 8:47854945-47854967 ATGGGGTAGAGGGTGGTGGGAGG - Intronic
1040954638 8:52967389-52967411 ATGTGAAGGTGGAGGGTGGGAGG - Intergenic
1041090398 8:54296621-54296643 GGATGGTAGGGGATGGTGGGTGG + Intergenic
1041491447 8:58437952-58437974 CTGTGATGGGGGTTGGGGGGGGG - Intronic
1044106382 8:88212179-88212201 ATGTGAGAGGTAATGGTGTGTGG + Intronic
1046218346 8:111179830-111179852 ATGGGGTAGGGGAAGGGGGGAGG - Intergenic
1047733802 8:127748342-127748364 CTGTGATAGAGGAAGGGGGGAGG - Intergenic
1048096732 8:131303835-131303857 ACTTGAGAGGGGAGGGTGGGAGG - Intergenic
1049442553 8:142615998-142616020 ATAAGACAGGGGATGCTGGGGGG - Intergenic
1050977299 9:11956339-11956361 ATGGGAAGGGGCATGGTGGGGGG + Intergenic
1051073917 9:13207362-13207384 ATGAGGTTGGGGCTGGTGGGAGG - Intronic
1052454082 9:28671628-28671650 ATTTGAGAGTGGAGGGTGGGAGG + Intergenic
1052666097 9:31496981-31497003 CTGTGATGGGGCAGGGTGGGGGG + Intergenic
1053578973 9:39383274-39383296 AAGAGATGGGGGATGGTCGGTGG + Intergenic
1053843485 9:42211349-42211371 AAGAGATGGGGGATGGTTGGTGG + Intergenic
1054100556 9:60942078-60942100 AAGAGATGGGGGATGGTCGGTGG + Intergenic
1054121952 9:61217703-61217725 AAGAGATGGGGGATGGTCGGTGG + Intergenic
1054241012 9:62613213-62613235 ATGTGAGAGGGGTTGGGGGTCGG - Intergenic
1054585790 9:66964808-66964830 AAGAGATGGGGGATGGTCGGTGG - Intergenic
1056103036 9:83318243-83318265 ACAAGATATGGGATGGTGGGAGG - Intronic
1056658046 9:88524925-88524947 AGGGGACAGGGGATGGCGGGGGG + Intergenic
1056860518 9:90176704-90176726 AGGCAAGAGGGGATGGTGGGAGG + Intergenic
1057662434 9:97014872-97014894 GTGTGTTTGGGGGTGGTGGGTGG - Intergenic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1059395594 9:114032267-114032289 ATCTGACAGGGAGTGGTGGGCGG + Intronic
1060346501 9:122821397-122821419 GTGTGTTTGGGGATGGTGTGGGG - Intronic
1060630348 9:125152103-125152125 ATGGGGTAGGGGGTGGGGGGTGG + Intronic
1060638685 9:125220573-125220595 ATGTTCTTGGGGATGGTGGGGGG - Exonic
1060828733 9:126700837-126700859 ATGTGTCTGGGGATGGCGGGTGG - Exonic
1061213493 9:129206810-129206832 AATTGACAGGGGATGGCGGGAGG + Intergenic
1061391534 9:130319698-130319720 AAGAGATTGGGGCTGGTGGGGGG + Intronic
1185749201 X:2597161-2597183 TTGTGTTTGGGGAGGGTGGGCGG + Intergenic
1186216810 X:7309387-7309409 ATTTGAGAGGGGAGGGTGGGAGG + Intronic
1186850916 X:13579242-13579264 ATTTGAGAGTGGAGGGTGGGAGG - Intronic
1187236724 X:17474835-17474857 ATGTCATAGTGGATGCTGTGGGG - Intronic
1187596425 X:20777552-20777574 ATGGGGTAGGGGAAGGGGGGCGG + Intergenic
1187852208 X:23602203-23602225 TTGTGAAAGGGGATGGAGGAAGG - Intergenic
1187916157 X:24153973-24153995 ATCAGATAAGGGGTGGTGGGAGG - Intronic
1188403648 X:29779441-29779463 ATTTGAGAGGGGAGGGAGGGAGG + Intronic
1188644012 X:32541645-32541667 ATTTGAGAGTGGAAGGTGGGAGG + Intronic
1188651909 X:32641173-32641195 ATGTGATAGAGAATGGTTGAGGG - Intronic
1189220044 X:39363731-39363753 ACTTGATGGGGGAGGGTGGGAGG + Intergenic
1189226544 X:39418151-39418173 AAGTGATATTGGATGTTGGGGGG + Intergenic
1190288098 X:48973821-48973843 TTGGGATTGGGGATGCTGGGTGG - Exonic
1190399204 X:50014722-50014744 CTATGACAGGGGAGGGTGGGAGG - Intronic
1191910111 X:66141060-66141082 GTGTCACAGGGGTTGGTGGGGGG + Intergenic
1192169419 X:68844950-68844972 AAGAGATATGGGAGGGTGGGAGG + Intergenic
1192339173 X:70248437-70248459 ATGTAATAGGGTATGCTGGATGG - Intergenic
1192728555 X:73778557-73778579 ATCTGAGAGGGGATGGAGGCAGG + Intergenic
1193115485 X:77771562-77771584 GGGTCATTGGGGATGGTGGGGGG - Intronic
1193336813 X:80299344-80299366 ATGGGATTGGGGATGGAAGGTGG - Intergenic
1194455738 X:94100727-94100749 ATCTGATGGTGAATGGTGGGAGG + Intergenic
1195483062 X:105370371-105370393 ATTTGATGGTGGAGGGTGGGAGG - Intronic
1196303245 X:114070478-114070500 ACTTGATGGGGGAGGGTGGGAGG - Intergenic
1196624518 X:117863182-117863204 ATGTGTGGGGGGGTGGTGGGAGG - Intergenic
1197045067 X:121986447-121986469 ACTTGAGAGGGGAGGGTGGGAGG + Intergenic
1197274323 X:124460574-124460596 ATCGGATAGTGGAGGGTGGGAGG + Intronic
1197377478 X:125699157-125699179 ATTAGAGAGTGGATGGTGGGAGG - Intergenic
1197807469 X:130411613-130411635 GTGTGAAAGGGGAAGGTGTGGGG + Intronic
1200034947 X:153321014-153321036 ATGTTACAGATGATGGTGGGAGG - Intergenic
1201276226 Y:12301281-12301303 ATGTGATGGGGGTTGGGGGTTGG - Intergenic
1201717087 Y:17057103-17057125 ATATGAGAGTGGAGGGTGGGAGG + Intergenic