ID: 1140520116

View in Genome Browser
Species Human (GRCh38)
Location 16:75573726-75573748
Sequence AGATCTCTGCAGAAGGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 167}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140520112_1140520116 23 Left 1140520112 16:75573680-75573702 CCGATGGTTGGTACCAACATTTG 0: 1
1: 0
2: 1
3: 5
4: 64
Right 1140520116 16:75573726-75573748 AGATCTCTGCAGAAGGTACAAGG 0: 1
1: 0
2: 1
3: 15
4: 167
1140520113_1140520116 10 Left 1140520113 16:75573693-75573715 CCAACATTTGTATGAGAAGCACT 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1140520116 16:75573726-75573748 AGATCTCTGCAGAAGGTACAAGG 0: 1
1: 0
2: 1
3: 15
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140520116 Original CRISPR AGATCTCTGCAGAAGGTACA AGG Intronic
900529473 1:3145613-3145635 ACATCTCTGCAGGAGGCTCATGG - Intronic
900960903 1:5919339-5919361 AGTACTGAGCAGAAGGTACAGGG + Intronic
901142487 1:7044123-7044145 ATGTCTCTGCAGAAGGCACGTGG + Intronic
905985779 1:42280415-42280437 AGATCTCTGAAGATGCTATATGG - Intronic
907932499 1:59013713-59013735 AGATCTCTCCAGAAAGCAAACGG + Intergenic
909602346 1:77473581-77473603 AGATTTCTCCAGAAGGAAGAAGG - Intronic
910162004 1:84283025-84283047 AGATCACTGCAGAAGGGAAAGGG - Intergenic
911465978 1:98252446-98252468 CAATCTTTGCAGAAGGTAAAAGG - Intergenic
914903370 1:151724505-151724527 AGATATCTGCAGAACAGACAAGG - Intronic
915214306 1:154329637-154329659 AAATGTGTGCAGATGGTACAAGG + Intronic
915631589 1:157156830-157156852 AGGGCTCTGGAAAAGGTACATGG - Intergenic
918020001 1:180678276-180678298 AGACCTCTGAAGAAGGGAGAAGG - Intronic
918399473 1:184149016-184149038 AGATGTTTGCATCAGGTACACGG - Intergenic
918670253 1:187205754-187205776 AGATCTCTGCACAGGCTGCAGGG - Intergenic
920758919 1:208762814-208762836 AGAGGTCTGGAGAAGGTCCAGGG + Intergenic
923175767 1:231463273-231463295 ATATCTCTGAAGAAGGGACTGGG + Intergenic
1064706940 10:18082733-18082755 AGATCTCAGCTGAAAGTAGAGGG + Intergenic
1065303763 10:24349461-24349483 ACAACTCTGCATAAGCTACAGGG + Intronic
1065925582 10:30432205-30432227 AGGGCTCTAGAGAAGGTACAAGG + Intergenic
1069071599 10:63995390-63995412 AGATCTCTTGTGAAAGTACATGG + Intergenic
1070272136 10:74966344-74966366 AGAACTCTGCAGAAGTGACTAGG - Intronic
1071107148 10:82111530-82111552 AGATCACTGGAGAAGGTCCAGGG + Intronic
1071286880 10:84157016-84157038 AGCTCTCTGTAGAAGGTGGAAGG - Intergenic
1072977726 10:100073940-100073962 AGAGCTCTGAAGATGTTACACGG - Intronic
1073680588 10:105699190-105699212 AGATTTCTGGAGAAGGAACATGG + Intergenic
1075702886 10:124480621-124480643 AGATCTATCCATAATGTACAAGG + Intronic
1076154019 10:128188945-128188967 AGAGCTCTGCAGAAGGCAGGTGG + Intergenic
1077022530 11:424897-424919 AAATCTCTCCAGATGTTACAAGG + Intronic
1077907833 11:6547534-6547556 AGCTCTCTGCTGCAGGTACACGG + Exonic
1078697463 11:13648781-13648803 AAATCACGGCAGAAGGTGCAGGG - Intergenic
1081293442 11:41355102-41355124 GGATCTATCCAGAATGTACAAGG + Intronic
1083689454 11:64398163-64398185 TGATCTGTGCAGAAGGTGGAAGG + Intergenic
1083882158 11:65554043-65554065 AGATCTCAGCAGAAGGTACCAGG - Exonic
1085014894 11:73167511-73167533 AGCTCACTGCACAGGGTACATGG - Intergenic
1086246120 11:84755232-84755254 AGTTCTGTGCAGAACGTACTTGG - Intronic
1087204060 11:95375486-95375508 ACATATCTCCAGAAGGAACATGG + Intergenic
1087975412 11:104539948-104539970 AGATATTTGAAGAAGGCACAGGG - Intergenic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1091818683 12:3458368-3458390 AGAGCTGTGCAGCAGGTCCATGG + Intronic
1092344666 12:7705518-7705540 AGAGCTCCACAGAATGTACAGGG - Intergenic
1092674543 12:10901229-10901251 AGATTTCTGCACAGGGTAAATGG - Intronic
1092683783 12:11018040-11018062 ATATCTCTACAGCAGATACAGGG + Intronic
1094632460 12:32189481-32189503 AGAACTGTGCAGAAGGTTAAGGG + Intronic
1097644263 12:62217199-62217221 ACAGCCCTGCAGCAGGTACAGGG + Intronic
1103549332 12:121725319-121725341 AGCTCTCTGCAGACAGTGCAGGG - Intronic
1104553725 12:129780709-129780731 TTATCTATGCAGCAGGTACAGGG - Intronic
1106898207 13:34328360-34328382 AGAATTCTGCAGCAGGAACAAGG + Intergenic
1109673952 13:65648241-65648263 AGATGCCTGCAGAAGTTAAAGGG + Intergenic
1111155695 13:84321071-84321093 ACATCTCTGCAGAATGAATAGGG - Intergenic
1113232342 13:108226718-108226740 ACATCTCAGCAGATGGTGCATGG + Intronic
1113784815 13:112996907-112996929 AGATCTGTGCAGGAGTTTCATGG - Intronic
1116050228 14:39793784-39793806 AGATCTCTGGAGAGAGTGCAAGG + Intergenic
1117011486 14:51474913-51474935 ATATCTCTGCAGAAAGAACATGG - Intergenic
1121551637 14:94807215-94807237 AAATGTTTGCAGAAGGTAGAAGG - Intergenic
1122202110 14:100128792-100128814 AGCGCTCTGCAGATGGCACAAGG - Intronic
1123197242 14:106628281-106628303 AGATCTCAGGAGAAGGTAGTGGG + Intergenic
1123198586 14:106640157-106640179 AGATCTCAGGAGAAGGTAGTGGG + Intergenic
1123832155 15:24151083-24151105 AAATCTGTAGAGAAGGTACAAGG - Intergenic
1123891676 15:24786753-24786775 AGAACCATGCAGAAGGTAAAAGG + Intergenic
1125041760 15:35195872-35195894 AGATAGCTACAGAAGGGACAAGG - Intergenic
1126296983 15:47150701-47150723 AGAGTTCTGCAGAGTGTACAAGG + Intergenic
1129143601 15:73626274-73626296 AGATCTCTGCATAACAGACACGG + Intronic
1130285521 15:82551295-82551317 AAATCTGAGCAGAAAGTACAGGG + Intronic
1131045825 15:89314739-89314761 AGATCTGTCAAGAAGGTAAATGG - Intronic
1131966337 15:97847999-97848021 AGATGGCTGCAGAAAATACAAGG - Intergenic
1132108052 15:99078995-99079017 AGATCTCTGAAGAATGTCCTTGG - Intergenic
1134876893 16:17708481-17708503 AGATGTGTGCAGGAGATACAAGG - Intergenic
1134909998 16:18017155-18017177 ATATGTGTGCAGAAAGTACAAGG + Intergenic
1138470192 16:57228573-57228595 AAATCTCTGGAGAAATTACAGGG - Intronic
1140520116 16:75573726-75573748 AGATCTCTGCAGAAGGTACAAGG + Intronic
1143379669 17:6488154-6488176 AGACCTGTGGGGAAGGTACAGGG - Intronic
1144682098 17:17203093-17203115 GGATCCCTGCAGAAAGGACAAGG + Exonic
1146321075 17:31846867-31846889 GGATTTCTGCAGATGGCACAAGG + Intergenic
1146760716 17:35475437-35475459 AGATTTCTGCAGAAGGTTTTTGG + Exonic
1147558266 17:41493413-41493435 AGATCTCTGCAGAAGGCCAATGG + Intergenic
1151276624 17:73039253-73039275 GGATGTCTGCAGAAGGCATACGG - Intronic
1151436248 17:74099620-74099642 TGATCTCTGCAGGAGGGAAATGG - Intergenic
1153581866 18:6582091-6582113 GGATCTCTGCACAAGGTACCTGG + Intronic
1154146966 18:11874662-11874684 AGAACTCCTCAGATGGTACACGG + Intronic
1155150606 18:23119968-23119990 AGATCTCTTCAGATGGCAAACGG - Intergenic
1156266880 18:35497363-35497385 AGATGTCTGCAGAATGGACGAGG + Intronic
1158468263 18:57711191-57711213 AAATCCCTGCAGTAGGTACATGG - Intronic
1161503913 19:4633762-4633784 ACATCTTTGCAGGAGGCACAGGG - Intergenic
1165779499 19:38424087-38424109 AAATCCCTGGAGAAGGTCCAAGG - Intronic
1166352644 19:42207341-42207363 AAAGCTCTGCAGATGGTAGAAGG + Intronic
1167795888 19:51708262-51708284 ACATCACTCCAGAAAGTACAAGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925302920 2:2829710-2829732 AGGTCTCTGCAGAAGAGACAAGG + Intergenic
927853441 2:26513843-26513865 AGAGCTCTCCAGAAGGGACTTGG - Intronic
933314651 2:80701686-80701708 CAACATCTGCAGAAGGTACAAGG - Intergenic
935470601 2:103455311-103455333 TGCTCTCTGCAGGTGGTACAAGG + Intergenic
940557511 2:155249574-155249596 AAAACTCTACAGGAGGTACAAGG + Intergenic
940908110 2:159186771-159186793 AGATACCTGCAGAAGGCACGGGG - Intronic
945170005 2:206985989-206986011 CGATCCCTGCAGAAGGTATTGGG + Intergenic
947323669 2:228951010-228951032 AAGTCACTGCAGAAGGGACAAGG - Intronic
1171239316 20:23552122-23552144 TTATCTCTGCTGAGGGTACATGG + Intergenic
1173049908 20:39549264-39549286 TGATCTCTGTAGTAGTTACATGG + Intergenic
1174590752 20:51642803-51642825 AGAGCTCTGCAGAAGCCACAAGG + Intronic
1184385454 22:44171736-44171758 AGATCTGTGGGGAAGCTACATGG + Intronic
1184423006 22:44392658-44392680 AGAGCTCCACAGAAGGTACCTGG - Intergenic
949208885 3:1474267-1474289 AGCTATCTGCAGATGGTACGTGG - Intergenic
950713669 3:14832222-14832244 AGCTCCCAGCAGAAAGTACAAGG - Intronic
951344592 3:21531980-21532002 AGATCTGGGCACAAGGTAAATGG + Intronic
952115321 3:30173021-30173043 TGATCTGTCCAGAAGGCACATGG - Intergenic
953090810 3:39724344-39724366 AGAACACTACAGAAAGTACATGG - Intergenic
953824759 3:46241540-46241562 AAGTCTCTGCAGAATATACAGGG - Intronic
954574486 3:51668222-51668244 ACCTCTCTGAAGATGGTACAAGG - Exonic
954947438 3:54438955-54438977 ATAACTCTGCAGAAGGTATGTGG + Intronic
954960262 3:54558281-54558303 GGATCTCTGGTGAGGGTACAGGG + Intronic
957585063 3:82122600-82122622 TGATCTCTGAAGAAGGTTCTGGG - Intergenic
958080542 3:88741019-88741041 AGATGTCTTAAGAAGATACATGG + Intergenic
959393026 3:105800253-105800275 AAATCTCTGGGGAAGGGACATGG + Intronic
960515226 3:118595758-118595780 AGCTCTCAGCAGAAGGGAGATGG + Intergenic
961549548 3:127661187-127661209 GGCTCTGTGAAGAAGGTACAGGG - Intronic
961723109 3:128908956-128908978 AGCTCACTGCAGAAAGTCCATGG - Exonic
962881234 3:139578806-139578828 AGATGTCTGCAGAGCTTACAGGG - Intronic
963661684 3:148134385-148134407 AGATGTGTGCAGAAGGCAAAGGG + Intergenic
964081070 3:152758049-152758071 AGATCACTGCAGAAGAGAAAGGG + Intergenic
964090467 3:152870202-152870224 TGATTTCTACAGAAGGGACATGG + Intergenic
964639694 3:158895383-158895405 AGGTCTCTGCAGATTATACATGG + Intergenic
964942365 3:162174598-162174620 AGAGCTCTGTAGTTGGTACATGG - Intergenic
969105087 4:4801469-4801491 AGCTCTCTGGACAAGGCACAAGG - Intergenic
970542146 4:17090874-17090896 AGGTATTTGCAGAAGGTCCATGG - Intergenic
972295141 4:37730375-37730397 ACATCTGGCCAGAAGGTACAAGG - Intergenic
973273815 4:48288154-48288176 AAATCTCTACAGAAGGCCCAAGG + Intergenic
973756047 4:54074437-54074459 AGTTCTTTGCACATGGTACAGGG + Intronic
976772145 4:88664905-88664927 AGATATTTGCAGAAGGGATAAGG - Intronic
976993341 4:91397961-91397983 ATTTCTCTGCAAAATGTACAAGG - Intronic
980008029 4:127563319-127563341 AGATCTGGGCAGAAGCTGCAAGG - Intergenic
980385536 4:132085108-132085130 AGATGTTTGCTGAAGGTAAAGGG - Intergenic
980601164 4:135027419-135027441 ACATCCCTGCAAAAGGTAGATGG - Intergenic
981277651 4:142920635-142920657 AGGTGTATGGAGAAGGTACAGGG - Intergenic
981507414 4:145518072-145518094 GTTTCTCTTCAGAAGGTACAGGG - Intronic
982287583 4:153751440-153751462 AGCTTTCTGCAGAAGACACATGG - Exonic
983560692 4:169098510-169098532 ACATCTCTGCAAAAGGTAAGTGG + Intronic
984897436 4:184554022-184554044 AGATCTGAGCAGAAGGCAGATGG - Intergenic
987338244 5:16916150-16916172 AGGTCTCTGGAGATGGTTCATGG - Intronic
988716166 5:33830241-33830263 AGATCCCTTCAGAAGATAGAGGG + Intronic
989363518 5:40630267-40630289 AGGTCTCTGCAGGGAGTACAGGG + Intergenic
992785900 5:80170399-80170421 AGATCTCTACAGAAGGCAAAAGG - Intronic
996627820 5:125590756-125590778 TGATCTATGCAGAAGACACATGG - Intergenic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
1000635696 5:163641381-163641403 AGTTCTCAGCAGTAGGGACATGG + Intergenic
1001706921 5:173748240-173748262 AGTTCACTTCAGAAGGTAGATGG - Intergenic
1001880131 5:175236159-175236181 ATTTCTATGCACAAGGTACAAGG + Intergenic
1009019977 6:57938674-57938696 GGATCTCTGCAGCAGATGCAAGG - Intergenic
1010149585 6:72715244-72715266 TGATCTCACCAGCAGGTACAGGG - Intronic
1011095765 6:83660178-83660200 TGACCTCTGCAGTAGGTCCATGG - Intronic
1014343394 6:120235998-120236020 AGATCACAGCAGAAGGCAAAGGG + Intergenic
1014521242 6:122444929-122444951 AGAACACTGGAGAAGTTACATGG + Exonic
1014600973 6:123411698-123411720 AGATACCTGCAGATGGTAGAGGG - Intronic
1015748214 6:136533612-136533634 AGAGTTCTGCAGACTGTACAAGG + Intronic
1020313772 7:6889946-6889968 AGAGGTCGGCAGAAGGGACAGGG - Intergenic
1021918941 7:25464458-25464480 AGATCTCTGGGGAAGGTAGAGGG - Intergenic
1022991370 7:35711284-35711306 AGTTCTCTGCAGAAGGGGAAAGG + Intergenic
1024626936 7:51215864-51215886 AGCCCTCTACAGAAGGAACATGG + Intronic
1026988952 7:74572187-74572209 TGACCTCTGCAGAGGGTACTGGG + Intronic
1027710928 7:81600505-81600527 AAATCCCTGCAGAAGGTGAAGGG - Intergenic
1028869188 7:95748676-95748698 AGTTCTTTGCAGACGGTAGAGGG + Intergenic
1029907422 7:104105369-104105391 AGATCTGGCCAGAAGGTAAATGG + Intergenic
1031971675 7:128069076-128069098 GGATCTGTGCAGGTGGTACAGGG + Intronic
1033262879 7:139858796-139858818 AGATCACTTTAGAAGGTACACGG + Intronic
1036198198 8:6741671-6741693 TGATTTTTCCAGAAGGTACAAGG + Exonic
1036709392 8:11068551-11068573 AGCTTTCTGCAGAAGAGACAGGG - Intronic
1036952146 8:13150996-13151018 AGATGTCTACAGATGGAACAGGG + Intronic
1037268668 8:17100016-17100038 AGATCTTTGGAAAAGGTATATGG + Intronic
1039097961 8:33907245-33907267 AAATCACGGCAGAAGGTAAAGGG - Intergenic
1039304194 8:36243419-36243441 AGATCCCTACAAAAGGTAAAAGG + Intergenic
1046437496 8:114210956-114210978 AGAGCTCTCCAGAAGGTAATTGG - Intergenic
1048464053 8:134648937-134648959 AGATCTATCCAAAAGTTACAAGG + Intronic
1048796074 8:138151417-138151439 AGGTCTCTGCAGAAGTCAGATGG + Exonic
1049291559 8:141805682-141805704 AGATCTATGCAGAGGGTAGGCGG - Intergenic
1052245038 9:26324154-26324176 ATTTCTCTGAAGAAGGGACATGG - Intergenic
1052546336 9:29885654-29885676 AGATCTCTGTAGCTGGAACATGG + Intergenic
1053306326 9:36986796-36986818 AGATCTTTGAAGGAGGTCCAGGG - Intronic
1055520453 9:77075590-77075612 ACATCTCTGTAGTAGGTACATGG - Intergenic
1188981906 X:36734208-36734230 AGATCTTAGCAGAATGTTCAAGG - Intergenic
1189177011 X:38967632-38967654 AGAGCTTTGCAGAAGCTGCAAGG + Intergenic
1189744789 X:44158356-44158378 AGAGCTCTGTAGAAGTTACCAGG - Intronic
1189944354 X:46163048-46163070 AAAGCTCTGCAGAAGGTCAAGGG - Intergenic
1194224293 X:91236583-91236605 AGATCAATGCAGAAGCTAGAAGG - Intergenic
1194543563 X:95204731-95204753 AGTTATCTGCAGCAGGAACATGG - Intergenic
1194833955 X:98658772-98658794 AGTTATCTGCAGAAGGTCCCAGG - Intergenic
1197016620 X:121632926-121632948 AGAAATTTGCAGAAGTTACAAGG - Intergenic