ID: 1140522850

View in Genome Browser
Species Human (GRCh38)
Location 16:75597121-75597143
Sequence CAGGTAGACATGAAGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 2, 2: 12, 3: 61, 4: 316}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140522850_1140522855 3 Left 1140522850 16:75597121-75597143 CCCCAAAACTTCATGTCTACCTG 0: 1
1: 2
2: 12
3: 61
4: 316
Right 1140522855 16:75597147-75597169 CCTCAGAATGTGACTTTAGTTGG 0: 4
1: 68
2: 857
3: 1937
4: 2837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140522850 Original CRISPR CAGGTAGACATGAAGTTTTG GGG (reversed) Intronic
900281986 1:1875843-1875865 CAGGTAGACATGAATTTTGGGGG - Intronic
900712032 1:4120437-4120459 CAGGTAGATGTGAATCTTTGGGG + Intergenic
900903165 1:5530833-5530855 CAGTTGGACATGAGATTTTGTGG - Intergenic
901357568 1:8664438-8664460 CTGGTAGACATGTACTTGTGTGG - Intronic
901382873 1:8886612-8886634 CGGATAAACATGAAGTTTTGTGG + Intergenic
901442485 1:9286995-9287017 CAGGTGGACATGAATTTTGGGGG + Intergenic
901892973 1:12283879-12283901 AAGGTAGACATGAATATTTTGGG + Intronic
902643500 1:17781671-17781693 GGGGTAGACATGAATTTTGGGGG + Intronic
903707609 1:25298423-25298445 CAGGCTGAATTGAAGTTTTGAGG - Intronic
903719632 1:25394931-25394953 CAGGCTGAATTGAAGTTTTGAGG + Intronic
905510817 1:38518280-38518302 GAGGTGGACATGAATTTTGGAGG + Intergenic
905795293 1:40812650-40812672 CAGGGAGAAGTGAAGTTTGGGGG + Intronic
906332473 1:44898289-44898311 GAGGTAGATACCAAGTTTTGTGG - Intronic
907585605 1:55615270-55615292 CAGGTGGACATGAATTTTGTGGG - Intergenic
908040903 1:60111885-60111907 CAGGGACACAGGAAATTTTGGGG - Intergenic
908586539 1:65576255-65576277 CAGGCAGACATGGACCTTTGGGG - Intronic
908673996 1:66580464-66580486 CAGGTAGATAGGGAGTTTTGAGG - Intronic
911202600 1:95060841-95060863 CAGGTGGACATGAATTTTAGGGG - Intronic
912758395 1:112344240-112344262 CAGGTAGCCATTAACTTATGGGG - Intergenic
913210733 1:116580252-116580274 CAGGTGGACATGCATTTTGGAGG - Intronic
913461702 1:119093385-119093407 TAGGTAGACATGAATTTTGGAGG - Intronic
913583745 1:120252655-120252677 CAGGTCGAGAACAAGTTTTGTGG - Intergenic
913624428 1:120645665-120645687 CAGGTCGAGAACAAGTTTTGTGG + Intergenic
914565733 1:148864491-148864513 CAGGTCGAGAACAAGTTTTGTGG - Intronic
914607092 1:149265761-149265783 CAGGTCGAGAACAAGTTTTGTGG + Intergenic
917263927 1:173199294-173199316 CACATGGACATGAAGTTTGGAGG - Intronic
917435120 1:175013189-175013211 CAGGTGGAGGTGAAGTTATGAGG - Exonic
918628271 1:186683508-186683530 TAGCTACACAAGAAGTTTTGAGG + Intergenic
919503774 1:198371909-198371931 CATGTACATATGAAGATTTGAGG - Intergenic
920035972 1:203065627-203065649 CAGGTAGACACATAGTTTGGCGG - Intronic
921410653 1:214832866-214832888 CAGGTAGATGTGAAATTTTGGGG + Intergenic
922343032 1:224672732-224672754 CAGGTAGATATGAATTTTGGAGG + Intronic
922525271 1:226297230-226297252 CAGGTAGCCAGGAGGTTTTAAGG - Intronic
924501165 1:244639386-244639408 CAGCTAGAAATGAAGTTCTGTGG - Intronic
1063051158 10:2449703-2449725 AAGCTAAACATGGAGTTTTGGGG + Intergenic
1064316035 10:14257517-14257539 CAGGTACACATGCATTTTCGAGG - Intronic
1064473296 10:15659611-15659633 TGGGTAGATATGAAATTTTGGGG - Intronic
1068729367 10:60338952-60338974 CTGGAAGCCATGAAGTCTTGGGG + Intronic
1069404273 10:68081577-68081599 CAGATGGACATGAATTTTGGGGG + Intergenic
1069555436 10:69394719-69394741 CAGGTAGACATGAATGCTGGTGG + Intronic
1069840444 10:71336312-71336334 TGGGTAGACATGAATTTTGGGGG + Intronic
1070370768 10:75779832-75779854 CAGGTAGACATAAATTTGTAGGG - Intronic
1072147647 10:92656688-92656710 CAGCCAGACATGAAATCTTGGGG - Intergenic
1072242953 10:93514271-93514293 CAAGTGGACATGAATTTTGGGGG + Intronic
1072836657 10:98722125-98722147 CTGGTAGACATAAATTTTGGGGG - Intronic
1074647906 10:115485386-115485408 AATGTAAACATGATGTTTTGAGG + Intronic
1074713504 10:116197659-116197681 CAGGTGGACATGAATTTTGTGGG + Intronic
1075049420 10:119171600-119171622 CAGATAGAAATGATGTTCTGGGG + Intronic
1075353895 10:121752745-121752767 CAGGTAGACATACAGATCTGTGG - Intronic
1076484243 10:130805600-130805622 TAGATAGACATGAATTTTGGGGG - Intergenic
1078437240 11:11335546-11335568 TGGGTAGACATGAATTTTAGAGG - Intronic
1080208857 11:29761868-29761890 CAGGTGGATATGAATTTTGGAGG - Intergenic
1080590588 11:33719997-33720019 CCTGTAGACATGGATTTTTGTGG + Intronic
1081093586 11:38902515-38902537 CAGGTAGGCATGTAGCATTGTGG + Intergenic
1082762210 11:57138328-57138350 TGGGTAGACATGAACTTCTGCGG + Intergenic
1084158974 11:67334307-67334329 CAGCTGGAGATGGAGTTTTGAGG - Intronic
1084447668 11:69213093-69213115 CAGGGGGACATGAATTTTGGCGG - Intergenic
1085129502 11:74026029-74026051 CAGGAAGATCTGCAGTTTTGTGG - Intronic
1086064174 11:82729528-82729550 CAGGGAGACATGAGGTAATGGGG + Intergenic
1087013012 11:93530921-93530943 CAGGTGGACATGAGTTTTTTGGG - Intronic
1087155080 11:94894309-94894331 CAGGTCAAGATGAAGTTTGGTGG + Intergenic
1087689921 11:101308791-101308813 CATGTAGAGATGTAGTGTTGTGG + Intergenic
1087779029 11:102283828-102283850 CAGGTAGACGTGACTTTCTGTGG + Intergenic
1087901067 11:103641743-103641765 CAGGTGGACATGAATTTTGGGGG - Intergenic
1090051114 11:123380797-123380819 CAGGCAGACATGAGGCTGTGGGG - Intergenic
1091238001 11:134034420-134034442 CAGGGAGCCCTGAGGTTTTGCGG + Intergenic
1091265162 11:134264905-134264927 CAGGTAGCAATGAAGTGATGAGG + Exonic
1091352068 11:134905813-134905835 CAAGTAGGAATGAAGATTTGGGG - Intergenic
1091922363 12:4315648-4315670 GAGGTACACATGAATTGTTGGGG - Intergenic
1096094832 12:48927535-48927557 AAGGGAGACTTGGAGTTTTGTGG - Intronic
1097350026 12:58538625-58538647 CAGGTAGGCATGAATTTTGGGGG - Intergenic
1097522867 12:60690068-60690090 CAGGCACACATGAAGTCCTGAGG - Intergenic
1100795735 12:98179908-98179930 CAGGTGGACATGAATTTTAGTGG + Intergenic
1100825760 12:98472870-98472892 CAGGTAGACATGAATTATTGGGG - Intergenic
1102217040 12:111169013-111169035 TAGGTGGACATGAATTTTGGCGG - Intronic
1103099260 12:118158220-118158242 CTGGTAGACATCAACATTTGAGG - Intronic
1103477585 12:121229984-121230006 CAGGTAGATGTGAATTTTTGGGG + Intronic
1104686313 12:130787357-130787379 CTTGTAGACATGAGCTTTTGGGG + Intergenic
1107597589 13:41979417-41979439 CAGGTAGAGACTACGTTTTGAGG + Intergenic
1108498493 13:51047165-51047187 CTGGTAGACATGAATTTTAAGGG - Intergenic
1109902951 13:68797271-68797293 TAAGTAGACATGAACATTTGGGG + Intergenic
1111775347 13:92654783-92654805 CAGGTAGAAATGAAATTTGGGGG - Intronic
1112082098 13:95982858-95982880 CAGGTAGGAATGATGTGTTGTGG + Intronic
1112558419 13:100490687-100490709 CAGGCAGAAAGGAACTTTTGGGG - Intronic
1112721280 13:102248926-102248948 CATCTAGACTTGAAATTTTGGGG - Intronic
1112724531 13:102287424-102287446 AAGGTAGACATGCAATTTAGGGG + Intronic
1112822666 13:103354865-103354887 CCAGTAGACATAAATTTTTGGGG - Intergenic
1112838805 13:103549985-103550007 CAGGTGGATATGAATTTTGGGGG + Intergenic
1113042524 13:106120292-106120314 CAGGAAGAGAAGAAGTTCTGGGG - Intergenic
1116489273 14:45487100-45487122 CAGGTGGATATGAATTTTTTGGG - Intergenic
1117436434 14:55719059-55719081 CAGATAAACATGAAGATATGAGG + Intergenic
1117965906 14:61206523-61206545 CAGGTAGATATGAATTTTAGGGG + Intronic
1118221952 14:63862732-63862754 AAGGTAGATATTAGGTTTTGGGG + Intronic
1119128433 14:72150034-72150056 CAGGTAGACGTGAATTTGGGAGG - Intronic
1119968611 14:78944432-78944454 CGGGTAGACATCAAATTTTTAGG - Intronic
1120144292 14:80962594-80962616 CAGGTAGATATGAATTTTGGGGG + Intronic
1120383392 14:83811656-83811678 TAGATAGACATGAAGATTTTTGG + Intergenic
1120819033 14:88894930-88894952 CAGGTAAACATGAATATTTGGGG + Intergenic
1120885719 14:89450366-89450388 CAAGCAGACATGAATTTTGGGGG + Intronic
1121022784 14:90591706-90591728 CAGGTAAACCTGAACTTGTGGGG - Intronic
1121396440 14:93627737-93627759 CAGGGAGATATGAAGAATTGGGG + Intronic
1122595016 14:102884391-102884413 CAGATAGACATGAATTTTGGAGG + Intronic
1122595757 14:102889906-102889928 CAGGTAGACTTGACATTTGGTGG + Intronic
1124010193 15:25831912-25831934 CAGATGGACATGAATTTTGGGGG - Intronic
1124969108 15:34467488-34467510 CAAGTAGAAATGAATTTTGGGGG - Intergenic
1125121218 15:36160937-36160959 CAGGGAGACTAGAAATTTTGTGG + Intergenic
1126451628 15:48814863-48814885 TAGGTGGACATGAAATTTTAGGG - Intergenic
1128259097 15:66219927-66219949 CGGGTGAACATGAATTTTTGGGG - Intronic
1129029858 15:72610221-72610243 GAGGCAGACATCAAGTTCTGGGG + Intergenic
1130697492 15:86145207-86145229 TGGGTGGACATGAATTTTTGGGG + Intronic
1131267902 15:90929215-90929237 AAGGTATACATGATGTTATGAGG - Intergenic
1131295147 15:91141363-91141385 CAGGAAGACTTGGAGTTTTCAGG + Intronic
1131552499 15:93369626-93369648 TGGGTAGACATGAATTTTGGGGG + Intergenic
1133689846 16:8202748-8202770 CAGGTGGACATGAATTTTGAGGG + Intergenic
1133758314 16:8778909-8778931 CAGGTAAACATGAATTTAGGGGG + Intronic
1134290351 16:12899579-12899601 GAGGTAGACAGAAAGTTTGGAGG + Intergenic
1136086160 16:27886671-27886693 CAGGGAGAAATGAAATTGTGAGG + Intronic
1138305635 16:55972004-55972026 GAGGAAGACATGATGGTTTGTGG + Intergenic
1138752255 16:59438137-59438159 CAGGTAGGCATGAATTTGGGGGG - Intergenic
1139613367 16:68074618-68074640 CAGGTAGACAGGGAGCTGTGGGG - Intronic
1140522850 16:75597121-75597143 CAGGTAGACATGAAGTTTTGGGG - Intronic
1140636356 16:76919320-76919342 TGGGTAGACATGCATTTTTGGGG + Intergenic
1140662823 16:77204298-77204320 CTGGTGGACATGAATTTTGGAGG - Intronic
1140892551 16:79297727-79297749 CAGGTACACATGGAGTTCTGTGG + Intergenic
1141437965 16:84011581-84011603 CAGGTAGACATGAATTTTGGGGG - Intronic
1141666591 16:85468852-85468874 CTGGTAGACGTGAATTTTGGGGG - Intergenic
1141977301 16:87525420-87525442 CAGGTGGACATGCATTTTTGGGG + Intergenic
1147698955 17:42379648-42379670 CAGGTAGTGTTGAAGGTTTGAGG - Intronic
1149054571 17:52347646-52347668 CAGGTCTATATGCAGTTTTGGGG + Intergenic
1151011659 17:70505381-70505403 CAAGAAGACATGAATTTTAGGGG - Intergenic
1151222784 17:72625597-72625619 CAGGTGGACATGGATTTTGGTGG + Intergenic
1151963302 17:77418797-77418819 CAGGTAGTCATGTAGGTCTGTGG + Intronic
1152261352 17:79268966-79268988 TAGGTAGACATGAATTTGGGGGG - Intronic
1152603847 17:81278968-81278990 CAGGTGGCCAGGAGGTTTTGTGG - Intronic
1155072212 18:22326584-22326606 TAGGTGGACATGAATTTTGGAGG - Intergenic
1156723621 18:40100825-40100847 CAGGTGGACATGAATTTTTTAGG - Intergenic
1157085552 18:44577022-44577044 CAGGTAAACATGAATTTTGGAGG + Intergenic
1157750711 18:50175672-50175694 CAGGTGGGCAAGAAGTTTTAAGG + Intronic
1159004634 18:63001497-63001519 TAGGTAGACATGAACTTTTTGGG + Intergenic
1161228694 19:3161323-3161345 CAGGTGGACATGAATTTTGGGGG + Intronic
1161341567 19:3745941-3745963 CAGGTAGGCATGAATTTGAGGGG + Intronic
1161692016 19:5741241-5741263 CAGGTTGACATAAATTTTGGGGG - Intronic
1161883335 19:6973169-6973191 CAGGAAGAAAGGAAGTGTTGAGG - Intergenic
1164780955 19:30892185-30892207 GTGGTAGACATGGAGTTATGGGG - Intergenic
1164840827 19:31390928-31390950 CAGGTGGACATGCTATTTTGGGG + Intergenic
1166615094 19:44236613-44236635 CAGGTGGACTCGAAGATTTGAGG - Exonic
1167316235 19:48764642-48764664 CAGGTAGACCTGAAGCTTCCAGG + Intergenic
1167316597 19:48766978-48767000 CAGGTAGACATGAAGCTTCCAGG + Intergenic
925665984 2:6256874-6256896 CTGGTGGACATGAATTTTGGGGG - Intergenic
926559681 2:14402447-14402469 TAGGTAGAGATGGAGTTTTTGGG - Intergenic
927815006 2:26207673-26207695 CTGGGTGACATGAACTTTTGAGG + Intronic
928296225 2:30086518-30086540 CACGTAGACATGTAGCTTAGAGG - Intergenic
928697306 2:33862181-33862203 CAGGTGGACATAAATTTTGGAGG + Intergenic
932263015 2:70342756-70342778 CAGGAAGAGATGAAGATTTAGGG + Intergenic
932271705 2:70416056-70416078 CAGGTACTCATGAAGATTAGGGG + Intergenic
932322132 2:70830128-70830150 CTGGTGGACATGAAGTTCTAGGG - Intergenic
932372214 2:71200002-71200024 CAGATTGAAATGTAGTTTTGGGG - Intronic
932520067 2:72402900-72402922 CATGTAGAGCTGAAGTTTTGAGG + Intronic
934477300 2:94602196-94602218 CAGGCCCACCTGAAGTTTTGGGG - Intronic
935714584 2:105928784-105928806 CAGGCAGACGTGAAGTCCTGCGG + Intergenic
936888128 2:117337328-117337350 CAGGTAGACTTAAAGTTTTCTGG - Intergenic
937459317 2:122071866-122071888 GGGGAAGACATGCAGTTTTGTGG + Intergenic
938624361 2:133092104-133092126 TAGGTAGACATGAATTTTACAGG - Intronic
939606759 2:144263119-144263141 CAGGTACACAGCAAGTTTTCAGG + Intronic
939774217 2:146364127-146364149 AAAGTAAACATGAATTTTTGTGG + Intergenic
940295370 2:152117045-152117067 CAGGTGTACATGAAATTTGGAGG + Exonic
941176541 2:162204356-162204378 CACGTGGACATGAATTTTTGGGG - Intronic
942842416 2:180378874-180378896 TAGGTAGGCATAAAGTTTGGGGG + Intergenic
943299067 2:186174695-186174717 TAGGTAGAGAGGAAGTTTTGAGG + Intergenic
943325609 2:186493944-186493966 CAGGTGGACTTGAATTTTGGGGG + Intronic
944472826 2:200073143-200073165 CAGGTGGACATGAATTTTTGAGG + Intergenic
944542547 2:200767453-200767475 CAGACAGACATGAATTTTAGGGG + Intergenic
944545886 2:200798473-200798495 CAGGTAGACATGAATTTGGGGGG + Intergenic
946171122 2:217896284-217896306 TGGGTGGACATGACGTTTTGAGG - Intronic
946887991 2:224243732-224243754 CAGGTAGATGTGAAGTTTGGGGG - Intergenic
948115218 2:235490406-235490428 AAGGGGGACATGAAGTGTTGGGG + Intergenic
948398114 2:237662360-237662382 TGGGTGGACATGAACTTTTGGGG + Intronic
1169343959 20:4815605-4815627 CAGGTAGAAGTGGAGTTGTGTGG - Intronic
1170144890 20:13162628-13162650 GAGGGAGACATTAAGTATTGTGG - Intronic
1170459813 20:16566951-16566973 CAGGTAGACAGGGTGTTGTGAGG - Intronic
1170560728 20:17556078-17556100 TAGTTAGACAAAAAGTTTTGGGG + Intronic
1170836303 20:19887589-19887611 AGGGTACACATGAAGTTTTCAGG + Intronic
1171422489 20:25026529-25026551 CAGGTTGACTTGAAGGGTTGGGG - Intronic
1172976427 20:38909429-38909451 CAGGTAGACATGAATTTTTGAGG + Intronic
1173375234 20:42477002-42477024 CAGGAAGAGATGCAGTTTGGTGG - Intronic
1174366405 20:50059200-50059222 CTGGTAGACATGAACTTCAGGGG - Intergenic
1174884091 20:54312517-54312539 CTGATAGACATGAATTTTAGGGG - Intergenic
1175031777 20:55961847-55961869 CAGGGAGACAGGAAGAATTGGGG + Intergenic
1175119623 20:56708062-56708084 CTGGTGGACATGAATTTTGGAGG + Intergenic
1176069452 20:63218504-63218526 CAGGTGGACATGAGTTTTGGGGG + Intergenic
1177571892 21:22897903-22897925 TGGGTAGACATGAATTTTTGAGG + Intergenic
1177728080 21:24993835-24993857 CATGTAGAGCTGAACTTTTGGGG + Intergenic
1178839168 21:36124966-36124988 CAGGTGGACATGAATTTTGAGGG - Intergenic
1179085257 21:38210779-38210801 CAGATGAACATGAACTTTTGGGG + Intronic
1179472783 21:41622651-41622673 CAGGTGGACACGAATTTTGGGGG + Intergenic
1180040229 21:45274257-45274279 CTTGTAGAGATCAAGTTTTGTGG - Intronic
1180363362 22:11919195-11919217 GAGAAAGACATGAAGTTTGGGGG + Intergenic
1181587643 22:23862373-23862395 CAGGAGGACATGCAGGTTTGGGG - Intronic
1182536485 22:31007610-31007632 CTGGCAGACATGAATTTTTGTGG - Intergenic
1182552319 22:31107027-31107049 CAGGAAAACATGAAGTGATGGGG + Intronic
1183013902 22:34970329-34970351 TGGGTAGACATGAATTTTGGGGG - Intergenic
1183397011 22:37577312-37577334 CAGGTGGACATGAATTTTCGGGG - Intronic
1184125270 22:42482381-42482403 CAGGTAGCCATGAATTTCTTGGG + Intergenic
1184133755 22:42533841-42533863 CAGGTAGCCATGAATTTCTTGGG + Intergenic
1184775595 22:46621300-46621322 GAGGTGGACATGAATTTTGGGGG - Intronic
950118461 3:10466292-10466314 CACGTAGACATGAACTTCAGTGG - Intronic
951147357 3:19243755-19243777 CAAGCATACATGAAGATTTGAGG - Intronic
951634414 3:24757227-24757249 CAGGACCACATGAAGTTTTCTGG - Intergenic
952108925 3:30100018-30100040 CAAGTAGACATGAAATCTGGTGG - Intergenic
952718119 3:36502780-36502802 CTGGTAGACATCAAGTTGAGTGG + Intronic
956116285 3:65922274-65922296 CAGGTGGACATGAACTTTGAGGG - Intronic
956422311 3:69097933-69097955 CAAGTAGAGATGGACTTTTGTGG + Intronic
957248614 3:77744641-77744663 GAGACAGACATGAAGTTTTGGGG + Intergenic
959948260 3:112149876-112149898 CAGGTAGAAATGCAGGTATGTGG - Intronic
959969808 3:112396881-112396903 CAGGAAGACTTGAAGTCATGAGG - Intergenic
960205092 3:114887360-114887382 CAGGTGAACATGAAATTTTGGGG - Intronic
960409668 3:117307343-117307365 CAGGAAGACAGGAAGATGTGTGG - Intergenic
961432948 3:126896101-126896123 CAGTTTTACATGAAGCTTTGAGG + Intronic
964364477 3:155934587-155934609 TGGGTGGGCATGAAGTTTTGGGG + Intronic
965137938 3:164798400-164798422 CAGGTTGACTTCAAGATTTGTGG - Intergenic
967007907 3:185401793-185401815 CATGTGGAAATGAGGTTTTGAGG + Intronic
969051605 4:4377200-4377222 CAGATGGACATGAATTTTGGGGG + Intronic
969078917 4:4603149-4603171 TGGGTGGACATGAAGTTTTTAGG - Intergenic
969106853 4:4812942-4812964 CAAGTAAACATCAAATTTTGTGG - Intergenic
970211332 4:13713199-13713221 CAGGTAGACATGAATTTTAGGGG - Intergenic
970279597 4:14439838-14439860 CAGGTAGACATTTAGATATGTGG + Intergenic
970464941 4:16312943-16312965 AAGGTAGACATGAATTCTGGGGG + Intergenic
970510999 4:16781712-16781734 CAGGCAGACATGAATTATAGGGG - Intronic
970933181 4:21537570-21537592 CAAGTAGACACGAAATTTTAAGG - Intronic
972906883 4:43760917-43760939 CTGGTAGCCTTGAAGTATTGAGG - Intergenic
973258325 4:48135750-48135772 CAGGTAGACAAGAAGGAATGTGG + Intergenic
973659749 4:53091721-53091743 CAGGCAGACATGAAGATTTCTGG + Intronic
974116988 4:57591002-57591024 CAAAAGGACATGAAGTTTTGTGG + Intergenic
974535448 4:63168143-63168165 TAGGTGGACATGAAATTTGGAGG - Intergenic
974666028 4:64962650-64962672 TAAGTAAAAATGAAGTTTTGTGG - Intergenic
975286312 4:72625482-72625504 CAGGTGAACATGAACTTTGGGGG - Intergenic
976663120 4:87561213-87561235 GAGGTGGACATGAATTTTGGGGG - Intergenic
976764416 4:88584289-88584311 CAGGTAGACATGAATTTGAAGGG + Intronic
976956612 4:90909320-90909342 CAAGTAGACATGAATTTTGGAGG + Intronic
977521238 4:98087280-98087302 CAGGAAAACGTGAAGTTTTTAGG - Intronic
977531029 4:98200634-98200656 CAGGTAGACATGAATTTTGGGGG - Intergenic
978911318 4:114067440-114067462 CAGATATACATGAATTTTAGGGG - Intergenic
979842697 4:125464997-125465019 CAGATAGTCATGAAGTTGTTTGG - Intronic
979856894 4:125644619-125644641 TAGGTTGAGATGAAGTTGTGCGG - Intergenic
981268536 4:142816922-142816944 CAGGTAGACATAAAGTTTTGGGG - Intronic
981687786 4:147474397-147474419 CAGGTGGAAATGATGTTTTTGGG - Intergenic
981752066 4:148102354-148102376 CAGGTAGACACTGAGTTCTGTGG - Intronic
983013518 4:162580617-162580639 GAGATAGAAATTAAGTTTTGAGG + Intergenic
983318847 4:166168925-166168947 GAGGTAAACCAGAAGTTTTGAGG + Intergenic
985768004 5:1791089-1791111 CAGGTAGACAGGAATTTTGCGGG - Intergenic
987247002 5:16059299-16059321 CAAGAAGACATGAATTTTGGAGG + Intergenic
989262259 5:39431198-39431220 TAGGTAGACATGAATTTTGGAGG - Intronic
990044564 5:51413649-51413671 CAGGTACACATGGAGTTTTCTGG - Intergenic
990389035 5:55299803-55299825 CAGGTGGACATGAATATTTGGGG + Intronic
990645284 5:57836827-57836849 CTGGTGGATATGAATTTTTGGGG + Intergenic
992353313 5:75953333-75953355 CATTTTGACATGAAGTTTGGGGG + Intergenic
993742050 5:91553645-91553667 CAGGTGGACATGAATTTTGGAGG - Intergenic
994027894 5:95105961-95105983 CTGGTAGACTTGATGTTTTTAGG - Intronic
994280171 5:97892615-97892637 CAGGTAGACATGAATTTTGCAGG - Intergenic
995168203 5:109073123-109073145 CAGGTAGACATAAATTTTGGGGG + Intronic
995235687 5:109827138-109827160 CAGGAAGAAATGAGGGTTTGGGG + Intronic
996021605 5:118596739-118596761 CTGACAGACATGAAGTTTGGTGG + Intergenic
996564001 5:124860624-124860646 CAGGTCAACATCAAGTTTTGTGG + Intergenic
997659986 5:135582107-135582129 GAGGTAGACGTGAAGTGTGGGGG + Intergenic
997666500 5:135633649-135633671 GAGGTAGACATGTAGATGTGAGG + Intergenic
1000047169 5:157531298-157531320 GAGGTGGACATGAATTTTAGGGG - Intronic
1002558333 5:180061800-180061822 TAGGGGGACATGAATTTTTGTGG + Intronic
1003026694 6:2561255-2561277 CAGGTAGAGTTCAAGTTTTGGGG - Intergenic
1003473430 6:6459266-6459288 AAGGTACCCTTGAAGTTTTGGGG - Intergenic
1003783621 6:9457907-9457929 CAGGTACACATGAAGCTATGTGG - Intergenic
1004820949 6:19367266-19367288 CAGATACCCATGAAGTCTTGGGG - Intergenic
1005595759 6:27377566-27377588 CAGGAAGACATGAAGCTGGGAGG - Intronic
1007364859 6:41384234-41384256 TGGGTGGACATGAATTTTTGGGG + Intergenic
1007736272 6:43984252-43984274 CTGGTGAACATGAAGTTTGGAGG + Intergenic
1008230634 6:48982332-48982354 CAGGTGGACCTGATTTTTTGGGG + Intergenic
1008863767 6:56184763-56184785 CATCTGGATATGAAGTTTTGCGG + Intronic
1009444208 6:63721243-63721265 CAGGTATACATAAAGATTGGTGG + Exonic
1010009762 6:71036488-71036510 GAGGTATACCAGAAGTTTTGTGG - Intergenic
1012736167 6:102947715-102947737 CACGTTAACATGAAGTTTTATGG - Intergenic
1013274506 6:108571400-108571422 CAGGAAGACATGAATTTTAGAGG - Intronic
1013343648 6:109238743-109238765 CAGGTAGACATGAATTTTGGGGG + Intergenic
1013356177 6:109347746-109347768 CAGGTAGACATGAAATTTGGGGG + Intergenic
1013769603 6:113613248-113613270 CAGTTAAACATGAGGTTTGGAGG - Intergenic
1014390257 6:120853372-120853394 CAGGTAGAGATTATGCTTTGAGG + Intergenic
1014490643 6:122057516-122057538 CAGGTAGACACGAAGTTGATTGG + Intergenic
1015547018 6:134371543-134371565 CAGGTAGACATGATATTTGGGGG + Intergenic
1016722840 6:147322809-147322831 CAAGTACACTTGAAGTTTTCTGG + Intronic
1017180891 6:151550855-151550877 TAGGTTCAGATGAAGTTTTGAGG - Intronic
1017841266 6:158224717-158224739 CAGGTAGCCATGACTCTTTGGGG - Intergenic
1018040864 6:159921031-159921053 CAGGTGGACAGGAATTTTGGGGG - Intergenic
1018099163 6:160420965-160420987 CAGGTAGACATGAGGCTCTGCGG - Intronic
1018568660 6:165184301-165184323 CAGGTGGACATGAATTTTGGAGG + Intergenic
1018659022 6:166067982-166068004 CAGGTAGACATTGCATTTTGTGG - Intergenic
1019065975 6:169298134-169298156 TAGGTGGACATGAATTTTGGGGG - Intergenic
1020110529 7:5445501-5445523 CAGGTGGACAGGAAGTTTTGGGG - Intronic
1020123171 7:5517114-5517136 CAGGTGGACATGAATATCTGGGG + Intergenic
1020678062 7:11203604-11203626 CAGGGAGAAATAAAGATTTGGGG - Intergenic
1020706778 7:11554144-11554166 CTGGTAGACATTAAGTTTGCAGG - Intronic
1022385584 7:29895877-29895899 CAGTTAAACATGAAATTTGGTGG + Intronic
1022519355 7:30995936-30995958 CAGGGAGACAGGAAGCCTTGTGG + Intergenic
1022621158 7:31986008-31986030 CAGGTAGATGTGAATTTTGGTGG - Intronic
1022693316 7:32680130-32680152 CTGGTGGACATGAAATTTTAGGG - Intergenic
1022920989 7:35014706-35014728 CTGGTGGACATGAAATTTTAGGG - Intronic
1023269327 7:38444303-38444325 CAGATAGGCATGAAATTTGGGGG - Intronic
1023346519 7:39277170-39277192 AAGGTAGACAGGAAGTTCTCTGG + Intronic
1023355944 7:39366991-39367013 CAGGAATACAAAAAGTTTTGGGG + Intronic
1023656697 7:42429766-42429788 TAGAGAGACATGAAGTTTTCAGG - Intergenic
1024246213 7:47472252-47472274 CAGGTGGACATGAATTTCGGGGG + Intronic
1024379783 7:48683234-48683256 CAGGTAGACATAAATTCTTGAGG + Intergenic
1025109038 7:56197278-56197300 CAGTGAGACAGGATGTTTTGGGG + Intergenic
1027436330 7:78168437-78168459 CAGACTGCCATGAAGTTTTGGGG + Intronic
1028972337 7:96872713-96872735 CAGGTGGACATGAATTTTGGGGG + Intergenic
1031096861 7:117430438-117430460 CAGGTGGACATGAAATTTTGGGG + Intergenic
1031610068 7:123815756-123815778 CAGGTATAGATGGAGATTTGAGG - Intergenic
1033984724 7:147210865-147210887 CATGTAATCATGTAGTTTTGAGG + Intronic
1034070207 7:148177162-148177184 TAGGTGGACATGAATTTTGGGGG - Intronic
1034408584 7:150923685-150923707 CAGGTGGACATGGATTTTGGGGG - Intergenic
1035248634 7:157581915-157581937 CAGGCAGAGATGGAGTGTTGTGG + Intronic
1036974922 8:13399712-13399734 CAGGTAGAGATAAAGGTTTAAGG - Intronic
1037464691 8:19148737-19148759 CAGGTAGACATGAATTTTGGAGG - Intergenic
1037627347 8:20619633-20619655 CAGGTGAACATGAATTTTGGTGG - Intergenic
1037660996 8:20926759-20926781 CAGGTGGACATGAATTTTGAGGG + Intergenic
1037721429 8:21447825-21447847 CAAGTGGACATGAATTTTTAGGG - Intergenic
1037863902 8:22427395-22427417 AAGGTTGACATCAAATTTTGGGG - Intronic
1038304797 8:26389751-26389773 CAGGTAGACAGGAAGTGATGGGG + Intronic
1038982762 8:32777471-32777493 CAGGTAGACATGAGGCATGGGGG - Intergenic
1039726588 8:40223998-40224020 CAGGTAAACATGAATTATGGGGG + Intergenic
1041632964 8:60108817-60108839 CAGGCACACACTAAGTTTTGTGG - Intergenic
1041837349 8:62231355-62231377 CAGTTAAACATGAACTTTTGAGG + Intergenic
1042027031 8:64434822-64434844 CAGGAATACATGCAGTCTTGGGG - Intergenic
1042150638 8:65779690-65779712 TTGGTAGACATGAAGTTTCTCGG - Intronic
1042300875 8:67279354-67279376 CAGGAAGAGATGTATTTTTGTGG - Intronic
1043196385 8:77297776-77297798 CAGGTATACATGCATATTTGGGG + Intergenic
1043217314 8:77608390-77608412 CCAGTAGAAATGAAGTTTTGTGG - Intergenic
1044688985 8:94857845-94857867 CAGATACACATGAATTTTGGGGG + Intronic
1044773302 8:95660644-95660666 CATGTAGACATGAATTTTGGGGG - Intergenic
1044928387 8:97228649-97228671 CAGGTAGACAGGAGGTTTATGGG + Intergenic
1044995028 8:97830491-97830513 TAGGTAGACATTAAGTAGTGGGG + Intronic
1045176886 8:99735272-99735294 CAGGTAGAAATGAATTTGGGAGG - Intronic
1045486110 8:102633023-102633045 CTGGTGGACATGAATTTTGGAGG - Intergenic
1046313594 8:112471242-112471264 CAGAGAGCCATGAAGTTTTCTGG + Intronic
1046714728 8:117555084-117555106 CAGATAGCCATGAAGTAGTGTGG + Intergenic
1046976151 8:120280220-120280242 TATATAGACATTAAGTTTTGTGG + Intronic
1047006406 8:120624608-120624630 GAGGAGGACATGAATTTTTGGGG - Intronic
1047431917 8:124800115-124800137 CAGGTGAACATGAATTTTTGGGG - Intergenic
1048368843 8:133759350-133759372 CAGCTGGACATGACTTTTTGGGG + Intergenic
1048743121 8:137584457-137584479 CGGATAGACATGAATTTTGGAGG - Intergenic
1049320952 8:141996049-141996071 TAGGTGGACATGAATTTTGGGGG + Intergenic
1050411474 9:5370634-5370656 CAGGTCTACATGACCTTTTGTGG - Intronic
1050588009 9:7133293-7133315 CAAGTAGGCATGAAGTTCTGAGG - Intergenic
1051764246 9:20504742-20504764 CAGGTACTCATCATGTTTTGTGG - Intronic
1051888131 9:21916179-21916201 CAGGTATACATGAATTTTGGAGG - Intronic
1052235130 9:26203949-26203971 CAGGTACGCATGAAGTTCTAGGG - Intergenic
1052852670 9:33387366-33387388 CAGGCCCACCTGAAGTTTTGGGG + Intronic
1052873607 9:33533685-33533707 CAGGTAGAAAAGAAGTTATTTGG + Intronic
1053502487 9:38611053-38611075 CAGGTAGAAAAGAAGTTATTTGG - Intergenic
1053512482 9:38700365-38700387 CAGGTAGACATTAAATCTGGGGG - Intergenic
1053680769 9:40483917-40483939 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1053930755 9:43112229-43112251 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054282944 9:63141018-63141040 CAGGCCCACCTGAAGTTTTGGGG - Intergenic
1054293851 9:63319432-63319454 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054391876 9:64623921-64623943 CAGGCCCACCTGAAGTTTTGGGG + Intergenic
1054503853 9:65892407-65892429 CAGGCCCACCTGAAGTTTTGGGG - Intronic
1055011511 9:71571431-71571453 TAGGTTAAGATGAAGTTTTGAGG - Intergenic
1056501521 9:87214490-87214512 CAGAAAGAAATGAAGTTTTAGGG + Intergenic
1057633970 9:96745914-96745936 TAGGTAGACATGAACTTTGTAGG - Intergenic
1057792665 9:98134396-98134418 CAGGTGGACATGAGTTTTGGGGG - Intronic
1057998971 9:99846429-99846451 CAGGTGGACATGATGACTTGGGG - Intronic
1058165235 9:101611483-101611505 TAGGTAGACATTAATTTTGGGGG + Intronic
1058782907 9:108356487-108356509 CTGGTAGACATGAATTTTGAGGG + Intergenic
1060505779 9:124197590-124197612 CAAGACGACATGAAGTTGTGTGG + Intergenic
1061350974 9:130064638-130064660 CAAGCAGACATGAACTTGTGGGG - Intronic
1062482952 9:136760840-136760862 CAGGTGGGCCTGAAGTTTTGGGG - Intronic
1186399460 X:9243225-9243247 CAGGTGGACATCAATTTTGGGGG + Intergenic
1186646257 X:11510329-11510351 CAGGGAGCCATGAAGAATTGGGG - Intronic
1187549644 X:20289069-20289091 TGGGTAGACATGAATTTTGGGGG + Intergenic
1188967604 X:36574291-36574313 CAGGTAGAATTGAACTTTTCTGG - Intergenic
1189094935 X:38128036-38128058 CAGGAAGGCATGAAGAATTGGGG + Exonic
1192582944 X:72299785-72299807 CAGGGAGACATGGGGTTTTGAGG - Intronic
1193863164 X:86696047-86696069 CAGGTTTACATGATGTTTTAGGG + Intronic
1194647171 X:96471980-96472002 CAGGTGGATATGAATTTTGGGGG - Intergenic
1194843173 X:98770279-98770301 TGGGTAGACATGAAGTTTTGGGG + Intergenic
1195634927 X:107103198-107103220 GAGGTGGACATGAATTTTAGAGG - Intronic
1195934285 X:110110220-110110242 AAGGTATACATGAATATTTGTGG - Intronic
1195973806 X:110502903-110502925 GAGGTAGAGATTAAATTTTGGGG + Intergenic
1195996275 X:110734745-110734767 CAAGTTCACATGAAGATTTGAGG - Intronic
1196127432 X:112114637-112114659 CTGATAGACAGGAGGTTTTGTGG + Intergenic
1198494960 X:137182884-137182906 CAGGTAGACATAGACTTCTGTGG - Intergenic
1198512857 X:137371670-137371692 CAGGAGAACGTGAAGTTTTGGGG + Intergenic
1198677662 X:139147966-139147988 TGGGTAGACATGAATTTTGGTGG + Intronic
1199454546 X:148013700-148013722 CAGGTAGAGGTGAAGATTTTAGG - Intronic
1200382914 X:155858544-155858566 CAGATAGACATAAAGTAATGTGG - Intergenic