ID: 1140526295

View in Genome Browser
Species Human (GRCh38)
Location 16:75625694-75625716
Sequence ACCTGGTGCCATATTTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140526287_1140526295 -5 Left 1140526287 16:75625676-75625698 CCAGCCCCTTCCTGCCTCACCTG No data
Right 1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG No data
1140526286_1140526295 4 Left 1140526286 16:75625667-75625689 CCTGCATGGCCAGCCCCTTCCTG No data
Right 1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG No data
1140526290_1140526295 -10 Left 1140526290 16:75625681-75625703 CCCTTCCTGCCTCACCTGGTGCC No data
Right 1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG No data
1140526289_1140526295 -9 Left 1140526289 16:75625680-75625702 CCCCTTCCTGCCTCACCTGGTGC No data
Right 1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG No data
1140526283_1140526295 24 Left 1140526283 16:75625647-75625669 CCCATAGTAGTGCTCACAGTCCT No data
Right 1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG No data
1140526284_1140526295 23 Left 1140526284 16:75625648-75625670 CCATAGTAGTGCTCACAGTCCTG No data
Right 1140526295 16:75625694-75625716 ACCTGGTGCCATATTTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140526295 Original CRISPR ACCTGGTGCCATATTTCTTT GGG Intergenic
No off target data available for this crispr