ID: 1140528880

View in Genome Browser
Species Human (GRCh38)
Location 16:75647486-75647508
Sequence CCCGGCACAGCAGCCTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 174}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140528875_1140528880 -10 Left 1140528875 16:75647473-75647495 CCGGCAAGAAGGCCCCGGCACAG 0: 1
1: 0
2: 1
3: 11
4: 116
Right 1140528880 16:75647486-75647508 CCCGGCACAGCAGCCTTGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 174
1140528869_1140528880 21 Left 1140528869 16:75647442-75647464 CCACGTCTCAGCATGTGCGTACC 0: 1
1: 0
2: 1
3: 2
4: 29
Right 1140528880 16:75647486-75647508 CCCGGCACAGCAGCCTTGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 174
1140528873_1140528880 -1 Left 1140528873 16:75647464-75647486 CCACGAGAGCCGGCAAGAAGGCC 0: 1
1: 0
2: 0
3: 5
4: 82
Right 1140528880 16:75647486-75647508 CCCGGCACAGCAGCCTTGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 174
1140528872_1140528880 0 Left 1140528872 16:75647463-75647485 CCCACGAGAGCCGGCAAGAAGGC 0: 1
1: 0
2: 0
3: 3
4: 57
Right 1140528880 16:75647486-75647508 CCCGGCACAGCAGCCTTGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 174
1140528868_1140528880 24 Left 1140528868 16:75647439-75647461 CCACCACGTCTCAGCATGTGCGT 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1140528880 16:75647486-75647508 CCCGGCACAGCAGCCTTGGTGGG 0: 1
1: 0
2: 1
3: 13
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140528880 Original CRISPR CCCGGCACAGCAGCCTTGGT GGG Intronic
900013458 1:134401-134423 CCCGGCACAGCTGCAGGGGTAGG - Intergenic
900043526 1:490384-490406 CCCGGCACAGCTGCAGGGGTAGG - Intergenic
900064964 1:725387-725409 CCCGGCACAGCTGCAGGGGTAGG - Intergenic
900313512 1:2046154-2046176 CTGGGCACAGCAGCCGTGGGAGG - Intergenic
900359817 1:2283116-2283138 CCCGGCCCAACCGCCTTTGTCGG + Intronic
900362726 1:2297747-2297769 CCAGGCACAGCTGCCATGATGGG - Intronic
900587017 1:3437500-3437522 CCCTGCACTGCAGCCTTGTGGGG + Exonic
901040387 1:6359745-6359767 CCTGGGAAAGCAGCCCTGGTGGG - Intronic
902754074 1:18537618-18537640 CTGGGAACAGCAGCCCTGGTGGG + Intergenic
902956042 1:19924676-19924698 CTGGGCACATCAGCCTTTGTGGG - Intergenic
903672247 1:25043332-25043354 CCCGGGTCCGCAGCCATGGTTGG + Intergenic
905344818 1:37304138-37304160 CCCGGAACAGGTGCCTTTGTGGG - Intergenic
905926972 1:41758156-41758178 CCGGGGAAGGCAGCCTTGGTTGG - Intronic
906623124 1:47301125-47301147 CACTGCACTCCAGCCTTGGTGGG - Intronic
907009455 1:50949898-50949920 CGCTGCACACCAGCCTGGGTGGG - Intronic
907510251 1:54952703-54952725 CCCTGCACTGCCACCTTGGTTGG + Intergenic
910556573 1:88541255-88541277 CCTAACACAGCAGCCTTGGAGGG - Intergenic
916731325 1:167569466-167569488 CCCTGCAGACCAGCTTTGGTGGG - Intergenic
918399683 1:184151325-184151347 CCCCGAAGAGCAGCCTTGGCAGG - Intergenic
921006061 1:211094658-211094680 TGCTGCACAGCAGCCTTGGTGGG + Intronic
922261898 1:223950894-223950916 CCCGGCACAGCTGCAGGGGTAGG - Intergenic
922536482 1:226384894-226384916 CCAGGCCCAGCAGCCTGGGTAGG - Intronic
922735176 1:227974846-227974868 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
924343068 1:243053071-243053093 CCCGGCACAGCTGCAGGGGTAGG - Intergenic
1066733419 10:38452503-38452525 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
1067222725 10:44355684-44355706 CCCAGCCCTGCAGCCTGGGTGGG - Intergenic
1067469132 10:46523521-46523543 CCCAGCCAGGCAGCCTTGGTAGG + Intergenic
1071526756 10:86363765-86363787 CCCGGCGCCGCTGCCTAGGTGGG + Intronic
1072424648 10:95319963-95319985 GCTGGCAAAGCAGCCATGGTGGG - Intronic
1073316520 10:102585017-102585039 CCAGGCACAGCAGCCTGGCCTGG - Intronic
1076969798 11:126615-126637 CCCGGCACAGCTGCAGGGGTAGG - Intergenic
1077281546 11:1748303-1748325 CCCTTCGCAGCAGCCTTGGCAGG + Intronic
1078722840 11:13899765-13899787 CCTGACACAGCTGCCTTGCTGGG + Intergenic
1080583047 11:33658928-33658950 CAGGGCACAGCAGCAGTGGTGGG - Intronic
1083162124 11:60861018-60861040 CCCAGCTGAGCAGGCTTGGTAGG - Intergenic
1083668896 11:64289611-64289633 CCCAGCCCACCAGCCTTGATGGG - Intergenic
1084316954 11:68351206-68351228 CCCAGCACAGCACCCCTGGGAGG - Intronic
1085454614 11:76658756-76658778 CCTGGCTCAGCAGCCAAGGTGGG + Exonic
1088875910 11:113936086-113936108 CCCGGCCCAGCAGCCATGGGAGG + Intronic
1089080682 11:115773939-115773961 CCTGGCTCAGCAGCCTGGGCTGG - Intergenic
1091321444 11:134655252-134655274 CCAGGCACTCCAGCCCTGGTTGG - Intergenic
1094293558 12:28878770-28878792 GCTGGCAGAGCAGCCATGGTGGG - Intergenic
1097186387 12:57198693-57198715 CCAGGCACAGCAGACTCAGTGGG + Intronic
1098068521 12:66646546-66646568 CCCGGAACATAAGCCTTGCTAGG + Intronic
1098760883 12:74423648-74423670 CCTGGCACAGCAGCTTTAATAGG + Intergenic
1101641124 12:106586362-106586384 CCGGGCAGAGCAGCCCTGATTGG - Intronic
1102063481 12:109953015-109953037 CACTGCACAGCAGCTTTGGCAGG + Intronic
1103560911 12:121793048-121793070 CCCCGCCCTGCAGCCTTGGCAGG - Intronic
1103903229 12:124314419-124314441 CCCTGCACTGCAGCCTGGGCCGG + Exonic
1105063198 12:133172811-133172833 CTCAGCACTGCAGCCTTGGCAGG - Intronic
1107534224 13:41311860-41311882 CCGGGCACAGCCGCCTCGGCCGG + Intronic
1113416077 13:110129704-110129726 CCCAGCGCAGCAGCCCGGGTGGG + Intergenic
1113816394 13:113174532-113174554 CCCTGCACTCCAGCCTTGGGTGG - Intergenic
1114559122 14:23578207-23578229 CCCGGCACAGCATCCATGGCAGG + Exonic
1117042754 14:51781752-51781774 CCCGGCACAGCAACCTTGTGAGG + Intergenic
1119806060 14:77483085-77483107 CCCGACACAGCAGCCCTTGGAGG + Intronic
1120229762 14:81829678-81829700 CCCGGGACAGCAGCTGTGGAGGG - Intergenic
1121007356 14:90498951-90498973 CCCAGCACAGGAGGCGTGGTTGG + Intergenic
1122325324 14:100878207-100878229 ATCCTCACAGCAGCCTTGGTGGG + Intergenic
1122491991 14:102123837-102123859 CCCTGCACTCCAGCCTAGGTTGG - Intronic
1128222608 15:65979786-65979808 CCCTGCCCAGCTGCCATGGTTGG - Intronic
1129108522 15:73324339-73324361 CCTGGCACAGAAGCCTTGGCAGG + Intronic
1129698943 15:77756592-77756614 CCAGGCTCAGCAGCCCTGGTTGG + Intronic
1130023582 15:80251737-80251759 CAGGGGACAGCAGCCTCGGTGGG - Intergenic
1131515432 15:93073442-93073464 CCAGGCCCAGCACCCTTGGGAGG + Intronic
1132532915 16:462489-462511 CCCAGCACCTCAGCCTTGGGAGG - Intronic
1132605113 16:790390-790412 CCCTGCACAGGTGACTTGGTTGG + Exonic
1132991659 16:2798687-2798709 CCCGGCCCAGCCGCCCTGGCTGG - Intergenic
1134118271 16:11565724-11565746 CCCGCCACACCTGCCTTGCTTGG + Intronic
1136516485 16:30771743-30771765 CCCTGGACAGAAGCATTGGTGGG + Intronic
1140261250 16:73382528-73382550 CCCCACACAGCAGCCTGAGTGGG - Intergenic
1140482022 16:75266975-75266997 CCTGGCACAGCATCCCTGGCAGG - Intronic
1140528880 16:75647486-75647508 CCCGGCACAGCAGCCTTGGTGGG + Intronic
1142329729 16:89443904-89443926 CCCGGCACGGCAGCTGTAGTTGG - Intronic
1142450881 16:90172517-90172539 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
1142456685 17:61174-61196 CCCGGCACAGCTGCAGGGGTAGG - Intergenic
1143740842 17:8952950-8952972 CCCTGGACAGGAGCCTTGATGGG + Intronic
1144457365 17:15430175-15430197 TCCGTCACAGCAGACATGGTTGG + Intergenic
1144778320 17:17795874-17795896 TCGGGCACAGCAGGCTTGTTGGG - Exonic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1151686639 17:75651048-75651070 CCCGACACAACAGCCTTTGCAGG + Intronic
1152442396 17:80317002-80317024 CCGGTCACAGCAGCCCAGGTTGG - Intronic
1152739432 17:82012554-82012576 CCCAGCACAGCAGCCCAGGGGGG - Intronic
1157325968 18:46669069-46669091 CCCGAACCAGCAGCCTTGGGTGG - Intronic
1160481004 18:79239463-79239485 CCTGCCACAGCAGACTTGGCTGG - Intronic
1160646601 19:196533-196555 CCCGGCACAGCTGCAGGGGTAGG - Intergenic
1161561890 19:4977903-4977925 CCCGGTCCAGCAGCCTGGCTTGG - Intronic
1163600788 19:18247971-18247993 CCAGGTTCAGCAGCCTGGGTGGG + Intronic
1165818411 19:38658100-38658122 ACAGGCACAGCAGCCTTGCCAGG + Intronic
1167117746 19:47497976-47497998 CCCTGAGCAGCAGCCATGGTTGG + Intronic
1167482918 19:49744239-49744261 GCGGGCACAGTTGCCTTGGTGGG + Exonic
925326011 2:3022643-3022665 CACGGCACGGCAGCCTGGGATGG - Intergenic
926967679 2:18433117-18433139 CTCGGCAAAGGAGCCTGGGTCGG + Intergenic
927493526 2:23536596-23536618 CTCGGCACAGCAGCCTGTGAAGG + Intronic
932837628 2:75051899-75051921 CCTGGAACAGCAGGCTGGGTGGG + Intronic
936556250 2:113500401-113500423 CCCAGCACCGCGCCCTTGGTGGG - Exonic
937318658 2:120947892-120947914 CCCGGCACTGCAGCCTTCCCTGG + Intronic
944320766 2:198339361-198339383 CCAGGCAGAGCAGCCTGGGTTGG + Intronic
945251927 2:207771190-207771212 CCCAGCACAGAACCCTGGGTCGG - Intergenic
947675875 2:231979511-231979533 CCTGGCACAGTGGCCTTGGGAGG - Intronic
948864522 2:240768560-240768582 CATGGCACAGCAGCCCAGGTGGG - Intronic
1171346608 20:24470221-24470243 CCCGGCTCACCAGCCCTGGCTGG - Intronic
1172108822 20:32533371-32533393 CCCAGCACATCAGATTTGGTAGG - Intronic
1172710677 20:36920719-36920741 CCCTGCACTCCAGCCTGGGTGGG + Intronic
1173083845 20:39895663-39895685 CCCAGGACACCAGCCTTGGAGGG + Intergenic
1173387995 20:42606281-42606303 CCTACCACATCAGCCTTGGTAGG - Intronic
1173873974 20:46358224-46358246 CCTGGCACGGCAGGCTTGGAGGG + Intronic
1174087721 20:48020762-48020784 CCGGGAAGGGCAGCCTTGGTGGG + Intergenic
1176278905 20:64289689-64289711 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
1179152076 21:38817752-38817774 CTCGGAACAGCAGGCTTGGGTGG + Intronic
1179537544 21:42062124-42062146 CTCGGCACAGCAGCCTTAGCAGG - Intergenic
1180937990 22:19638510-19638532 GCCAGCACAGCACCCTGGGTAGG - Intergenic
1181590543 22:23882528-23882550 CCGGGCACGGCAGCCCTGGCAGG - Exonic
1181775299 22:25154833-25154855 CCCTGCAGAGCAGCCTTGCATGG - Intronic
1182787235 22:32917963-32917985 CCCAGCAGAGCAGCCTTGGAGGG - Intronic
1183294704 22:37022688-37022710 CTAGGCACCGCAGCCTTGGGCGG - Intronic
1183668963 22:39260947-39260969 CTCTGAACAGCAGCCTTGGCAGG - Intergenic
1183669181 22:39262358-39262380 CCCTGCACAGCAGCCCAAGTGGG + Intergenic
1184969199 22:48003152-48003174 CCATGCACAGCAGCCTTTGCAGG - Intergenic
1185210898 22:49569989-49570011 CCCTGCAGAGCAGCCCTGGAGGG - Intronic
950401011 3:12769089-12769111 CCCGGGACAGCAGCTGTGGAGGG - Intronic
954810495 3:53244293-53244315 CTCGGCAGAGCATCCTGGGTTGG + Intronic
955681356 3:61505336-61505358 CCCGGGACAGAATTCTTGGTGGG - Intergenic
961332486 3:126150913-126150935 CCCAGCACAGCACCCCTTGTGGG - Intronic
961678811 3:128584754-128584776 CCTTGCACAGCAGCCTGGCTGGG - Intergenic
962281469 3:134055073-134055095 CCCTCCACAGCAGCCTTGGCTGG - Intergenic
963960005 3:151299296-151299318 CAGGGCACAGCTGCCTAGGTCGG + Intronic
966911660 3:184563093-184563115 CCCCCCACAGCAGTCTTGGCAGG - Intronic
966926423 3:184647490-184647512 CCAGGCACAGAAGCCTGGCTTGG + Intronic
967804872 3:193707026-193707048 CCCTGCACTCCAGCCTGGGTGGG - Intergenic
968371080 3:198222989-198223011 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
968446663 4:655558-655580 CCCAGCACGGCAGCCTGGGGAGG + Intronic
968573368 4:1353895-1353917 CTTGGCACTGCAGCCTGGGTGGG + Intronic
969666527 4:8560521-8560543 CGCAGGACAGGAGCCTTGGTTGG + Intronic
975509738 4:75181061-75181083 CACAGCACAGAAGCCATGGTAGG + Intergenic
975895469 4:79084803-79084825 CACTGCACTGCAGCCTGGGTGGG + Intergenic
979259764 4:118635473-118635495 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
982668266 4:158291968-158291990 CCCCGCTCAGCAGCCTGGCTGGG - Intergenic
983119999 4:163871465-163871487 CCCCACACAGCACCCTTAGTGGG - Intronic
985870056 5:2547244-2547266 CCCGGCAGGCCAGGCTTGGTAGG + Intergenic
986928972 5:12794967-12794989 GCCGGCACAGCAGCCATGAAGGG - Intergenic
987255401 5:16145259-16145281 CCCAACACAGCAGGGTTGGTAGG + Intronic
989339276 5:40355341-40355363 CCAGGCACACCAGCTGTGGTGGG - Intergenic
995988437 5:118208182-118208204 CCCGGGCCAGCAGCTGTGGTGGG - Intergenic
997091543 5:130864428-130864450 CCCCACACAGAATCCTTGGTGGG - Intergenic
997195638 5:131977380-131977402 CCAGGCACAGCAGGCTGGGAAGG + Intronic
997295853 5:132767917-132767939 CCAGACACAGCTGACTTGGTGGG - Intronic
999328295 5:150656803-150656825 CCCGGCACAGCAGCCGAGCCGGG - Intronic
1002074121 5:176698022-176698044 CCCAGCACAGCAGCCTTGGGAGG + Intergenic
1002730317 5:181328545-181328567 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
1003126335 6:3358917-3358939 TCGGGCACAGCATCCTGGGTGGG + Intronic
1013590598 6:111616574-111616596 GAAGGCACAGCAGACTTGGTGGG - Intergenic
1014770379 6:125452974-125452996 CCTGGGTCAGCAGCCTTGGCTGG - Intergenic
1019015962 6:168879296-168879318 GTAGGCACAGCAGCCCTGGTAGG - Intergenic
1019097028 6:169590577-169590599 CCCGCCACACCAGCCATGGGAGG + Intronic
1019137496 6:169919934-169919956 CCAGGCACTGCTGCCTTGGGCGG - Intergenic
1019282931 7:209635-209657 CCCAGCCCAGCAGCCTTCCTGGG - Intronic
1019411892 7:910286-910308 CCCTGCACTCCAGCCTGGGTGGG - Intronic
1019667306 7:2258313-2258335 CCTGGCCCAGCAGTCTTGATGGG + Intronic
1020128522 7:5546535-5546557 ATGGGCACAGCAGCCTTGGGAGG - Intronic
1023401489 7:39795095-39795117 CCCTGCACAGCAGCAGGGGTAGG + Intergenic
1024632608 7:51262131-51262153 CACCGCACAGCAGCCCTGGCTGG + Intronic
1024648126 7:51385583-51385605 CCCAGCACAGCAGCAGGGGTAGG - Intergenic
1025224366 7:57143955-57143977 GACATCACAGCAGCCTTGGTTGG + Intergenic
1025694467 7:63767764-63767786 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
1026795217 7:73361988-73362010 CCCAGCACAGCGGCCTGGGGAGG + Intergenic
1031404555 7:121369016-121369038 CACTGCACTGCAGCCTGGGTGGG - Intronic
1032051988 7:128655464-128655486 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
1035207927 7:157306790-157306812 CCCTGCAAAGCATCCTTTGTGGG - Intergenic
1036772646 8:11589689-11589711 GCCCGCACAGCAGCCGTGGGGGG + Intergenic
1037681425 8:21100865-21100887 CCTGTCACAGCAGCCATGGCTGG + Intergenic
1038207293 8:25478636-25478658 CCAGCCACAGCAGCCTTGCTGGG + Intronic
1041524008 8:58785693-58785715 CGCATCACAGAAGCCTTGGTAGG - Intergenic
1049664066 8:143835360-143835382 CCCGGCCAGGCAGCCTGGGTAGG + Exonic
1049896776 9:116963-116985 CCCAGCACCGCGCCCTTGGTGGG + Exonic
1053347537 9:37388899-37388921 CCTGGCACAGCTGCCTTAGGAGG - Intergenic
1053739872 9:41127162-41127184 CCCAGCACCGCGCCCTTGGTGGG + Exonic
1054442839 9:65283159-65283181 CCCAGCACCGCGCCCTTGGTGGG + Exonic
1054487439 9:65738342-65738364 CCCAGCACCGCGCCCTTGGTGGG - Exonic
1054688478 9:68304151-68304173 CCCAGCACCGCGCCCTTGGTGGG - Exonic
1057414248 9:94847220-94847242 CCCTGCACTGCAGGCATGGTGGG - Intronic
1062091507 9:134680925-134680947 CCTGGCACTGCAGCCTCGGGGGG + Intronic
1062754729 9:138281059-138281081 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
1203578636 Un_KI270745v1:25219-25241 CCCGGCACAGCTGCAGGGGTAGG + Intergenic
1185466514 X:358244-358266 ACAGGCTCAGCAGCCTTGGCGGG + Intronic
1190939616 X:55027810-55027832 GCTGTCACAGCAGCCTGGGTTGG + Intronic
1193080102 X:77398217-77398239 CACAGCACACCAGCCTGGGTGGG + Intergenic
1196004806 X:110824136-110824158 CCCTTCCCAGCAGCCTTGGTGGG - Intergenic
1199360510 X:146912342-146912364 ACCTTCACAACAGCCTTGGTGGG + Intergenic