ID: 1140533186

View in Genome Browser
Species Human (GRCh38)
Location 16:75684364-75684386
Sequence GTGGAGGGAAGGTGTTTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 283}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140533180_1140533186 13 Left 1140533180 16:75684328-75684350 CCCTGCGTTCAGGGTTTTGGAAA 0: 1
1: 0
2: 0
3: 16
4: 135
Right 1140533186 16:75684364-75684386 GTGGAGGGAAGGTGTTTAAATGG 0: 1
1: 0
2: 2
3: 19
4: 283
1140533181_1140533186 12 Left 1140533181 16:75684329-75684351 CCTGCGTTCAGGGTTTTGGAAAG 0: 1
1: 0
2: 0
3: 2
4: 101
Right 1140533186 16:75684364-75684386 GTGGAGGGAAGGTGTTTAAATGG 0: 1
1: 0
2: 2
3: 19
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140533186 Original CRISPR GTGGAGGGAAGGTGTTTAAA TGG Intronic
900532096 1:3159559-3159581 GTGGAGATGAGGTCTTTAAAGGG - Intronic
900740418 1:4327608-4327630 CTAGAGGGAAGGTGTTTTGATGG - Intergenic
901635492 1:10668379-10668401 GTGGCGGGAAGGAGATGAAAGGG - Intronic
901862231 1:12081689-12081711 GTGGCTGGAAGGTGGATAAATGG - Intronic
901876404 1:12169230-12169252 GTGGATGGAAGGTGTCTTCAGGG + Intronic
903172122 1:21560848-21560870 CTGGAGGAAGGGTGTTTAAAAGG + Intronic
903193985 1:21671470-21671492 GTAGAGAGATGGTGCTTAAAAGG - Intergenic
903961502 1:27060664-27060686 GTTGAAGGAAGGGGTTTAATCGG - Intergenic
904432848 1:30476327-30476349 GTAGAGGGAAGGTCTTTTAGGGG - Intergenic
904569236 1:31448722-31448744 GTGGAGGTAAGCTGGTGAAAGGG + Intergenic
905338532 1:37262118-37262140 TTGGATGGAAGGTGGTCAAACGG - Intergenic
905973832 1:42161617-42161639 GTGGAGGGGAAGTGTCTCAAGGG - Intergenic
906881019 1:49590701-49590723 GTTGTGGGAAGGTTTTGAAATGG - Intronic
908082050 1:60591079-60591101 ATTGAGGGAAGATGTTGAAAGGG - Intergenic
908492106 1:64655473-64655495 GTGGAGGTTGGGAGTTTAAAAGG + Intronic
908594797 1:65675894-65675916 GTGGTGGGATGGTGTTCAAAGGG + Intergenic
908884342 1:68770549-68770571 GTGGATGGAGGGTGTATAGAGGG - Intergenic
910363751 1:86441661-86441683 GTGTATGGAAGGCTTTTAAAAGG + Intronic
912147662 1:106813584-106813606 GTGGAGAGAAGCTCTATAAAGGG + Intergenic
912748582 1:112266790-112266812 GTGGAGGGAATGTGATTGACAGG + Intergenic
913435763 1:118845869-118845891 ATGGAGAGATGGTGGTTAAAAGG - Intergenic
915129801 1:153688422-153688444 GTGGAGGGAAGGGGCATGAATGG - Intronic
916406855 1:164506546-164506568 GTTCTGGGAAGCTGTTTAAAGGG + Intergenic
918584237 1:186167389-186167411 GTGGAGGGAAGGGGTTATATAGG - Intronic
918733460 1:188028145-188028167 GTAGAGGAAATGTGTTTATAAGG + Intergenic
919079629 1:192854648-192854670 GAGGAGGGAGGATGTTTATATGG + Intergenic
919097329 1:193053775-193053797 GAGGGGGGAAGGTTTTAAAATGG + Intronic
919333928 1:196208143-196208165 ATGGAGGCAAGGTTTATAAATGG + Intergenic
919924850 1:202186917-202186939 GTGGAGGGAAGGTTTCTCAGTGG + Intergenic
920156569 1:203956779-203956801 GAGGAGGGAAGGTCTTTTATTGG + Intergenic
920931867 1:210396178-210396200 GAAGAGGGGAAGTGTTTAAAAGG - Intronic
923544060 1:234911411-234911433 GTGGAGGGAAAGTATTAGAAAGG + Intergenic
924393229 1:243586725-243586747 GAGGAGGGGAGGGGTTAAAAAGG + Intronic
924744538 1:246819338-246819360 GGGGAGGGGAGGTGTTACAATGG - Intergenic
924898928 1:248373598-248373620 GTGGAGGGAAGGGGTTTTTTAGG + Intergenic
1064837233 10:19547015-19547037 TTTGAGGGAAGGTGTTTTGAAGG + Intronic
1064980648 10:21163127-21163149 CTGGAGAGAAGGAGGTTAAATGG + Intronic
1065476887 10:26148206-26148228 TTGGAGGGAAGGATTATAAAGGG - Intronic
1066494850 10:35932830-35932852 CTGGAGGGAAGGTATTGGAACGG - Intergenic
1066647545 10:37625010-37625032 CTGGAGGGAAGGTATTGGAACGG + Intergenic
1066995100 10:42555887-42555909 GTGGAGGAATGGTGTTAGAAGGG - Intergenic
1068810272 10:61247866-61247888 ATGGAGGGAAGTTGGATAAATGG - Intergenic
1069018216 10:63455309-63455331 GTGGAGGAAACATGTTTGAATGG - Intronic
1070056614 10:72941153-72941175 GTGGAAGGTAGGTGTCTCAATGG - Exonic
1071115196 10:82210469-82210491 GTGGAGGGCAGGGGGTTGAATGG + Intronic
1071690592 10:87815710-87815732 GTGGAGGTGAGGGGTATAAAAGG - Intronic
1074726052 10:116311184-116311206 GTGTAGGGGAGGTTTTGAAAAGG - Intergenic
1074888793 10:117717684-117717706 GTGGAGGGAAGGGGATGGAAAGG - Intergenic
1074970575 10:118533162-118533184 GTGGTGGGATGGTGGTTAGAGGG + Intergenic
1079722767 11:23839651-23839673 TTAGATGGAAGGTATTTAAAAGG + Intergenic
1080008288 11:27432248-27432270 GGGGAGAGAAGGTGTTCAAGTGG - Intronic
1080052104 11:27868679-27868701 GGGGAGGGAAGGTGTTGGGAAGG - Intergenic
1080439574 11:32279165-32279187 ATGAATGGAAGGTTTTTAAATGG + Intergenic
1081093216 11:38898941-38898963 GTGGAGGTAAGTTATTTATAAGG - Intergenic
1081222663 11:40480937-40480959 GTGGGGAGAGGTTGTTTAAAGGG + Intronic
1083534338 11:63454625-63454647 GAGGAGGGGAGGTGATAAAAAGG - Intergenic
1086008802 11:82073236-82073258 GTGGAGGGAAGGAAATGAAAGGG - Intergenic
1087340504 11:96899724-96899746 GAGGAGGGAAAATGTTTAATAGG - Intergenic
1088369791 11:109076657-109076679 GTGGAGGGAAGGAGACAAAAGGG - Intergenic
1089028700 11:115299534-115299556 ATGGTGGAAAGATGTTTAAAAGG + Intronic
1089894031 11:121909333-121909355 TTGGAAGGAAGGTATTGAAATGG + Intergenic
1090295664 11:125585527-125585549 ATGGAAGGAGGGTTTTTAAATGG + Intergenic
1090393613 11:126405428-126405450 AGGGAGGGAAGGTGTTTAAATGG - Intronic
1090445761 11:126763448-126763470 GTGGGTGGGAGGTGTTAAAAAGG + Intronic
1091805348 12:3352160-3352182 GTGGAGAGAGGGTCTTCAAAAGG - Intergenic
1093411140 12:18868521-18868543 GGGGAGGGAAGGGATTTACAGGG + Intergenic
1094308509 12:29050210-29050232 GTGAAGAGAAGTTGGTTAAATGG + Intergenic
1096284203 12:50283892-50283914 GTGCAGGGAGGGTGTTTTACAGG + Intergenic
1096849001 12:54423517-54423539 GTGGATGGAAGATGTTTACTAGG + Intergenic
1096996650 12:55842450-55842472 GTGGAGGTAAGCAGGTTAAAAGG + Intronic
1099102342 12:78458598-78458620 GTGGAGGGAGGGAGTTAGAAAGG + Intergenic
1099830778 12:87839647-87839669 GTGGAGGGTAGGTGTTTTGGTGG + Intergenic
1100028168 12:90153779-90153801 GTGGAGGGGATGTGTTTCACTGG - Intergenic
1101141234 12:101797970-101797992 GTGAAGGGAAGGTGTTCCCAAGG - Intronic
1101311084 12:103579983-103580005 GGGGAGGGAAGATGCTGAAAGGG + Intergenic
1102403296 12:112649953-112649975 TTGGAGATAAGGTCTTTAAATGG - Intronic
1102828088 12:115967893-115967915 CTGGAAGGAAGGGGTTTTAAGGG - Intronic
1102992943 12:117327805-117327827 TTGGAGGGAAGGGGCTTAAAGGG + Intronic
1105698438 13:22914729-22914751 GTGGAGGGAAGGATTACAAAGGG + Intergenic
1105850100 13:24326969-24326991 GTGGAGGGAAGGATTACAAAGGG + Intergenic
1106506655 13:30376350-30376372 GTGGAGGGAAGGGGGTTAGGGGG + Intergenic
1106896395 13:34307341-34307363 GGAAAGGGAAGGTGGTTAAAGGG + Intergenic
1107222540 13:38002397-38002419 ATGAAGGAAAGGTGGTTAAAGGG - Intergenic
1108202624 13:48058107-48058129 GAGGAGGGGAGGTGATAAAAAGG - Intronic
1110276682 13:73648904-73648926 TTGGAGGGAAGGAGTACAAATGG + Intergenic
1110892687 13:80709638-80709660 AAGGAGGGAATGTGATTAAAGGG + Intergenic
1111121558 13:83858109-83858131 GTGAATGGAAGGTGTGGAAATGG - Intergenic
1112695615 13:101944894-101944916 GTGGAGAGTAAGTGTTTAATGGG + Intronic
1113648049 13:112012770-112012792 TGGGAGGCATGGTGTTTAAAGGG - Intergenic
1113770415 13:112904609-112904631 TTGGAGGGAAGCTGCCTAAAGGG - Intronic
1114760331 14:25307338-25307360 GTGTAGGAAATGTGTATAAATGG + Intergenic
1114979220 14:28141658-28141680 GAGGAGGAAAGGAGTTGAAATGG + Intergenic
1118112351 14:62735752-62735774 TTGGAGGTAAGGTCTTTACAGGG + Intronic
1118890805 14:69907089-69907111 GTAGAGGGAAGGAGGTTTAATGG + Intronic
1119960439 14:78849691-78849713 GTGGAGGGAAGGAGTGGAATTGG + Intronic
1120844935 14:89117250-89117272 GTGGAGGGGAGGGGAATAAAGGG - Intergenic
1121225361 14:92317907-92317929 GTAGGTGGAGGGTGTTTAAAGGG + Intergenic
1121674505 14:95741474-95741496 TTGGAGGGCAGGTTTTAAAAGGG - Intergenic
1123401228 15:19988892-19988914 GAGGAGGAAAGGTGTAGAAAGGG - Intergenic
1124834822 15:33186299-33186321 TTGGTGGTCAGGTGTTTAAAGGG - Intronic
1125243879 15:37611171-37611193 GTTGAGGGGATGTTTTTAAACGG - Intergenic
1125271916 15:37948864-37948886 GTGGTGGGAAGATGTGTCAAGGG + Intronic
1127293994 15:57593772-57593794 CTGGAAGGAAGGTATCTAAAGGG + Intronic
1127666612 15:61153948-61153970 CTGCAGGCAAGGTGTCTAAATGG - Intronic
1134438649 16:14284280-14284302 GGGGAGGGGAGGTGTTTATTGGG - Intergenic
1136042716 16:27593215-27593237 GTGGGGGGTGGGTGTTTAAGGGG - Intronic
1138295074 16:55878884-55878906 GTGCAGTGATGGTGGTTAAATGG - Intronic
1138821731 16:60268747-60268769 GTGGAAGAATGGTGCTTAAAGGG - Intergenic
1140220351 16:73039364-73039386 CTGCAGTGAAGGTGTCTAAATGG + Intronic
1140533186 16:75684364-75684386 GTGGAGGGAAGGTGTTTAAATGG + Intronic
1140599244 16:76455544-76455566 GTGGAGAGCAGAAGTTTAAAGGG - Intronic
1140689447 16:77467627-77467649 TTGGAGGGAAAGAGTTTAATAGG - Intergenic
1141448882 16:84083254-84083276 GTGGAGGGAAGGTGGATAGTGGG - Intronic
1141759649 16:86019531-86019553 GTGGAGGGAGGGTCCTAAAATGG + Intergenic
1142903807 17:3029342-3029364 GTGGAGAAAAGGTGTGTAAGAGG - Intronic
1143045422 17:4075001-4075023 GTAGAGGTAAGGTCTTTGAAGGG - Intronic
1143588589 17:7865801-7865823 GTGGAGGGGTGGTCTTTGAAGGG + Intronic
1144019199 17:11225004-11225026 TTGGAGGGAAGTGGTATAAATGG + Intergenic
1144292930 17:13843817-13843839 GTGGAGAGAATGGGTTTTAATGG + Intergenic
1147526764 17:41232405-41232427 TTGGAGGCCAGGTGTATAAAAGG + Intronic
1147527270 17:41237955-41237977 TTGGAGGCCAGGTGTATAAAAGG + Intronic
1147528390 17:41249624-41249646 TTGGAGGCCAGGTGTATAAAAGG + Intronic
1147530399 17:41271214-41271236 TTGGAGGCCAGGTGTATAAAAGG + Intergenic
1148498503 17:48070663-48070685 GAGGAGGGAAGGTCTTTTATTGG - Exonic
1149380561 17:56089093-56089115 GTGGAGGAGAGGATTTTAAAAGG + Intergenic
1150633101 17:66894080-66894102 GTGGCGGGATGGTGTTTACGAGG - Intergenic
1150765047 17:67995818-67995840 GAGGAGGGAAAGTGTCAAAAGGG - Intergenic
1150899629 17:69257534-69257556 GTGGATGGAAGGTGAGTAACTGG + Intronic
1150988742 17:70230331-70230353 GTGTAGGTAAGGTGTCAAAAGGG + Intergenic
1151179445 17:72315968-72315990 CTGGAGGGAAGGAGTTGAACAGG - Intergenic
1151394536 17:73813480-73813502 GGAGAAGGAAGGTGCTTAAAGGG - Intergenic
1152369971 17:79880706-79880728 TTGGAGGGAAGGTGGGAAAATGG + Intergenic
1153074233 18:1144343-1144365 CTGGAGGGGAGGTCTATAAATGG - Intergenic
1157515308 18:48306987-48307009 GTGGAGGGAAGGTGGTAAGGAGG - Intronic
1157604640 18:48918244-48918266 AGGGAGGGAAGGTGTTTCACTGG - Intergenic
1157688115 18:49659195-49659217 GGGTAGGGAAGTTATTTAAAAGG - Intergenic
1157943328 18:51953136-51953158 GTGGAGAGAGGGATTTTAAAAGG - Intergenic
1159224545 18:65515366-65515388 ATGGAGAGAAGTTGATTAAAGGG + Intergenic
1160005729 18:75067887-75067909 GTGGATGGAAGATGACTAAAAGG + Intergenic
1160005744 18:75067937-75067959 GTGGATGGAAGATGGCTAAAGGG + Intergenic
1160005770 18:75068068-75068090 GTGGATGGAAGATGGCTAAAAGG + Intergenic
1160380359 18:78450145-78450167 TTGAAGGGAAGGCATTTAAAGGG - Intergenic
1161590471 19:5127085-5127107 GTGGAGGGAAGGTGTCACAGCGG - Intronic
1161791365 19:6362047-6362069 GGGGAGGGAAGGGGGTTAGAAGG - Intronic
1162103076 19:8352432-8352454 GAGGAGGGAAGTTGTTTAAGAGG - Intronic
1162249496 19:9430360-9430382 GTTCAGGAAAGGTCTTTAAAAGG - Intronic
1162929863 19:13952494-13952516 GTGGAGGGAGGGGGTGAAAATGG + Exonic
1167250140 19:48395021-48395043 GTGGAGGGAGGGGGTTTGAACGG + Intronic
1168700322 19:58434928-58434950 GTGGAGGGAAGCCCTTTAGATGG - Exonic
931907002 2:66853437-66853459 GCAAAGGGTAGGTGTTTAAAGGG + Intergenic
932240438 2:70152137-70152159 GTAGAGGGAAGGAATTTAAAAGG - Intronic
932395564 2:71445014-71445036 TTGGGGGGGAGGTGTATAAACGG + Intergenic
932913512 2:75830332-75830354 GTGGAGACAAGATATTTAAAGGG + Intergenic
934205605 2:89927021-89927043 GAAGAGGGAAGTTGTCTAAAAGG - Intergenic
935643788 2:105315744-105315766 GTTGCTGGAAGGAGTTTAAAAGG + Intronic
935859390 2:107311668-107311690 ATGGAGAGAACGTGTTAAAAGGG - Intergenic
935938728 2:108216089-108216111 GTGTGGGGAAGGTGTTCACAAGG - Intergenic
935954159 2:108358641-108358663 GTGGAGCGCAGGTGTAGAAAAGG - Intergenic
938983140 2:136545847-136545869 GTGCAGGGAAGGCTTTTCAAAGG - Intergenic
940102725 2:150060484-150060506 GTTTAGGGAAGGCCTTTAAATGG - Intergenic
942097011 2:172543456-172543478 GAGGAGGGGAGGTGATAAAAAGG - Intergenic
942682041 2:178487113-178487135 GTGGAGGGAAAGTTACTAAAAGG + Intronic
943450056 2:188034948-188034970 GAGGAGGGGAGGTGATAAAAGGG - Intergenic
945141809 2:206694686-206694708 CTGGAGGGAAGGTTTTTTCATGG + Intronic
946957452 2:224946922-224946944 TTCGAGGGAAGGTTTTTAAACGG - Intronic
947708547 2:232295592-232295614 GTGTACTGAAGGTGTTTGAAGGG - Intronic
948995988 2:241579045-241579067 GTGGGGGGATGGTGTTGAACGGG + Intergenic
1172013610 20:31860773-31860795 GTGGAGGAGAGGGGTTCAAAAGG + Intronic
1174899579 20:54484492-54484514 TTGGGGGGAAAGTGGTTAAAGGG - Intronic
1177295172 21:19163790-19163812 GGGGAGGGATGGTCTTTAGAGGG + Intergenic
1178516464 21:33251774-33251796 GAAGAGGCAAGGTGTTTAAAGGG + Intronic
1178797528 21:35758662-35758684 ATGAAGAGAAGGTGGTTAAAGGG + Intronic
1179332322 21:40415825-40415847 GTTGGGGGAAGGTGTGTATAGGG - Intronic
1181863825 22:25839995-25840017 GGGCAGGGAAGGTATCTAAAGGG - Intronic
1183389323 22:37535990-37536012 TTGGAGATAAGGTCTTTAAAGGG + Intergenic
1184469427 22:44687713-44687735 GTGGAGAGAGGGTGTTGAGACGG - Intronic
949903622 3:8839919-8839941 TTGGAGGCAAGGTGTGTAGAGGG + Intronic
950443953 3:13025462-13025484 GTGGAGGGACAGTGTTGAAGGGG + Intronic
954255254 3:49400731-49400753 GTGGGGGGATGGTATATAAAAGG + Intronic
955148542 3:56344302-56344324 GAGGAGGGAAGGTGTTTGCCAGG - Intronic
956806807 3:72822371-72822393 CAGGAGGGCAGGTGGTTAAAAGG + Intronic
956977000 3:74592313-74592335 GTGGAGTAAAGGAGTTTAACAGG + Intergenic
957895724 3:86419209-86419231 GCTGAGTGATGGTGTTTAAAAGG - Intergenic
960500855 3:118436732-118436754 GTGGAGAGAAGGGGATAAAAAGG + Intergenic
961408271 3:126698834-126698856 GGGGAGGGAAGGTGTTGTGACGG - Intergenic
961974900 3:131013225-131013247 CTGTAGGGAAGAAGTTTAAAAGG - Intronic
962575985 3:136755486-136755508 GTAGAGGGAAGGTGGGTCAATGG - Intergenic
963823814 3:149929796-149929818 GTGGAGCAAAGGTGATTCAAGGG - Intronic
964254382 3:154759435-154759457 GTGGTGGGCAGAGGTTTAAATGG - Intergenic
964411325 3:156400757-156400779 GTGGAGAGAAGGTGTTCACTAGG - Intronic
964835229 3:160930671-160930693 GCGGAGTGAAGGAGTTTAAGAGG + Intronic
965440521 3:168707387-168707409 GGGGAGAAAAGGTGTTCAAACGG - Intergenic
965548062 3:169935368-169935390 GTGGAGAGATCGTCTTTAAATGG + Intronic
967951944 3:194847996-194848018 GTGGAGTGAAGGGCTTTAAAAGG - Intergenic
969307816 4:6335754-6335776 GGGGAGGGAAGCTGCTTACAGGG + Intronic
969537168 4:7763502-7763524 GTGATGGAAAGGTGTTTGAAAGG - Exonic
969608305 4:8213089-8213111 GTGGAGGGCAGGTGGAGAAAGGG - Intronic
969962544 4:10959758-10959780 GTGGAGGAAAGATATTTATAAGG + Intergenic
970323878 4:14903086-14903108 GTGGTGGGAAGGTTTTTAATGGG + Intergenic
970471229 4:16381253-16381275 GTGGATGGAAAATGTCTAAAAGG + Intergenic
970532649 4:16999398-16999420 GAGGAGGGGAGGTGATAAAAGGG - Intergenic
970968719 4:21956989-21957011 GTGTAGGGAAGATGTTAACAGGG + Intergenic
975370911 4:73586412-73586434 GTAGGCAGAAGGTGTTTAAATGG + Intronic
976455791 4:85245910-85245932 GTGGAGAGAAGGAGTTTAACAGG - Intergenic
976616381 4:87081703-87081725 TGGGAGTGAAGGTGTTTCAAAGG - Intronic
978877307 4:113657064-113657086 GTGGATGGAAGATTTTTAAGAGG - Intronic
979492002 4:121338878-121338900 GAGGAGGGGAGTTATTTAAAAGG - Intronic
982154081 4:152498056-152498078 GGGGAGGGAAGAACTTTAAAAGG + Intronic
982269598 4:153572845-153572867 GCTGAGGGAAGGTGTTTAATGGG - Intronic
982685789 4:158487175-158487197 GTGGGGGGAAGGCTTTTATAAGG - Intronic
982801849 4:159715690-159715712 TTGTAGGTAAGGTCTTTAAAGGG + Intergenic
983281037 4:165681050-165681072 GTGGAGGAAAGGAGTTCAAAGGG + Intergenic
985022084 4:185702280-185702302 GTGGAGGGGAGAAGGTTAAAGGG + Intronic
986614429 5:9601973-9601995 TTGGAGGTAAGCTCTTTAAAGGG + Intergenic
986994239 5:13588227-13588249 GTGGAGGTAATGTTTTTTAATGG - Intergenic
987264502 5:16238009-16238031 TAAGAGGGAAGTTGTTTAAATGG - Intergenic
988420711 5:31002428-31002450 TTGGAGAGGATGTGTTTAAAAGG - Intergenic
989373626 5:40735970-40735992 TTGGAGAGAAGCTTTTTAAATGG + Intronic
989697832 5:44224622-44224644 GTAGAGGGAAGGTGGTCGAAGGG + Intergenic
990285008 5:54292409-54292431 GTGGAGGGCAGGAGTTTCAGTGG - Intronic
990901811 5:60759439-60759461 GAGGAGTCAAGGTGCTTAAAAGG + Intronic
993602870 5:89950363-89950385 GTGGAGTGCAGGAGTTGAAATGG + Intergenic
994455581 5:100002745-100002767 GTGGAGGGATTGTATATAAAAGG + Intergenic
996497361 5:124175038-124175060 GTGTGGGGAAAGTGTTTAAGAGG - Intergenic
999393052 5:151208377-151208399 GGGGAGGGAAGATGTATCAAGGG + Intronic
999748379 5:154608939-154608961 GAGGAGGGAAGGGGTCTGAAAGG - Intergenic
1001932393 5:175682700-175682722 GTGGAGGGCAGGAGCTGAAAAGG - Exonic
1003497505 6:6677311-6677333 GTGGCAGGAAGGTGTGGAAAGGG + Intergenic
1006210328 6:32388006-32388028 GAGGAGGGGAGGCGTTTGAAGGG + Intergenic
1007335196 6:41150633-41150655 GGGGAGGGAAGGAGATTCAATGG - Intronic
1007605843 6:43117425-43117447 GTGGAGGGAATGTGGGTAACAGG + Intronic
1008954730 6:57202294-57202316 GTGGGGGAAAGGTGTTTTTAGGG - Intronic
1009313909 6:62193554-62193576 GTGAAGGGGACATGTTTAAAGGG - Intronic
1010095967 6:72046334-72046356 GTTGGGGGAAGGTGTTGACATGG + Intronic
1011957585 6:93042076-93042098 GTCTAGGAAATGTGTTTAAATGG - Intergenic
1012469726 6:99557483-99557505 TTGGAGAGAGGGTCTTTAAAGGG + Intronic
1013053549 6:106561036-106561058 GGGCAGGGAAGGAGTTTATAGGG - Intronic
1016248788 6:142017547-142017569 GAGGAGGGGAGGTGATAAAAAGG - Intergenic
1018054255 6:160038105-160038127 GGGGAAGGAAGGTTTTCAAATGG - Intronic
1018719371 6:166561255-166561277 ATGGAGGGAAGGTCTTGAAATGG - Intronic
1019978561 7:4604565-4604587 GTTGTGGGAAGGTGTTTTGAAGG - Intergenic
1020475216 7:8586286-8586308 GTGGAGGGAGGTTGTATAAATGG + Intronic
1021176813 7:17459101-17459123 CTGGGGGGAAGGTCTATAAATGG - Intergenic
1021904859 7:25323060-25323082 ATGGAGGGGAGCTGCTTAAAGGG + Intergenic
1024777460 7:52804178-52804200 GTGGAGGAAAGGTGTTAAATAGG + Intergenic
1024941124 7:54764440-54764462 GTGCAGGGAGGATGTGTAAAAGG + Intergenic
1024984439 7:55183015-55183037 CTGGAGGCCAGGTGTCTAAAAGG + Intronic
1027941719 7:84690845-84690867 GGGGTAGGAAGGTGTTGAAATGG + Intergenic
1028318921 7:89436818-89436840 GTGGGGGGAAGGTGTTTAGATGG - Intergenic
1029363573 7:100103353-100103375 GTGGAGGGAAGGGGTAAAGAGGG - Intronic
1030441767 7:109596025-109596047 GAGGAGGGGAGGTGATAAAAAGG + Intergenic
1032211068 7:129914476-129914498 CTGGAGGGGAGTTGTTTAAAAGG - Intronic
1033013746 7:137650528-137650550 TAGGAGGTAAGGTGTTTGAAAGG + Intronic
1033642939 7:143279801-143279823 GTGTAAGGAAGGTGGATAAATGG - Intergenic
1034539085 7:151744688-151744710 ATGGAGGGAGGGTGGTTACACGG - Intronic
1034898838 7:154895007-154895029 GTGGAGAGGAGGAGTTAAAAAGG + Intergenic
1036726403 8:11224651-11224673 CTGGAGGTAAGGTGTTGATATGG - Intergenic
1037512206 8:19594897-19594919 CTGGAGGGTAGGTATATAAAAGG - Intronic
1037723159 8:21461767-21461789 GGGGTGGGCAGGTGTATAAAAGG - Intergenic
1039558131 8:38491526-38491548 GTGGAGACAAGGTCTTTTAAGGG - Intergenic
1041255055 8:55972785-55972807 GTGGGGGGAAGGTATAGAAAAGG - Intronic
1041857363 8:62472878-62472900 GTGCAGGCAAGGTGCTCAAAGGG + Intronic
1042751191 8:72159567-72159589 GTGGAAGCATGGTGGTTAAAAGG + Intergenic
1046302925 8:112321711-112321733 CTGGAAGGAAGATGTTTGAAGGG - Intronic
1051241484 9:15061781-15061803 GTGCGGGGAAGGTGTTTGGAGGG - Intergenic
1052075346 9:24134762-24134784 TTGGAGGTAAGGCCTTTAAAAGG + Intergenic
1053044403 9:34902815-34902837 GGGGAGGGGAGGTGGTTAATAGG + Intergenic
1053124239 9:35566677-35566699 GTGGAGAGAAAATGTTTAACTGG + Intergenic
1053924652 9:43039924-43039946 TTCAAGGGAAGATGTTTAAAAGG - Intergenic
1056373307 9:85980959-85980981 ATGGAGGGTAGGTGTGGAAAAGG - Intronic
1056479618 9:86987921-86987943 GAGTAAGGAAGGTCTTTAAAAGG + Intergenic
1056564699 9:87760679-87760701 TTGGAGGGAAAGTGTGGAAAGGG - Intergenic
1056822742 9:89854906-89854928 GTGGAGGGAAGGGCTGTAAGAGG + Intergenic
1057075480 9:92136119-92136141 GTGGAGGGAAGGTTTCTCAGTGG + Intergenic
1057158106 9:92862617-92862639 GTGAAGGAAAGGTGTTTATGAGG + Intronic
1058278096 9:103073518-103073540 ATGGAGGGAGGTTGATTAAAGGG - Intergenic
1058781273 9:108337868-108337890 GTGAAGGGAAGGTTTTCAAGAGG - Intergenic
1058931435 9:109723141-109723163 GTGGAGGGAAGGAAAATAAATGG + Intronic
1058936421 9:109773444-109773466 TTGGTGGGAAGATGTTTAGAAGG - Intronic
1059725247 9:117002333-117002355 GTGGAAGGTAGATGATTAAAGGG + Intronic
1061407382 9:130399897-130399919 GTGGAGGGAGGGATTTTTAACGG - Intronic
1061450695 9:130665598-130665620 GCGGAGGGGACTTGTTTAAAAGG - Intronic
1186852167 X:13591355-13591377 ATGAAGGCAAGGTGTTAAAAGGG + Intronic
1187293159 X:17974787-17974809 GTGGGGGGCACGTGTTGAAAAGG - Intergenic
1187939687 X:24369624-24369646 ATGGGGGGAAGGTGTGTTAATGG - Intergenic
1188571147 X:31586557-31586579 GTCAAGGGAAGCTTTTTAAAGGG - Intronic
1188605221 X:32020460-32020482 GTGGAGGTAGGGCCTTTAAAGGG + Intronic
1188694907 X:33178189-33178211 TTGGAGGAAAGCTGTGTAAAGGG + Intronic
1189396535 X:40628282-40628304 GTGGAGGGCAGGGGTTTATTTGG - Intronic
1192835673 X:74796602-74796624 GAAGAGGGCATGTGTTTAAAGGG + Intronic
1193934753 X:87603857-87603879 GTGGAGAGAGGGTGGTTAAAAGG - Intronic
1194286836 X:92020660-92020682 GTGGAGGGAGTGTGTTTTATTGG - Intronic
1194299593 X:92169125-92169147 GTGGAAAGAAAGTGTTTATAGGG + Intronic
1194960471 X:100229508-100229530 ATGAAGGGAAGTTGTTTAATGGG - Intergenic
1195446909 X:104962748-104962770 GTGGAGAGAAGCAATTTAAAAGG - Intronic
1196509384 X:116489086-116489108 GTGTAGAGAAGGTGAATAAATGG + Intergenic
1197299326 X:124758885-124758907 GAAGAGGGAAGTTGTTTAATGGG + Intronic
1197947741 X:131858909-131858931 ATGGAGAAAAGGTGTGTAAATGG - Intergenic
1197951230 X:131899485-131899507 ATGGAGGAAAGGTGTTGACAAGG + Intergenic
1198309787 X:135419835-135419857 GTTGAGGGAAGCTGGATAAAAGG + Intergenic
1199970702 X:152858563-152858585 GTGGGGAGAAGGTGATTAAAGGG + Intronic
1200604378 Y:5245220-5245242 GTGGAGGGAGTGTGTTTTATTGG - Intronic
1200617237 Y:5394286-5394308 GTGGAAAGAAAGTGTTTATAGGG + Intronic
1201785990 Y:17779706-17779728 GGGGAGGGAAGTTGTTTGGAAGG - Intergenic
1201815563 Y:18126282-18126304 GGGGAGGGAAGTTGTTTGGAAGG + Intergenic