ID: 1140536920

View in Genome Browser
Species Human (GRCh38)
Location 16:75718300-75718322
Sequence TTACACAACTAGGAAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 239}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140536920 Original CRISPR TTACACAACTAGGAAAACAC TGG (reversed) Intronic
900212619 1:1463605-1463627 TTCCACAACTAAGAAAGCAGAGG + Intronic
900225298 1:1530232-1530254 TTCCACAACTAAGAAAGCAGAGG + Intronic
900923233 1:5687115-5687137 TCACATGACTAGGAAAACAGAGG + Intergenic
901043942 1:6384173-6384195 TTACACCAATTGGAAAATACAGG + Intronic
901812757 1:11777117-11777139 TTACACAACTAGAGAAACTGAGG + Intronic
902881705 1:19375772-19375794 TAACACAGCTAGAAAACCACAGG - Intronic
903164780 1:21512540-21512562 CTACACAGCAGGGAAAACACTGG + Intronic
904891830 1:33784921-33784943 TTACACAGCTGGGACCACACTGG + Intronic
908558282 1:65279808-65279830 TGACACAAAAGGGAAAACACAGG - Intronic
910007920 1:82422427-82422449 TTACCCAATTAGTAACACACTGG - Intergenic
911591034 1:99747965-99747987 TTACAAAAAAAGAAAAACACTGG + Intronic
913134844 1:115878220-115878242 TCACACAACCAGGAAAACTTAGG - Intergenic
913181049 1:116321849-116321871 TAACACATCTAGGCAAAGACTGG + Intergenic
915252115 1:154598002-154598024 AAACAAAACTAAGAAAACACTGG + Intronic
916637530 1:166689573-166689595 TTACACAAATATGAAAATAGAGG - Intergenic
916780023 1:168015757-168015779 TGACACAAATAGGAAAAGAAAGG - Intronic
919766145 1:201128407-201128429 TCACACAGCTAGGAAAAGTCAGG + Intergenic
920582348 1:207123033-207123055 ATACACAATAAGGAAAACAGAGG - Intronic
921528928 1:216255290-216255312 TTACAAAACTAGCAAAAGAAGGG - Intronic
923099813 1:230803424-230803446 TTAGACATTTAAGAAAACACTGG - Intergenic
923451304 1:234120071-234120093 TCCCAGAACTTGGAAAACACTGG + Intronic
924282086 1:242448576-242448598 TGATACAAGGAGGAAAACACGGG - Intronic
1065064330 10:21944897-21944919 CTGCAGAAATAGGAAAACACTGG + Intronic
1065587568 10:27234603-27234625 TTACACAAATAGGAAAATCTTGG - Intronic
1066623543 10:37382667-37382689 TTTTACAACCAGGAAAACACAGG - Intronic
1066810772 10:39331655-39331677 TTGCACACCTAGAAAAACAGTGG + Intergenic
1067809109 10:49413200-49413222 TTATACAGCTAGGAAAACGAAGG - Intergenic
1068708654 10:60106593-60106615 TTTCACAAATTGAAAAACACAGG - Intronic
1068859586 10:61833788-61833810 TTACACAGCTAGGAAATGATGGG - Intergenic
1069858778 10:71457278-71457300 TAACCTAACTAGTAAAACACAGG - Intronic
1069969405 10:72153177-72153199 GCACACAAATTGGAAAACACCGG + Intronic
1069979900 10:72245121-72245143 TTAGGCAAATAGGAAAACAGAGG + Intergenic
1070319936 10:75347031-75347053 TTTCAGAAATAGGAAAACAGAGG - Intergenic
1070852472 10:79577327-79577349 TTAAACAACCAAGAAAAAACTGG + Intergenic
1074476956 10:113782083-113782105 TTATATAAATAGGAAAACAAAGG + Intronic
1074877256 10:117623028-117623050 TTTCACAGATAGGAAAACAAGGG + Intergenic
1078488489 11:11746729-11746751 TTACATAACTAGGAATAGAAGGG + Intergenic
1080585345 11:33676577-33676599 TCTTACAACTAGGAAAACAAAGG + Intergenic
1081506744 11:43725196-43725218 TAACAAAACTAGGAAATGACTGG - Intronic
1083412583 11:62504639-62504661 CCACACACCTAGGTAAACACTGG + Intronic
1083500208 11:63098724-63098746 TTACAGAATTAGAAAAACAAGGG + Intronic
1083976510 11:66126178-66126200 GTATACAACTATGAAACCACTGG - Intronic
1084234953 11:67781643-67781665 TTACACAGCTGAGAAAACCCAGG - Intergenic
1084280764 11:68090368-68090390 TAACACAATGAGGAAAACAGTGG + Intronic
1084973578 11:72784331-72784353 TGACACAGCTAGGAAATCAGAGG - Intronic
1085838559 11:79983170-79983192 TTACACAAATAGGTAAACGGAGG - Intergenic
1087007563 11:93484279-93484301 ATACATAAGTAGGAAAAGACGGG - Intronic
1090679189 11:129035335-129035357 TTACACAACAAGGGTAACATAGG - Intronic
1092388347 12:8053050-8053072 TAAAAGAACTAGGAAAAAACAGG - Exonic
1093081306 12:14814957-14814979 TTACACCAATGGGAAAACTCAGG - Intronic
1094369691 12:29724568-29724590 TTACACAGCTGGGAAATGACTGG + Intronic
1094433690 12:30398084-30398106 TTACATAACTATGAAAATCCTGG - Intergenic
1096467942 12:51858146-51858168 TTACGTAACAAGGAAAACATGGG + Intergenic
1096644379 12:53022292-53022314 TTAAACCAATAGGAAAAAACGGG + Intronic
1097897427 12:64839590-64839612 TCACAAAACTAGTAAATCACTGG + Intronic
1099662752 12:85586184-85586206 TCACAGAACTAGAAAAAAACAGG + Intergenic
1100023158 12:90096238-90096260 CTACACAGCTAGGAAAAGGCTGG + Intergenic
1103938925 12:124491430-124491452 TTTCACAGCTAGGACATCACTGG + Intronic
1104338398 12:127923214-127923236 TTAGAAAAATAGGCAAACACTGG + Intergenic
1110463028 13:75767603-75767625 TGGCATAACTAGAAAAACACTGG + Intronic
1110880764 13:80569491-80569513 GTACCAAACTAGGAAAACTCAGG - Intergenic
1113233980 13:108248601-108248623 TTAAAAAACTAGGAATAGACAGG + Intergenic
1115138804 14:30143683-30143705 TTGCACAGCTGGGAAAACACAGG + Intronic
1117078093 14:52124442-52124464 TTACATATCTAGAAAAAAACTGG + Intergenic
1119083991 14:71723055-71723077 TTACAAAACTAGGGCAACATTGG - Intronic
1120521093 14:85529513-85529535 TCACATAACTAAGAAGACACGGG - Intergenic
1121134365 14:91481780-91481802 TATCACAACCACGAAAACACAGG - Exonic
1121160390 14:91733711-91733733 TTTCTCAAAAAGGAAAACACTGG - Intronic
1122546772 14:102527437-102527459 CTGCACAACTAGGGAAACAATGG + Intergenic
1125586821 15:40826600-40826622 TCACACAACTAGGAAACCTTGGG - Intronic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126870013 15:52977550-52977572 TGGCACAGCCAGGAAAACACTGG + Intergenic
1128047966 15:64635942-64635964 TTACAGAACAAAGAAATCACAGG + Intronic
1128915212 15:71553990-71554012 TTACAAAACTATCAAAACCCTGG - Intronic
1130820550 15:87490698-87490720 TCAGACAATTGGGAAAACACAGG + Intergenic
1131444851 15:92489864-92489886 TTACACTACCAGGATAACAGAGG + Intronic
1133523112 16:6577965-6577987 TTACCCAGTTAGGAAAGCACAGG + Intronic
1134780786 16:16893433-16893455 TTACACAACTCTGAATATACTGG - Intergenic
1136068149 16:27772288-27772310 TTTCACAGCTAGGAAAACTGAGG + Intronic
1137575143 16:49594450-49594472 TGACACAAACAGAAAAACACAGG + Intronic
1137752148 16:50872651-50872673 TAATACAACTAGGAAAAGAAGGG - Intergenic
1139190260 16:64855212-64855234 TTACACAAATAGGAAGACTGGGG + Intergenic
1140531359 16:75669398-75669420 TTTCACCACTAGGAAAACACTGG - Intronic
1140536920 16:75718300-75718322 TTACACAACTAGGAAAACACTGG - Intronic
1141095797 16:81162201-81162223 TTATATAACCAGGAAAACTCTGG + Intergenic
1141960142 16:87400675-87400697 TTACACATTTATTAAAACACAGG + Intronic
1142606039 17:1081546-1081568 TTGCAGGAATAGGAAAACACAGG - Intronic
1144060235 17:11576831-11576853 TTACACAAATATGAAACAACAGG + Intergenic
1149181714 17:53946319-53946341 TTACACAGCTAGCAAAAGATGGG + Intergenic
1149522668 17:57329773-57329795 TTACGTAACTCGGAAAACAGGGG - Intronic
1153003513 18:477655-477677 TTACAACACTATAAAAACACAGG - Intronic
1156803163 18:41143267-41143289 GTACACAATTACGAAAACAGGGG + Intergenic
1157036464 18:43980671-43980693 TTCCACAATGAGAAAAACACTGG + Intergenic
1157182106 18:45507078-45507100 TTACACAAAAAAGACAACACTGG - Intronic
1158760697 18:60382193-60382215 TTACAAAATTAAGAAAAGACAGG + Intergenic
1160148056 18:76379955-76379977 TTGCACAACAAGGAACACTCTGG - Exonic
1163352889 19:16790102-16790124 TTATAAAACTATGAAATCACAGG - Intronic
925487899 2:4356501-4356523 TTAAACAAACAAGAAAACACAGG + Intergenic
925573205 2:5333217-5333239 TTACACAGTTTGCAAAACACTGG - Intergenic
927567491 2:24125598-24125620 TCACTCAGCCAGGAAAACACTGG + Intronic
927608963 2:24517120-24517142 TTAAACCAATAGGAAAACATGGG - Intronic
927614248 2:24574806-24574828 TTATACAAATAAGAAAACAATGG - Intronic
928485521 2:31727640-31727662 TCAGAAAACTAGGAAAACAGTGG - Intergenic
929319487 2:40525506-40525528 TTACACAACAAAGAGAAAACAGG - Intronic
929624695 2:43394700-43394722 GGACAGAACTAGGACAACACAGG + Intronic
931489699 2:62731574-62731596 TCAGACAACTAGGAAAAAAGGGG - Intronic
933937058 2:87215040-87215062 TTACACAATTGGGAAAAAACAGG - Intergenic
936018476 2:108977138-108977160 TTAGCCATCTAGGAAAACCCAGG - Intronic
936356083 2:111750784-111750806 TTACACAATTGGGAAAAAACAGG + Intergenic
937351558 2:121167221-121167243 TTAAAAAACTAGAAAAACTCGGG - Intergenic
937727768 2:125187300-125187322 TTTCCCAACAAGGAAACCACTGG + Intergenic
938580149 2:132638374-132638396 TCACACAAGTTGGAGAACACTGG - Intronic
938907374 2:135850879-135850901 TAATAAAACTAGGAAAACGCAGG + Intronic
939129647 2:138219212-138219234 TTTCACAACTTTGAAAAGACTGG - Intergenic
939865476 2:147467710-147467732 TTACAAACCAAGGAAACCACAGG + Intergenic
941102545 2:161312053-161312075 TTGCACAAATAAGAAAACAGAGG + Intronic
942381776 2:175399176-175399198 TTTCACAAATCGGAAAACTCAGG - Intergenic
945135844 2:206626833-206626855 TTGAACAACTGGTAAAACACAGG + Intergenic
945596076 2:211794864-211794886 TAACAGAAATAAGAAAACACAGG - Intronic
1169445999 20:5671545-5671567 TTATACACCAAGGAAAGCACTGG - Intergenic
1169803731 20:9538008-9538030 TTACCAAACTGGGAAAACAGAGG - Exonic
1170130710 20:13016513-13016535 TCACACAACTAGAACAAAACTGG + Intronic
1170470750 20:16665576-16665598 GAAGATAACTAGGAAAACACTGG - Intergenic
1170514201 20:17110947-17110969 ATACAAAACTATGAAAACCCTGG - Intergenic
1171157819 20:22892570-22892592 TTATACAGCTATGGAAACACAGG + Intergenic
1172485793 20:35297238-35297260 TTTCACAACTGGGAAAGCTCTGG - Intergenic
1176251289 20:64121584-64121606 ACACAAAACTAGGACAACACTGG - Intergenic
1177335585 21:19721799-19721821 TTTCTCAACTTGTAAAACACCGG - Intergenic
1177575691 21:22952062-22952084 GTAAACAACTACAAAAACACAGG - Intergenic
1178545355 21:33488844-33488866 TTACACTATCAGGAAAATACTGG + Exonic
1178642604 21:34357227-34357249 TTACACAACTAGAAAGAAAGTGG + Intergenic
1180224318 21:46380737-46380759 TTCCACAGCTCTGAAAACACTGG + Intronic
1181612458 22:24026491-24026513 ATACAAAACAAAGAAAACACAGG - Intronic
1182822885 22:33233906-33233928 TTTCACAATTAGTATAACACAGG - Intronic
1183549071 22:38470663-38470685 TTTGACAAATGGGAAAACACAGG - Intronic
1184270417 22:43378350-43378372 TCACACAGCTATGGAAACACAGG - Intergenic
1184604880 22:45566808-45566830 TGACACAACCAGGAAAGCACAGG - Intronic
1185243606 22:49760899-49760921 TTACTCAACCAAGAAAAGACAGG + Intergenic
949889781 3:8725252-8725274 TTCTAAAACTAGGAAATCACTGG + Intronic
950649674 3:14399517-14399539 TCACACAACTGGGAAGCCACAGG + Intergenic
953292696 3:41682302-41682324 TGATACAACTAGGAACTCACAGG - Intronic
954493844 3:50933896-50933918 TTAAACAAGTAGAAAAAGACAGG + Intronic
955143192 3:56289926-56289948 TTACACAGATAGGGAAACAGAGG - Intronic
956040771 3:65142940-65142962 TTTATCAAATAGGAAAACACAGG - Intergenic
956944239 3:74200698-74200720 TCACACAACTAGCAAGAGACAGG + Intergenic
957151172 3:76488042-76488064 TTACACAACCATATAAACACGGG + Intronic
960733065 3:120747034-120747056 TTACACAGTTACCAAAACACAGG + Intronic
961089461 3:124097597-124097619 TGACACACCTAGGAAAAGGCAGG + Intronic
961884590 3:130088172-130088194 TTCCACAGCTAAGAAAACCCAGG - Intronic
962347698 3:134630742-134630764 TTACTCAGCTAGGAAGACTCAGG + Intronic
963645731 3:147911908-147911930 TTAAACAACAAAGAAAACATTGG + Intergenic
964485988 3:157185850-157185872 TTACACAAGTAGGAAGGTACAGG - Intergenic
965342585 3:167508398-167508420 TTTCACAACTTGAAAAACAGAGG - Intronic
967239304 3:187421534-187421556 TCACAGAACTAGAAAAAAACTGG + Intergenic
967989329 3:195119775-195119797 ACAAACAGCTAGGAAAACACAGG - Intronic
970551731 4:17188535-17188557 TTACAGGGCTAGGAAAACAAGGG + Intergenic
971625881 4:28919684-28919706 TTACACATGTAAGCAAACACTGG - Intergenic
974221661 4:58981904-58981926 TAACACAACTAGGAAAAGAATGG - Intergenic
977355094 4:95935895-95935917 TTAGCCAACTAGGAAAAGAGGGG + Intergenic
978704663 4:111692319-111692341 TTCAACAACTAGGAAGACACTGG + Intergenic
978887121 4:113777076-113777098 TTACACAACCAGGAAAATTTAGG - Intergenic
981169793 4:141608107-141608129 CTCCACAACATGGAAAACACAGG + Intergenic
981785499 4:148474076-148474098 TTTCACATCAAGGAAAAGACAGG + Intergenic
984328081 4:178278969-178278991 TTACACAAATAACAAAACAGAGG + Intergenic
984497788 4:180520091-180520113 TCACACAGCTAGTAAAACACTGG + Intergenic
986943360 5:12984364-12984386 TTACAGAACTTGAAAATCACAGG + Intergenic
988427344 5:31078974-31078996 CTGCACAACTAGCAAAACTCTGG + Intergenic
988619204 5:32805181-32805203 TCACACAGCTAGGAAATGACAGG + Intergenic
988948752 5:36236346-36236368 GAACACAACTTGGAAAACAGAGG - Intronic
990962569 5:61410152-61410174 ATACAAAACTACGAAAACTCAGG + Intronic
993865679 5:93191898-93191920 ATACACAATTACGAATACACTGG + Intergenic
994670718 5:102758382-102758404 TTTCACAAATAGAAAAACAAAGG - Intronic
995026668 5:107431575-107431597 TTACACAACTAGTAAAGAAAAGG + Intronic
995681124 5:114721050-114721072 TTAAACAACTAGAAAAACTCTGG - Intergenic
996005501 5:118416137-118416159 TTCTAGAACTAAGAAAACACAGG + Intergenic
996267057 5:121554286-121554308 TTATATAACAAGGAAAAAACAGG - Intergenic
997316028 5:132936682-132936704 TAGCACAACTAGGAAAATAGAGG + Intronic
998659493 5:144220263-144220285 AGACATCACTAGGAAAACACTGG - Intronic
1000010988 5:157232747-157232769 TTACAGGACTAGCAAACCACAGG + Intronic
1000266452 5:159642331-159642353 TAACACACTTCGGAAAACACTGG + Intergenic
1000485102 5:161831521-161831543 TAACACAGTTATGAAAACACTGG + Intergenic
1001338967 5:170826116-170826138 TTTCACAACTGGGGAAACACAGG + Intergenic
1002119892 5:176994872-176994894 TTACAAAACTTGTGAAACACAGG + Intronic
1003298721 6:4857090-4857112 TTTTACAATTAGAAAAACACAGG + Intronic
1005617831 6:27592376-27592398 TTAAAGAGCTAGGAAAACACCGG - Intergenic
1005746206 6:28840131-28840153 TAACACAACTAGCAAATAACTGG + Intergenic
1009814643 6:68716436-68716458 TTACAGAACCAGTAAAACATGGG - Intronic
1011939455 6:92825151-92825173 TTTTACAAATGGGAAAACACAGG + Intergenic
1013747595 6:113364412-113364434 GTACACAACTAGAAATTCACTGG - Intergenic
1014310982 6:119801184-119801206 TTTCACAGCTGAGAAAACACAGG - Intergenic
1014480095 6:121925631-121925653 TTTCTCAAATAGGAATACACTGG + Intergenic
1015261386 6:131241405-131241427 TTAGACAACTAGGTAGACAGTGG + Intronic
1016277920 6:142377164-142377186 TCACACAACTAGGAAAATTTAGG + Intronic
1017881295 6:158564368-158564390 TTTCACAGGTGGGAAAACACAGG - Intronic
1018074069 6:160194849-160194871 TTACATAAAAAGGAAAATACAGG + Intronic
1018319422 6:162591186-162591208 AAACACAGCTAGGAATACACAGG + Intronic
1020559411 7:9711699-9711721 TTTCTTAACCAGGAAAACACAGG - Intergenic
1020923253 7:14291874-14291896 TTAGACAACAAGGCAAACATTGG + Intronic
1021465084 7:20933433-20933455 TTGCACCACCAGAAAAACACTGG - Intergenic
1023154066 7:37230415-37230437 TTCCACCACTTGGAAAGCACAGG + Intronic
1023230364 7:38021578-38021600 TTTCACAAATGAGAAAACACAGG + Intronic
1024488221 7:49944904-49944926 TTAAAGAACTAGAAAAACAAGGG - Intronic
1025063761 7:55834991-55835013 TTGCATAACTAGGTAATCACTGG + Intronic
1026543840 7:71304607-71304629 TGACACAAATAAGCAAACACAGG - Intronic
1028573815 7:92323528-92323550 CTACAAAACTAGAAAAATACAGG - Intronic
1028930126 7:96403916-96403938 TTGCACAACTAGGAAAATAACGG - Intergenic
1029063355 7:97822842-97822864 TTACACAAAAAGTAAAATACTGG - Intergenic
1029673167 7:102047999-102048021 TGACACAACTGGAAAAAGACTGG - Intronic
1030652648 7:112132104-112132126 TTAGACCATTAGGAAAACAGTGG + Intronic
1031350912 7:120729756-120729778 CTTCACAACTGAGAAAACACAGG - Intronic
1031769029 7:125819343-125819365 TTAAACTTCTAGGAAAACAAGGG + Intergenic
1032320448 7:130881756-130881778 TTTCACATCCAGGAAAACAATGG - Intergenic
1034707777 7:153161814-153161836 TTATAAAAATAGGAAAAGACCGG - Intergenic
1036280233 8:7394016-7394038 TTGCACAGCTCTGAAAACACAGG - Intergenic
1036341292 8:7917867-7917889 TTGCACAGCTCTGAAAACACAGG + Intergenic
1037440526 8:18911449-18911471 TTACACAGCAAGGAAGTCACGGG - Intronic
1039665824 8:39526482-39526504 GTAAACTATTAGGAAAACACAGG + Intergenic
1041874426 8:62671588-62671610 TTATACTACTTGGAAAACAAAGG - Intronic
1042879100 8:73467619-73467641 TTTTACAGCTAGGAAAACAAAGG + Intronic
1042916491 8:73880299-73880321 TGACACAACAAGGCTAACACCGG - Intergenic
1043586557 8:81777030-81777052 TCACACAGCTAGAAAAACATAGG - Intergenic
1043807141 8:84685658-84685680 TTACACAATTTAAAAAACACAGG + Intronic
1043842772 8:85128344-85128366 ATACATAACTTGGGAAACACGGG - Intronic
1044176457 8:89129984-89130006 TTAAACTACTAGGAGAAAACAGG - Intergenic
1044635383 8:94319168-94319190 TACCACAACTAGGAATGCACTGG + Intergenic
1046691062 8:117284774-117284796 TCAGACAACAAGGGAAACACAGG + Intergenic
1046957384 8:120075587-120075609 TTTCACAAATAAGAAAACAGAGG + Intronic
1047076523 8:121410502-121410524 TCACCCAACTAGTAAAACATGGG + Intergenic
1048774867 8:137934734-137934756 TAACACAACCAGAAAAACACAGG + Intergenic
1050724747 9:8636091-8636113 TCACACTACTTGTAAAACACAGG + Intronic
1050828894 9:9986244-9986266 TTCCACATCTAGGAAATAACTGG + Intronic
1054982121 9:71219065-71219087 TTACACAGCCATGAAACCACCGG - Intronic
1057434745 9:95029415-95029437 TTACCCTACTGAGAAAACACAGG - Intronic
1057903236 9:98965620-98965642 CCACACAATTAGGAAAACAAGGG - Intronic
1058103987 9:100949448-100949470 TCACACAACTAGAAAAATCCAGG + Intergenic
1058247981 9:102654521-102654543 ATACACAACTTAGAAATCACTGG + Intergenic
1058587595 9:106527379-106527401 TTCCTCAACTTGGAAAACATAGG + Intergenic
1058654730 9:107209739-107209761 TAAAACACCTGGGAAAACACAGG - Intergenic
1185576699 X:1180303-1180325 TTAAACAACAAAGAAAACAGTGG + Intergenic
1185716377 X:2346021-2346043 TTACAGAACAAGGATACCACGGG - Intronic
1186361700 X:8849140-8849162 TTACAAAACAAGGAAAACTTAGG - Intergenic
1186823982 X:13319545-13319567 TTAGAAAATTTGGAAAACACTGG - Exonic
1188425333 X:30040305-30040327 ATCCACAAATAGGTAAACACTGG + Intergenic
1188490834 X:30737595-30737617 TTACACAACAATGAAAGTACAGG + Intergenic
1189488984 X:41454993-41455015 TGACACAGCTGTGAAAACACTGG - Intronic
1190331370 X:49237516-49237538 TTTCACAAATAGGAAAACTGGGG - Intronic
1190958520 X:55221079-55221101 TTACACATTTAGGAAAAAAACGG - Intronic
1192259200 X:69494022-69494044 TTACAAAACTCAGAAAACAATGG + Intergenic
1193802810 X:85956728-85956750 TTAAACAACTATGACAACATGGG + Intronic
1194161507 X:90458357-90458379 TTACAAAACTTGTAAAACACTGG + Intergenic
1195302066 X:103539714-103539736 TTACACATTTATGCAAACACTGG - Intergenic
1195866054 X:109434111-109434133 TGAGACAAAGAGGAAAACACAGG + Intronic
1195963850 X:110412827-110412849 TTACACATACAGGAAAAGACTGG + Intronic
1198696928 X:139351561-139351583 TTAAAGAACTAGAAAAACAAGGG - Intergenic
1200507795 Y:4036090-4036112 TTACAAAACTTGTAAAACACTGG + Intergenic
1201687187 Y:16718260-16718282 TTAAACAACTAGGAACAGGCAGG - Intergenic