ID: 1140537911

View in Genome Browser
Species Human (GRCh38)
Location 16:75727775-75727797
Sequence ATAGCTCACTAGTTCACTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140537911 Original CRISPR ATAGCTCACTAGTTCACTAT GGG Intronic
909112622 1:71498818-71498840 GGAGGTCACTACTTCACTATAGG + Intronic
909407583 1:75309345-75309367 TGAGCTCACGAGTTCACTGTTGG + Intronic
909717468 1:78726817-78726839 ATCCCTCACTAGTACACTAAAGG + Intergenic
911313412 1:96325940-96325962 ATAGCTCACTAGCGGGCTATAGG - Intergenic
917621229 1:176798364-176798386 ATACCTCACTCACTCACTATGGG - Intronic
921869895 1:220128681-220128703 ATACCTCACTGTTTCACAATTGG - Intronic
921899584 1:220436205-220436227 ATAGCTCCCTCTTTCACTCTTGG - Intergenic
1068619587 10:59166196-59166218 ATAGCTCACTAGCTAATCATGGG - Intergenic
1072978066 10:100076326-100076348 ATAACTGTCTAGTACACTATGGG - Intronic
1086934618 11:92731230-92731252 ATAGATCATTTGTTCATTATTGG + Intronic
1087726902 11:101728947-101728969 GTAGCTCGCTATTCCACTATTGG - Intronic
1117017681 14:51535025-51535047 ATATCTGAGTAGTTCACTTTTGG - Intronic
1120550774 14:85869794-85869816 GTAGCACTCTAGTTGACTATAGG + Intergenic
1124073340 15:26416099-26416121 ATAGGTCAATAGTTCACAAATGG + Intergenic
1125525423 15:40371077-40371099 CTATCTCACTACTTCACTACAGG + Intergenic
1134395313 16:13857088-13857110 ATAGTTAACCAGTTCCCTATTGG - Intergenic
1135426139 16:22338054-22338076 ATAGCTCTCTTGTTCTCTTTTGG - Intergenic
1137403854 16:48175167-48175189 ATTGGTCACCAGCTCACTATAGG + Intronic
1138291431 16:55850659-55850681 ATAGCACTCTTGTTCATTATAGG - Intronic
1140533377 16:75686313-75686335 ATAGCTCTCTAGATTACTAGAGG - Intronic
1140537911 16:75727775-75727797 ATAGCTCACTAGTTCACTATGGG + Intronic
1154204115 18:12322587-12322609 ATAGCTCACTATTTGATTTTTGG + Intronic
1168358963 19:55722102-55722124 CTAGCTCAGTAGTTCTCAATGGG - Intronic
926458922 2:13103170-13103192 ATAAATCATTATTTCACTATTGG + Intergenic
932862267 2:75306336-75306358 AGAGCTCAGTAGTTCAGTGTTGG - Intergenic
939256690 2:139752895-139752917 ATAGCTTACTAGTACTCCATTGG + Intergenic
941308124 2:163895628-163895650 ATAGCTGACAAGTTCATAATGGG - Intergenic
942826689 2:180186242-180186264 AGAGTTCTTTAGTTCACTATAGG + Intergenic
943551232 2:189342136-189342158 AAAGCTCTCTAGATCATTATAGG + Intergenic
1170759215 20:19235100-19235122 AAAGCTCAATAGTGCTCTATCGG + Intronic
1177665218 21:24147858-24147880 ATTGCACAATAGTTGACTATGGG - Intergenic
951031566 3:17887791-17887813 ATAACTCACCATCTCACTATAGG - Intronic
951716751 3:25657107-25657129 ATTGCTCACTGGCTCACTAGTGG + Intronic
951982352 3:28579376-28579398 ATATCTCACTAGGTCACCAAAGG - Intergenic
957826464 3:85451955-85451977 ATGCTTCACTAGTTCACTCTCGG + Intronic
960100833 3:113741394-113741416 ATAGCTCTCACGTTCACGATGGG + Intronic
961225077 3:125236809-125236831 ATAGCTCACTTGTATACAATGGG + Intronic
962141145 3:132792081-132792103 AGAACTCACTGGTTCACAATAGG + Intergenic
964464525 3:156976139-156976161 ACATCCTACTAGTTCACTATAGG - Intronic
968256282 3:197275809-197275831 ATAGCACAGTAGGTGACTATAGG + Intronic
970921269 4:21398046-21398068 AGACCTCACAAGTTCATTATAGG + Intronic
977026786 4:91829792-91829814 ATATCTCACTATTTCACCAAGGG - Intergenic
977397731 4:96491713-96491735 TTATCTCACTAGGTCACTATAGG - Intergenic
980400495 4:132277910-132277932 ATAAGTTACCAGTTCACTATTGG + Intergenic
980468085 4:133212573-133212595 ATCACTCACTAGTTCATTAATGG + Intergenic
981303698 4:143222015-143222037 ATAGCTCAGAAATTCACTATTGG - Exonic
984817085 4:183849016-183849038 TTAGATAACTAGTTCACTCTGGG + Intergenic
988011360 5:25490803-25490825 ATAGCTCTCTAGATCATTAGGGG + Intergenic
989256500 5:39371365-39371387 ATCACTCATTAGTGCACTATTGG - Intronic
990425972 5:55689386-55689408 ATAGCTCAGTGGCTGACTATAGG - Intronic
992585573 5:78235844-78235866 ATTGCTTACTAGGTCACTTTTGG + Intronic
994619145 5:102142279-102142301 ATAGCTCCCAAGCTCACTACAGG + Intergenic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
1000336136 5:160242909-160242931 GTAGCTCCCAAGTTCACTAAAGG - Intergenic
1016092080 6:139992487-139992509 ATTGCACACTAGTTCACTTCAGG - Intergenic
1016935855 6:149448997-149449019 ATGGCTCATTTGTTCACTAGAGG - Intronic
1017995772 6:159530636-159530658 TGAGCCCACTAGTTCACTACTGG - Intergenic
1020509831 7:9040315-9040337 ATACCTCACTAATTTCCTATAGG - Intergenic
1020555171 7:9662012-9662034 CTAGTTCACTAGTTCACTATTGG - Intergenic
1027876183 7:83772067-83772089 ATATCTGATTATTTCACTATTGG + Intergenic
1030968153 7:116019267-116019289 ATTGCTCACTAATTCTCTAAAGG + Intronic
1034798460 7:154035169-154035191 ATTGCTCACTAGCTCATCATTGG + Intronic
1036534535 8:9634029-9634051 ATAGATTACTAATACACTATAGG + Intronic
1041219474 8:55634299-55634321 ATAACTCACAAGTTCAGTGTGGG + Intergenic
1041325657 8:56661040-56661062 AGAGCTCACTGGATCACTAAGGG + Intergenic
1046865809 8:119149251-119149273 ATAGCTCAATTCTTGACTATTGG - Intergenic
1048120681 8:131577870-131577892 ATAGTTCACTATGTCACTATCGG + Intergenic
1048548619 8:135411823-135411845 AAAGTTCAATTGTTCACTATTGG + Intergenic
1052753726 9:32519443-32519465 ATAGCTCTCTAGTTCATTAGAGG - Intronic
1053564142 9:39230327-39230349 ATATCTCTCTAGTTCCCCATTGG - Intronic
1053829929 9:42068198-42068220 ATATCTCTCTAGTTCCCCATTGG - Intronic
1054133006 9:61388707-61388729 ATATCTCTCTAGTTCCCCATTGG + Intergenic
1054600627 9:67119255-67119277 ATATCTCTCTAGTTCCCCATTGG + Intergenic
1057793111 9:98137187-98137209 ATAGCTCGCTTCCTCACTATGGG + Intronic
1058574467 9:106385497-106385519 ATAGTTCACTAATTCAGTTTTGG + Intergenic
1058794160 9:108481769-108481791 ATAGCTCACTAACTGACTACTGG + Intergenic
1194349741 X:92811275-92811297 ATTGCTCAGTAGTTCAGTCTTGG - Intergenic
1200658066 Y:5927880-5927902 ATTGCTCAGTAGTTCAGTCTTGG - Intergenic