ID: 1140539408

View in Genome Browser
Species Human (GRCh38)
Location 16:75742406-75742428
Sequence AAAATGTTATTTATGAAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1302
Summary {0: 3, 1: 8, 2: 30, 3: 133, 4: 1128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140539408 Original CRISPR AAAATGTTATTTATGAAACA AGG Intronic
900336785 1:2168270-2168292 AAAACTTTATTTACAAAACAGGG + Intronic
900691194 1:3981724-3981746 TAAATGTTATTAAAGGAACAGGG - Intergenic
900770707 1:4541257-4541279 AACATGTTATTTCTTAACCAGGG + Intergenic
900851296 1:5145013-5145035 CAACTTTTATTTTTGAAACAGGG + Intergenic
901708073 1:11091661-11091683 AACATTTTATTTATTTAACATGG + Intronic
902585287 1:17435430-17435452 AAAAGGTTCTTTCTGCAACAAGG + Intronic
903638653 1:24839743-24839765 AAAATGTTTACTCTGAAACAAGG - Intronic
904226665 1:29026798-29026820 AAAATTTTTTTTAAGAGACAAGG - Intronic
905683831 1:39894594-39894616 AGAATGTTTTTTTTGAGACAGGG + Intergenic
905706392 1:40063002-40063024 AAAATTTTTTTTTTGAGACAGGG + Intronic
906564145 1:46785075-46785097 TAAAGGTTATCTATAAAACAAGG - Intronic
907094276 1:51762188-51762210 AAATTTTTATTTTTGAGACAGGG + Intronic
907398897 1:54212295-54212317 AAAATGTTATTTACAAAAATAGG + Intronic
907637814 1:56154037-56154059 AAAATGTTTTCTATTAAAAAAGG - Intergenic
907920773 1:58909773-58909795 ATAAACTTGTTTATGAAACATGG + Intergenic
908148163 1:61269462-61269484 CAAAAGTTATTTATGATAGAAGG + Intronic
908702334 1:66915707-66915729 TAAAGGTTATATATAAAACAAGG + Intronic
908863131 1:68512914-68512936 TAAAGGTTATTTATAAAACAGGG - Intergenic
908941495 1:69440451-69440473 AAAATTCTATTTATAAAATATGG + Intergenic
908969039 1:69803727-69803749 AGATTGTAATTTATGAAAAACGG - Intronic
909106958 1:71423429-71423451 AAAAAGCTATTTTTAAAACATGG + Intronic
909129533 1:71716914-71716936 AACATATTATTTATTAAACTGGG + Intronic
909592620 1:77368422-77368444 ATAATGTTGTACATGAAACAAGG + Intronic
909837912 1:80280577-80280599 AAAACTTTATTTATAAAACCAGG + Intergenic
910039149 1:82826802-82826824 AAAACGTTAATTATGAAATGTGG - Intergenic
910089770 1:83448697-83448719 AAAATGTTAATTGTGCAGCATGG - Intergenic
910308314 1:85793073-85793095 AAAATGTTATTTGAAAAAAAAGG - Intronic
910400635 1:86834584-86834606 ATAATTTTTTTTTTGAAACAGGG + Intergenic
910584455 1:88863736-88863758 AAAATGTCATTTATGAAAAAAGG + Intronic
910617138 1:89210974-89210996 AAACAGTTATTTATGAAACAAGG + Intergenic
910886062 1:91964743-91964765 AAATTGTTATTTATATAACAAGG + Exonic
910908650 1:92210285-92210307 ACAATGTTATGAATGAAATAAGG - Intergenic
910937852 1:92500677-92500699 AAACTTTTATTTATTACACATGG - Intergenic
910986375 1:93008631-93008653 AGAATTTTATTTAGGAAGCAGGG - Intergenic
911845086 1:102742682-102742704 AAATTTCTATTTATGAAAAATGG + Intergenic
913339007 1:117738470-117738492 AAAAAGTTTTTTCTGCAACAAGG - Intergenic
914330791 1:146669131-146669153 ATAATGTTACTTGTGTAACAAGG - Intergenic
914720645 1:150285963-150285985 AAAATTTTATATTTGAGACAGGG - Intronic
915427509 1:155839139-155839161 AAAAGGTTATTTATATAACCAGG + Intronic
915652628 1:157328668-157328690 TAAAGGTTATGTATAAAACAAGG + Intergenic
915756305 1:158263682-158263704 AAAAACTTATTTATGAAATAAGG + Intergenic
916710628 1:167403621-167403643 ATCATGTTATTTATTAAAGACGG + Intronic
917232152 1:172849552-172849574 TAAAGGTTATATATAAAACAAGG - Intergenic
917406775 1:174715397-174715419 AATTGGATATTTATGAAACAAGG - Intronic
917421320 1:174866902-174866924 AAAATTTTTTTTTTGAGACAGGG - Intronic
918214529 1:182381863-182381885 AAAATGCTAAGGATGAAACAGGG + Exonic
918361944 1:183768406-183768428 AAAAGGTTATTTATGAAATAAGG - Intronic
918952307 1:191154179-191154201 TAAAGGTTATGTATAAAACAAGG + Intergenic
918960466 1:191269860-191269882 AAAATATTATTTTTAAACCATGG + Intergenic
919019160 1:192081445-192081467 AACATGTTATTTTTGGAAAAAGG - Intergenic
919180516 1:194075344-194075366 AAATTGTGATTTATGAAAACAGG - Intergenic
919239233 1:194889994-194890016 AAAAAGATATTTATGAAACAAGG - Intergenic
919535636 1:198784175-198784197 AAAATGATATTTATAGAAAATGG + Intergenic
919772866 1:201173936-201173958 AAATTGTTATTTACAAAACTAGG + Intergenic
920011138 1:202868603-202868625 AAATGGTTACTTATGAAAAAAGG - Intergenic
920125126 1:203688303-203688325 TCAATTTTATTTTTGAAACAGGG + Intronic
920139121 1:203795079-203795101 ACAATGTTAATAATGAAGCAGGG + Intergenic
920667756 1:207977615-207977637 ATAATTTTATGCATGAAACAAGG - Intergenic
920728259 1:208458032-208458054 AAAAAGTTATTTATCTAAGAAGG - Intergenic
920907217 1:210182559-210182581 AAAATGTTTTTTTTGAGATAGGG - Intergenic
921575929 1:216834771-216834793 AAAATGTTGTCTAAGAAACAGGG + Intronic
922341526 1:224660055-224660077 GAAAGGTTATTTATGAAACAAGG - Intronic
922600752 1:226850721-226850743 TAAAGGTTATGTATAAAACAAGG + Intergenic
923315360 1:232774563-232774585 AAAATGTTATTAAGAAAATAAGG - Intergenic
923536130 1:234853337-234853359 AAAATTTTACTGATGAAACTTGG - Intergenic
923547801 1:234936213-234936235 AAAATGTTTCTTTTGAGACACGG - Intergenic
923628452 1:235633492-235633514 AAATTTTTATTTTTGAGACAGGG + Intronic
923641310 1:235764044-235764066 GAAATGTAATTTATGAAACAAGG - Intronic
923824862 1:237489094-237489116 AAAATTTTATTTATAAAAATAGG + Intronic
924200772 1:241656292-241656314 AGAATGTTTTTAATGGAACAGGG + Intronic
924391273 1:243561832-243561854 AAGATGTTATTTTTCAAAGATGG + Intronic
924397420 1:243637091-243637113 AACATGTTATTTATTTAAAAAGG + Intronic
924407424 1:243764373-243764395 AAAATGTTACTTTTGATACACGG - Intronic
924749234 1:246870058-246870080 CAAAAGTTATTCATGAAAGATGG - Intronic
924813128 1:247420708-247420730 AAAAATTTTTTTTTGAAACAGGG - Intronic
1063320740 10:5050794-5050816 AAACTGTTGTGTATGATACAGGG - Intronic
1063326352 10:5107077-5107099 AAATTGTTATATATGATATAGGG - Intronic
1063360353 10:5449859-5449881 AATTTGTTATGCATGAAACAAGG + Intronic
1063483021 10:6393340-6393362 AAAACTTTATTTATGAAAACAGG + Intergenic
1063807742 10:9666620-9666642 AAAGTGTAATTTATAAATCAAGG - Intergenic
1063895965 10:10682350-10682372 AAATTGTTCTTTAAGAAAAACGG - Intergenic
1064383879 10:14873243-14873265 AAAATTTTATCTATGAAAACAGG - Intergenic
1064487493 10:15809891-15809913 AAAATATGATTTATAAAACATGG + Intronic
1064669831 10:17701320-17701342 TTAATGTTATTTTTAAAACATGG - Intronic
1064690007 10:17907039-17907061 AAAATGTTGTATGTAAAACAAGG + Intronic
1064711878 10:18136392-18136414 AAAATGTTACTCCTGAAAAAGGG - Intergenic
1065108635 10:22417467-22417489 AAAATGTGACTTTTGAAACTTGG - Exonic
1065224658 10:23531454-23531476 AAAATGGTATTTCTAAAAAAAGG - Intergenic
1065398966 10:25273984-25274006 AAAATGTTTTTTGCGAGACATGG + Intronic
1065729213 10:28695135-28695157 TTATTGTTATTTTTGAAACAGGG + Intergenic
1065770087 10:29070060-29070082 AAAATGGTATTAAGGAAACAAGG + Intergenic
1065843511 10:29725926-29725948 AAAAAATTATTTTAGAAACAAGG + Intronic
1066415812 10:35220482-35220504 AAAATGAAAATCATGAAACAGGG - Intergenic
1066593233 10:37019187-37019209 AAAGGGTTAATGATGAAACAAGG + Intergenic
1066979459 10:42398488-42398510 TAAAAGTTATGTATAAAACAAGG + Intergenic
1067573856 10:47393489-47393511 AAAATGTTTTTTATGAATTTGGG - Intergenic
1068228607 10:54139743-54139765 AAATGGTTAGTTATGAAACAAGG + Intronic
1068235194 10:54224607-54224629 AAAATTTTAGTTATGTAAAAGGG - Intronic
1068367771 10:56073548-56073570 AAAATGTTTTTTTTTAAAAAAGG + Intergenic
1068374409 10:56159546-56159568 AACATGGCATGTATGAAACATGG - Intergenic
1068399009 10:56504416-56504438 AAATTGAAACTTATGAAACAAGG + Intergenic
1068434362 10:56971583-56971605 ATATTGTTATTTATGAAAAGTGG + Intergenic
1068852425 10:61759279-61759301 CAAATGTTGCTTATTAAACATGG + Intronic
1069104526 10:64366588-64366610 AAAATGTTTTTCAGGCAACATGG - Intergenic
1069152808 10:64986754-64986776 AAAATTTTATTTTAGATACAGGG + Intergenic
1069186018 10:65424300-65424322 AAAATATTATTTAAGAATGAAGG + Intergenic
1069279291 10:66633980-66634002 ATAATCTCATTTATGAAAGATGG + Intronic
1069353005 10:67551870-67551892 AAACTGGTATTTATTAAACTGGG + Intronic
1069672745 10:70223190-70223212 AAAATGTTTTTTAAGAGACAGGG - Intronic
1070023854 10:72612622-72612644 AAATTGTTTTTTGTGAGACAGGG - Intronic
1070059846 10:72971243-72971265 AAAAATTTTTTTTTGAAACAAGG - Intergenic
1070086106 10:73238477-73238499 AAAAGTTTATTTACAAAACAAGG - Intronic
1070095295 10:73331671-73331693 AAAATTTTTTTTTTGAGACAGGG - Intronic
1070275164 10:74998919-74998941 ATAATTTTTTTTAAGAAACAGGG - Intronic
1070393884 10:75994708-75994730 AAAATGTTATATAAAAAACACGG - Intronic
1070539347 10:77405047-77405069 AAAATGTGCTTGAGGAAACAAGG + Intronic
1071253381 10:83843256-83843278 AAAATGTCAGTTTTGAAAAATGG + Intergenic
1071972320 10:90920873-90920895 AAAATGTCATATATGGAAAAAGG - Intronic
1071980162 10:90997302-90997324 AAAATTTTTTTTTTGAGACAAGG - Intergenic
1072163845 10:92792826-92792848 AAAATATTTTTTTTGAAACAGGG - Intergenic
1072178296 10:92952064-92952086 ATAATATGATTTAAGAAACAAGG + Intronic
1072873474 10:99146359-99146381 AAAAGGGTAGTTATGTAACATGG + Intronic
1073000222 10:100278911-100278933 AAAAAATTGTTTTTGAAACAAGG - Intronic
1073718216 10:106133910-106133932 AAAATGTGTTTTAGGAAACGGGG + Intergenic
1073939806 10:108683362-108683384 AAAATGATATTAATGAGACAAGG - Intergenic
1074331668 10:112518056-112518078 AAAATTTCATTTATAAAACATGG + Intronic
1074555982 10:114490598-114490620 AAAGAGTTATTAATCAAACAAGG - Intronic
1074725995 10:116310584-116310606 AAAATCTTATTTTTCAAAGAAGG - Intergenic
1074880932 10:117657921-117657943 AAAATGTTAATTGTAGAACATGG - Intergenic
1074905329 10:117857601-117857623 AAAATGTTATTTCTCTAAAATGG + Intergenic
1075157757 10:119993195-119993217 AAATTGTTATTTTTGAGACAGGG + Intergenic
1075198479 10:120381311-120381333 AATATCTGATTTATGAAAAATGG + Intergenic
1076073890 10:127516772-127516794 AAAATGGTATTTAGAAACCAAGG - Intergenic
1077733101 11:4756578-4756600 AAAAAGTCCTTTATAAAACATGG + Intronic
1077767160 11:5171433-5171455 AAAAATTTATTTCTGAAACAAGG + Intronic
1078673286 11:13384267-13384289 AAAATGTTGTTGATGAGATAGGG + Intronic
1078778232 11:14412936-14412958 AAAATTTTATTTACAAAAAAAGG + Intergenic
1079481344 11:20883736-20883758 AATATGCAAGTTATGAAACAAGG - Intronic
1079501189 11:21103099-21103121 AAAATGTTTTTAATGAACCGAGG + Intronic
1079646730 11:22872183-22872205 TAAATACTATTTATAAAACATGG + Intergenic
1079789736 11:24721995-24722017 AAAAATTTATTTATAAAAAATGG + Intronic
1080084366 11:28260249-28260271 AAAGTGACATCTATGAAACAGGG - Intronic
1080103223 11:28483701-28483723 AAAATGTTACTTATAAAAACAGG + Intergenic
1080679157 11:34457903-34457925 AAAAAGTTATTTTTTAAAAACGG - Intronic
1081334808 11:41851810-41851832 AAAAAGTTATTTTTGAAACAAGG - Intergenic
1081814104 11:45929066-45929088 AAAACTTTAATTATGAAAAAGGG - Exonic
1082256662 11:50039957-50039979 AAAAAGTTATTAATTCAACATGG + Intergenic
1082942321 11:58720123-58720145 TAAAGGTTATGTATAAAACAAGG - Intronic
1082949544 11:58797152-58797174 TAAAGGTTATGTATAAAACAAGG - Intergenic
1082994487 11:59240259-59240281 AAAAAGTTACTTATGACACAAGG + Intergenic
1083242596 11:61400110-61400132 AAAATTTTATTTTTGAGACAGGG - Intergenic
1083312507 11:61791803-61791825 ATAATGTCTTTTATGAAAGAGGG + Intronic
1083358646 11:62088258-62088280 TAAAGGTTATGTATAAAACAAGG + Intergenic
1084349555 11:68586096-68586118 AAAATTTTTTTTAAGAGACAGGG - Intronic
1084730576 11:71070673-71070695 AAAACTTTATTTACAAAACAGGG - Intronic
1085597434 11:77822018-77822040 AAAATATTAGTTATCAAAAAAGG + Intronic
1085836086 11:79958128-79958150 ATAATCTCATTTATGAAACACGG - Intergenic
1085992855 11:81871496-81871518 AAAATGCTAGTTGTAAAACATGG - Intergenic
1086197411 11:84157433-84157455 AAAATTTTATTTTTTAAAGATGG + Intronic
1086380017 11:86243016-86243038 AAAATGTTTCTGATGAATCAGGG - Intergenic
1086382301 11:86268915-86268937 AAAATTTTATTTATAAAAACAGG + Intronic
1086547064 11:88010029-88010051 ATAATTTTGTGTATGAAACAAGG + Intergenic
1087146318 11:94815674-94815696 TAAAAGTTATTTATAAAACAAGG + Intronic
1087259968 11:96000325-96000347 AAAATTTTATTTACCAAAAACGG - Intronic
1087414010 11:97829511-97829533 AATATGTTATGTATTATACAGGG - Intergenic
1087534700 11:99428198-99428220 CAAAGGTTGTTTATAAAACAAGG - Intronic
1087841117 11:102922209-102922231 AAAATTTTGATTATGAAGCAAGG + Intergenic
1087918162 11:103833904-103833926 AAAATTTGATTTATGAATCTGGG - Intergenic
1087986870 11:104693272-104693294 AATATTTTATTCATAAAACAAGG + Intergenic
1088023343 11:105147210-105147232 AAAATGTTATTTTTGAATAAAGG + Intergenic
1088127092 11:106440704-106440726 AAAATGTTAATGATGAATCTAGG - Intergenic
1088435521 11:109808143-109808165 AGAATGTTATTTTTGATAAATGG + Intergenic
1088605709 11:111529164-111529186 AAAATTTTATTTTTCAATCATGG - Intronic
1088872469 11:113902752-113902774 AAAATGTTCTTTATAACAAAAGG + Intergenic
1089516525 11:119035839-119035861 AAAATTTTTCTTTTGAAACACGG - Intergenic
1089600246 11:119609818-119609840 AAAATTTTATTCATAAAACCAGG - Intergenic
1089825103 11:121268124-121268146 AAAATTTTATTTATAAAAATGGG + Intergenic
1090026744 11:123174073-123174095 AAAAAATTTTTTTTGAAACAGGG - Intronic
1090593523 11:128296288-128296310 AAGATGTTATCTATGAAATTAGG - Intergenic
1090865806 11:130699459-130699481 AATCTTTTATTTTTGAAACAGGG - Intronic
1090947545 11:131445113-131445135 AAAATGTTTTATATTAAAAATGG - Intronic
1091818587 12:3457652-3457674 AAAATGTTTTTCATGCAGCAAGG - Intronic
1091909566 12:4218205-4218227 AAAAGGTTGTTTATGTAACCAGG + Intergenic
1092027414 12:5253991-5254013 AAAATGTTATCTCTCCAACATGG - Intergenic
1092371911 12:7923605-7923627 AAAATTTTTTTTTTGAGACAGGG - Intronic
1092702658 12:11249364-11249386 AAAATTTTTTGTATGATACAGGG + Intergenic
1092847608 12:12598321-12598343 TAAATATTATTTGAGAAACATGG - Intergenic
1093073326 12:14730423-14730445 AAAATATCCTTTATGAATCAAGG - Intergenic
1093250316 12:16794683-16794705 AAAATTTTATTTACGAAAACAGG - Intergenic
1093362639 12:18249506-18249528 TCAATTTAATTTATGAAACATGG - Intronic
1093624866 12:21333116-21333138 AAAATCTGATTTATAAAACTAGG - Intronic
1093914224 12:24782962-24782984 AAAATAATATCTATGATACAGGG - Intergenic
1094199726 12:27783180-27783202 AAAATGTTATTAATAAACTAAGG + Intronic
1094200543 12:27791052-27791074 ACTAATTTATTTATGAAACAGGG - Intronic
1094235349 12:28158975-28158997 AAAATTTTATTAATGAAAGAAGG - Intronic
1094468002 12:30774564-30774586 TAAAGGTTATATATAAAACAAGG + Intergenic
1094560265 12:31546244-31546266 AAAATGTTATTTATTAAGCACGG + Intronic
1094690607 12:32764759-32764781 AAATGGGTATTTTTGAAACAGGG + Intergenic
1095210091 12:39483750-39483772 AAAATGTTACTGATGAATCATGG + Intergenic
1095226941 12:39688561-39688583 AAACTGTTATATATCATACAAGG - Intronic
1095874278 12:47063530-47063552 AATATGTTTTTTGTGACACAGGG + Intergenic
1096249287 12:50017737-50017759 AAAATTTTATTTAGGAAATAAGG - Intronic
1096554028 12:52392226-52392248 AAAATGTTTTTTAAGCGACAAGG + Intergenic
1096658970 12:53110892-53110914 TAAAGGTTATATATAAAACAAGG - Intronic
1097092180 12:56515267-56515289 AAAATGTTACTAATTAAAAATGG - Intergenic
1097465243 12:59914803-59914825 AATATATTCTTTATGAGACAGGG - Intergenic
1097489331 12:60245392-60245414 TAAATGTTATTTCTGAAACCAGG + Intergenic
1097698746 12:62799635-62799657 AAAAGATTATTTAGGAAAAAGGG - Intronic
1097698802 12:62800042-62800064 TAAATGTTATCTCTGTAACAAGG + Intronic
1097724739 12:63062606-63062628 AAAATGGCATTTATCAAATAGGG - Intergenic
1097824786 12:64163925-64163947 AAAAACTTATTTATGAATCTGGG - Intergenic
1098265019 12:68709326-68709348 AAATTTTTTTTTATGAAACATGG + Intronic
1098408692 12:70154933-70154955 TAAAGGTTATATATAAAACAAGG + Intergenic
1098666186 12:73166080-73166102 TAAAGGTTATATATAAAACAAGG + Intergenic
1098857488 12:75669237-75669259 AAAATCTAATTCATGAAAAAGGG + Intergenic
1098885671 12:75958368-75958390 AAAATCTGGTTTATGAACCATGG + Intergenic
1098885700 12:75958747-75958769 AAAATCTGGTTTATGAACCATGG - Intergenic
1099027371 12:77482139-77482161 AAAATCATATTTATAAAATATGG + Intergenic
1099472205 12:83064835-83064857 AGAATGTTTTTTATGAATAAAGG - Intronic
1099543120 12:83940063-83940085 AAAAAGTAATTTAGGAAAAAAGG + Intergenic
1099703354 12:86118109-86118131 AAAATGTTATTCATGTATCCTGG - Intronic
1099710398 12:86216514-86216536 AAAATGTTAGTTATGTGCCAAGG - Intronic
1099767081 12:87000199-87000221 TAAAGGTTATGTATAAAACAAGG + Intergenic
1100084198 12:90887645-90887667 AAAATATTATTTATGAAATGTGG + Intergenic
1100411033 12:94320133-94320155 AAAATGTTTTGTCTGAAACTAGG + Intronic
1100491120 12:95079112-95079134 CAATTGTTATTTATGTAACCTGG - Exonic
1100534375 12:95492963-95492985 AAAATTTTATTTATAAAACAGGG + Intronic
1100676385 12:96873151-96873173 AACATGGTATTTCTGGAACAAGG + Intronic
1100764684 12:97850701-97850723 AAAATATTATATATGAAAAGTGG + Intergenic
1100845251 12:98651819-98651841 AATTATTTATTTATGAAACAGGG + Intronic
1100889655 12:99110698-99110720 TAAATGTTCTTTCAGAAACATGG + Intronic
1101133513 12:101713977-101713999 GAAATGTTCTTTATAACACACGG + Intronic
1101294717 12:103409893-103409915 TAAATGTGTTTTATGAAACCAGG + Intronic
1101526071 12:105532171-105532193 AACACGGTATTGATGAAACAAGG + Intergenic
1101844462 12:108351376-108351398 AAAACCTTATTTATGAACCCTGG - Intergenic
1102401248 12:112631519-112631541 AAAATTTTTTTTTTGAGACAGGG + Intronic
1102791126 12:115646458-115646480 AACATGGTATATATGCAACATGG - Intergenic
1103413844 12:120731285-120731307 AAAATTTTCTTTTAGAAACAGGG + Intronic
1103747878 12:123138431-123138453 ACATTTTTATTTTTGAAACAGGG - Intronic
1104261137 12:127183241-127183263 ACAATGGTATGTATGATACAGGG + Intergenic
1104764861 12:131322391-131322413 TAAAGGTTATGTATAAAACAAGG - Intergenic
1105362996 13:19738081-19738103 AAAAAATTATTTAAGAGACAAGG - Intronic
1106002248 13:25735068-25735090 AAAATGTAATTTATTTAATATGG + Intronic
1106195881 13:27493516-27493538 AACACTTTATTTATGAAACCAGG + Intergenic
1106309194 13:28538696-28538718 AAAAGGTTATTTTTAAAACCTGG + Intergenic
1106687892 13:32080953-32080975 AAACTATTATTTTGGAAACATGG - Intronic
1106744060 13:32680797-32680819 AAATTGTTTTTTAAGAGACAGGG + Intronic
1106789167 13:33137402-33137424 AAAACTTTATTTATGAAAGCAGG + Intronic
1106881526 13:34137067-34137089 AATGTGGAATTTATGAAACATGG + Intergenic
1107074110 13:36302488-36302510 AAAACGTTATTTATGAAAACAGG + Exonic
1107676532 13:42803406-42803428 AAAGTGTTATTTATGAAAACAGG - Intergenic
1107849766 13:44559415-44559437 AAAAAGTAATTTTTAAAACATGG + Intronic
1108033307 13:46259625-46259647 ATATTGTTATTTATTAAAGAAGG + Intronic
1108192731 13:47959226-47959248 AAAAAGTTTTTTATGAAACAAGG + Intronic
1108202281 13:48056027-48056049 AAAATGTTCTATCTGAAGCAAGG - Intronic
1108286778 13:48916626-48916648 AAAATTTTTTTTAAGAGACAGGG - Intergenic
1108383569 13:49877526-49877548 AAAATGTTATTTATGAAACAAGG + Intergenic
1108411858 13:50157227-50157249 AAAATTTTCATTATGAAACTTGG + Intronic
1108645604 13:52424206-52424228 TAAATGTATTTTTTGAAACATGG - Intronic
1108704269 13:52971100-52971122 AAAATGGAATTTATAAAACCAGG + Intergenic
1108735263 13:53277166-53277188 AAAACTTTATTTACAAAACAGGG - Intergenic
1108846821 13:54688382-54688404 AAAAGGTGATTTATGAAACAAGG + Intergenic
1108898987 13:55374199-55374221 AAAATGCTATTTATCCCACAGGG + Intergenic
1108908569 13:55512306-55512328 AACATGTTATTTATAAAAACAGG - Intergenic
1108927672 13:55773156-55773178 AAAATTTTATATTTGAAATAGGG + Intergenic
1109002418 13:56822659-56822681 TAAATCTTTTTTATGAAACCAGG + Intergenic
1109059436 13:57595278-57595300 AAAATGTAATTTTTGAAACATGG + Intergenic
1109286429 13:60414307-60414329 AAAATGTTATTTACAAAAACTGG - Intronic
1109287751 13:60431268-60431290 AATATTTTACTTGTGAAACAAGG + Intronic
1109302792 13:60606500-60606522 AAAACTTTATTTATGAAAACAGG - Intergenic
1109487409 13:63045095-63045117 ATAATGTTATATAAGAAACCAGG - Intergenic
1109562608 13:64072756-64072778 AAAATGTTTTTTATAAAGCAAGG + Intergenic
1109571681 13:64200469-64200491 TAAATGTTATTTGTATAACATGG - Intergenic
1109611923 13:64776761-64776783 AAAATTATATATATAAAACATGG + Intergenic
1109699310 13:66004953-66004975 AAAATTTGTTTTAAGAAACATGG - Intergenic
1109856829 13:68141064-68141086 TTAAATTTATTTATGAAACAAGG + Intergenic
1110093748 13:71488518-71488540 ACAAACTTATTTATGAAAGAAGG + Intronic
1110095566 13:71515492-71515514 CAAATGTTATTTATGAAGTCAGG - Intronic
1110125363 13:71935541-71935563 ATAATGTTATTTATTTAGCAGGG + Intergenic
1110239492 13:73251208-73251230 CAAATGGGATTTAAGAAACAAGG + Intergenic
1110447947 13:75608341-75608363 AAAATGTTGTTCATAATACATGG - Intergenic
1110807169 13:79769524-79769546 AAAATGTAATCAATGAAACCTGG - Intergenic
1110820678 13:79912029-79912051 AAAATGAAATTTATAAAAAAGGG - Intergenic
1110872916 13:80473509-80473531 ATAATGTTGTATTTGAAACAAGG + Intergenic
1111316074 13:86561874-86561896 AAAGTGTTATTTAAAGAACATGG + Intergenic
1111326432 13:86702777-86702799 AAAAAGTCATTTATAAAGCAGGG - Intergenic
1111552324 13:89830386-89830408 AACATTTTATTTTTGAGACAGGG + Intergenic
1111558115 13:89908087-89908109 AAAAGGTTATTTATGAAACAGGG + Intergenic
1111656369 13:91158979-91159001 AAAATTCTATTTATGAAGAAAGG + Intergenic
1111813512 13:93121147-93121169 TAAATGTTTTTTAAAAAACATGG - Intergenic
1111875072 13:93882659-93882681 AAAATGTTCTATTTGAAACTGGG - Intronic
1112413495 13:99184668-99184690 TAAAGGTTATATATAAAACAAGG - Intergenic
1112540932 13:100311790-100311812 ATAATGTGATTTATAACACATGG - Intronic
1112611640 13:100960738-100960760 ATAATTTTATTTATTAACCATGG + Intergenic
1112889827 13:104215484-104215506 GAAATGTTAATTATGATACTAGG - Intergenic
1113083130 13:106537691-106537713 AAAATGTTATTTTTGGAAGCTGG - Intergenic
1113985131 13:114308719-114308741 AAAATTTTTTTTTTGAGACAGGG + Intergenic
1114288121 14:21265005-21265027 AAAATTTTTTTTTTGAGACAGGG - Intronic
1114403160 14:22428874-22428896 AAAATGTTATTTCTAACAGAGGG - Intergenic
1114521356 14:23339448-23339470 TAAATGTTATGTGTAAAACAAGG + Intergenic
1114540402 14:23452458-23452480 TACATGTTATTAATGTAACATGG + Intergenic
1115203442 14:30876182-30876204 TAAATGCTATTTTTCAAACATGG - Intronic
1115596880 14:34917852-34917874 AAAATTTTTTTAGTGAAACAGGG - Intergenic
1115794496 14:36918413-36918435 AATAAGTTATTTAGGAAACTGGG - Intronic
1115799702 14:36979079-36979101 AAACTGTTTTTTTTGATACAGGG - Intronic
1116041355 14:39690111-39690133 AAAATGAGAATTATAAAACAAGG + Intergenic
1116132192 14:40869376-40869398 AAAATGTTATTAAAAAAATAAGG - Intergenic
1116382648 14:44290379-44290401 AAAATGTAATTTGTCAAAAAGGG - Intergenic
1117023758 14:51598704-51598726 ATAATGTTATTTGAGAAACATGG - Intronic
1117120266 14:52560148-52560170 GAATTGTTGTTTTTGAAACAGGG - Intronic
1117187686 14:53257992-53258014 TAAAGGTCATGTATGAAACAAGG - Intergenic
1117431792 14:55673503-55673525 AAAATAGGATTTATAAAACATGG - Intronic
1117492967 14:56270688-56270710 AAAATGATGTATATAAAACATGG - Intronic
1117509480 14:56435112-56435134 TAAAGGTTATTTATAAAACAAGG + Intergenic
1117690796 14:58302951-58302973 AAAATTTTTTTTTTGAGACAGGG - Intronic
1117877524 14:60270309-60270331 AAAACCTAATTTGTGAAACAGGG - Intronic
1117948082 14:61052501-61052523 AAAATGTTATTTTTCATCCAGGG - Intronic
1118095521 14:62532937-62532959 AAAATGCTATAAAGGAAACAGGG - Intergenic
1118178403 14:63465617-63465639 AAAAATTTTTTTTTGAAACAGGG - Intronic
1118207094 14:63732644-63732666 AACATGTTAATTATGAAGCATGG - Intergenic
1118371725 14:65143229-65143251 AAAATTTTATTTATGAACACTGG - Intergenic
1118530362 14:66697992-66698014 AAAATATTATTTATAAAACCAGG - Intronic
1118542100 14:66839936-66839958 TAAATATTATTTATTAAAGAGGG - Intronic
1118871247 14:69744206-69744228 TAAAGGTTATGTATGAAACAAGG - Intronic
1119352481 14:73977471-73977493 AAAATTTTATCTAGGAAAAATGG - Intronic
1119967802 14:78936343-78936365 AAATGGTTATTTATGAAAAGAGG - Intronic
1120168500 14:81225415-81225437 AAAATTTTTTTTTTGAGACAGGG - Intergenic
1120284563 14:82482515-82482537 AAAACTTTATTAATGAAAAAAGG - Intergenic
1120520117 14:85517491-85517513 AAAACTTTATTTACAAAACAAGG - Intergenic
1120541607 14:85758249-85758271 AAGATGTTATTTATTAAAATAGG + Intergenic
1120573424 14:86150618-86150640 AAAATGTTATTTACGAAATCAGG + Intergenic
1121147552 14:91598242-91598264 TAAAGGTTATATATAAAACAAGG - Intronic
1122186780 14:100004788-100004810 TAAAGGTTATGTATAAAACAAGG - Intronic
1122584867 14:102798631-102798653 AAAATTTTGTTTTTGAGACAGGG - Intronic
1122803298 14:104243706-104243728 AAAATTTTTTTTTTGAGACAGGG + Intergenic
1123777539 15:23595324-23595346 GAAAAGTTATTTATGAAACAAGG - Intronic
1124588132 15:31029101-31029123 AAAAGATTATTTTTCAAACATGG - Intronic
1124717901 15:32083733-32083755 AAAAGGTCATTTATGAAGGAAGG + Intronic
1124868116 15:33514067-33514089 AAAATGTTCTTACTGAAACCCGG + Intronic
1124942303 15:34229348-34229370 AAGTTATTATTTTTGAAACAGGG + Intronic
1124986562 15:34622279-34622301 AAAAAGTTCTTTATCACACAAGG - Intergenic
1125261632 15:37832413-37832435 TATATTTTATTTAAGAAACAAGG - Intergenic
1125348888 15:38746963-38746985 AAAAGCTTATTTTTGAAAAATGG - Intergenic
1125634396 15:41175085-41175107 AAAATTTTCTTTTTGAAACGGGG + Intergenic
1125668586 15:41452725-41452747 AAAATTTTTTTTTTGAAACAGGG - Intronic
1125683543 15:41548498-41548520 AAAATTTTTTTTATAGAACAGGG - Intergenic
1125809493 15:42525413-42525435 AAGATGTTCTTTCTGTAACAAGG - Intronic
1126077065 15:44921726-44921748 AAAATTTTTTTTTTGATACAGGG - Intergenic
1126336511 15:47591125-47591147 AAAGTGCCATTTATGAAGCAGGG - Intronic
1126450750 15:48806010-48806032 CAAATGTGATATATTAAACATGG + Intronic
1126835797 15:52663626-52663648 AAACTGTTTTTTCTGAGACAAGG + Intronic
1127270285 15:57394766-57394788 AAAATATTGTTCATGAAGCAAGG - Intronic
1127342344 15:58060751-58060773 AAAACTTTATTTATAAAACCAGG + Intronic
1127594204 15:60462003-60462025 AAAATGTTATTATTAAATCATGG - Intronic
1128027357 15:64449370-64449392 AAACTTTTATTTTTGAGACAGGG + Intronic
1128045082 15:64610639-64610661 AAATTATTATTTTAGAAACAGGG - Intronic
1128284022 15:66421140-66421162 AAATTTTTTTTTCTGAAACAGGG + Intronic
1128342584 15:66832968-66832990 AAAACTTTATTTATGAAAACAGG + Intergenic
1128958124 15:71971411-71971433 AAAATGTTGTTTTAGAGACAAGG - Intronic
1129025574 15:72570354-72570376 GAAATGTTATTCATAATACATGG - Intronic
1129084207 15:73071466-73071488 AAAATGTAATTTATGTATGATGG + Intronic
1129538892 15:76335557-76335579 TAAATGTTATTTATAATTCATGG + Intergenic
1129841662 15:78746945-78746967 AAAATATTTTTTTTGAAATAGGG - Intergenic
1130173467 15:81542772-81542794 AAAATATTTTTTGTGAAATAAGG + Intergenic
1130237612 15:82151379-82151401 AAAATCTTGTTTTTGAGACAGGG - Intronic
1130617178 15:85421859-85421881 CAAATGTTCCTTATGCAACATGG - Intronic
1131403410 15:92144612-92144634 AAAATATTCTTTATGCAAAAGGG + Intronic
1131764150 15:95657330-95657352 AAAATACTTTTTTTGAAACATGG + Intergenic
1131839669 15:96423111-96423133 AAATTCTTATTTTTGAAAGAAGG - Intergenic
1131901915 15:97097099-97097121 AAAATGTAATTTATTAAAAATGG - Intergenic
1132169623 15:99636351-99636373 AAAATTTTATTTTAGAGACAGGG + Intronic
1132274161 15:100552178-100552200 AAAAGGTCATTAATGAAAAAGGG + Intergenic
1133142755 16:3760096-3760118 AAATTATTATTTTTGAGACAAGG + Intronic
1133522308 16:6570963-6570985 ATAATGTTATTTTGAAAACAGGG - Intronic
1134148332 16:11785497-11785519 AAAATATTATTTTTGAGACAGGG - Intronic
1134480114 16:14611986-14612008 CAAATCTTATTTACAAAACAAGG + Intronic
1135225418 16:20652355-20652377 TAAGGGTTATATATGAAACAAGG + Intronic
1135379836 16:21986574-21986596 AAAGTCTTATTTTTGAGACAGGG - Intronic
1135740252 16:24969204-24969226 AACATGATATTTATGTAACAGGG - Intronic
1135786121 16:25350785-25350807 TACATGTTAGTTATGAAACTCGG + Intergenic
1135815245 16:25626733-25626755 AAAATGTTATTTACAAAAACAGG + Intergenic
1135964569 16:27025025-27025047 GAAATGTCATTCAAGAAACAAGG + Intergenic
1136665566 16:31808981-31809003 AAACTCTTATTTAAAAAACAGGG - Intergenic
1137593088 16:49705883-49705905 AAAATGTATTTTGAGAAACAAGG + Intronic
1138085575 16:54130979-54131001 AAAATATTTTTTGAGAAACAAGG + Intergenic
1138154937 16:54694368-54694390 AAAATTTTTTTTTTGAGACAGGG + Intergenic
1138632414 16:58308891-58308913 TAAAGGTTATATATAAAACAAGG + Intronic
1138723644 16:59111331-59111353 AGACTGTTATTTATGACACTAGG + Intergenic
1138736229 16:59253117-59253139 AAAATGTTGATTATGAAATATGG + Intergenic
1138786876 16:59857027-59857049 TAAGAGTTATATATGAAACAAGG - Intergenic
1138809335 16:60130116-60130138 AAAATTATATTTATGATAAAAGG - Intergenic
1138835050 16:60424161-60424183 AAAATTTTATTTAGAAAAAAGGG - Intergenic
1138977300 16:62223129-62223151 AAAATGTTATTTATGGCAACAGG - Intergenic
1139018078 16:62714505-62714527 AAAATTGTATATATTAAACATGG + Intergenic
1139677044 16:68530738-68530760 AAATTTTTATTTATAAAACCTGG - Intronic
1139735650 16:68985704-68985726 AAAATGTGTTTTTTGAGACAGGG - Intronic
1139770004 16:69266721-69266743 TTTATTTTATTTATGAAACAGGG + Intronic
1139807285 16:69577982-69578004 AAAATTTTTTTTTTGACACAGGG - Intronic
1139807879 16:69584778-69584800 TAAATTTTATTTTTGAGACAGGG - Intronic
1140002761 16:71041774-71041796 ATAATGTTACTTGTGTAACAAGG + Intronic
1140244896 16:73239144-73239166 AAAATACTATTTATGATACTTGG - Intergenic
1140311440 16:73852530-73852552 AAAATGTTTGTTATTAAAAAGGG + Intergenic
1140539408 16:75742406-75742428 AAAATGTTATTTATGAAACAAGG + Intronic
1140722331 16:77783440-77783462 GAAATGTTATTTAAGGAAGAGGG - Intergenic
1140834647 16:78781922-78781944 ATAATGTTATTTATTTTACAGGG - Intronic
1140890932 16:79284620-79284642 ATAATGTTAGTCATAAAACAAGG + Intergenic
1141414753 16:83861774-83861796 AAATTATTATTTTTGAGACAGGG - Intergenic
1142655992 17:1394597-1394619 AAAAATTTTTTTTTGAAACAGGG - Intronic
1143961345 17:10723483-10723505 AAAAAGTAATTTATGAATCATGG - Intronic
1144049571 17:11486953-11486975 AAAATGTTATTTATGAAAGCAGG - Intronic
1144138888 17:12326704-12326726 AAAATCTTATTACTGAAACTTGG - Intergenic
1144798572 17:17910020-17910042 AAAAAGTTTTTTAAGAGACAGGG - Intronic
1145355401 17:22141957-22141979 ATAATGTTATCTATGAAACCAGG + Intergenic
1145899886 17:28483628-28483650 AAAATTTTTTTTAAGAGACAGGG - Intronic
1146119636 17:30180740-30180762 AAAAATTTATTTATGAAAACAGG + Intronic
1146659580 17:34656199-34656221 AAAATGTTATTATTTCAACAGGG - Intergenic
1146897205 17:36551821-36551843 AAAATTTTTTTTTTGAGACAGGG - Intronic
1147681992 17:42255251-42255273 ACAATTTGTTTTATGAAACATGG + Intronic
1147847568 17:43415643-43415665 AAAATTTTATTTTTGAGACAGGG + Intergenic
1148283371 17:46366758-46366780 ATAATGTTATTTGTAAAGCATGG + Intergenic
1148288938 17:46424146-46424168 AATATTTTATTTATAAAATATGG + Intergenic
1148305589 17:46584679-46584701 ATAATGTTATTTGTAAAGCATGG + Intergenic
1148311107 17:46641723-46641745 AATATTTTATTTATAAAATATGG + Intronic
1148407325 17:47427856-47427878 AAAATTTTTTGTCTGAAACATGG - Intronic
1149005292 17:51798855-51798877 AAAATTTTAATTATGAATCTTGG - Intronic
1149476868 17:56969139-56969161 TAAAGGTTATATATAAAACAAGG + Intergenic
1149740691 17:59043073-59043095 GAAATATTATTTTTGAAAAATGG - Intronic
1149948569 17:60959298-60959320 AAAATTTTTTTTTTGAGACAGGG - Intronic
1150243142 17:63652005-63652027 AAAAAATTATTTAGGAAATAAGG - Intronic
1150357522 17:64499834-64499856 AGATAGTTATTTAAGAAACATGG - Exonic
1150533227 17:66008360-66008382 AAACTTTTATTTTTGAGACAGGG + Intronic
1150536232 17:66045075-66045097 AAATTTTTTTTTTTGAAACAGGG + Intronic
1150756568 17:67919530-67919552 AAAATTTTTTTTAAGAGACAGGG - Intronic
1151743419 17:75999332-75999354 AAAATTTTTTTTTTGAGACAGGG - Intronic
1151944872 17:77314161-77314183 AAATTTTTTTTTTTGAAACAGGG - Intronic
1152126086 17:78447857-78447879 AAAATGTTTTTAAAGAAACAGGG - Intronic
1152578440 17:81154274-81154296 AAAATTGGATTTATGAAAAAGGG - Intronic
1203173051 17_GL000205v2_random:169198-169220 AAAAAATTTTTTTTGAAACAAGG - Intergenic
1153243846 18:3054614-3054636 AAAATTTTTTTTTTGAGACAAGG + Intergenic
1153478462 18:5522506-5522528 AAAATGTTATTTGTCATATAAGG + Intronic
1153478482 18:5522928-5522950 AAAATTTTTTTTTTGCAACATGG + Intronic
1153682147 18:7510916-7510938 AAAATGTTATTTACAAAACCTGG - Intergenic
1153920768 18:9787348-9787370 TAAATGTGATTTATGTAGCAGGG + Intronic
1154316455 18:13307719-13307741 AAAATGTTATTTAAAAAATTAGG - Intronic
1154987569 18:21567893-21567915 AAAATGTTATATACCAAATAGGG - Intronic
1155263773 18:24072100-24072122 AAAATGTTTTCTAAGAAACATGG - Intronic
1155663551 18:28280325-28280347 AAAATATCATTTATTAAAAATGG - Intergenic
1155695608 18:28682166-28682188 AAAATTTTTTTTTTGAGACAGGG + Intergenic
1155735448 18:29217025-29217047 AAAATGTTAATTATAAAAACAGG + Intergenic
1155901274 18:31394063-31394085 ATAAAACTATTTATGAAACAGGG - Intronic
1156053878 18:32974005-32974027 TAAATGTTTTTATTGAAACAAGG + Intronic
1156139894 18:34094942-34094964 AAGATGTCATTTATGAAACCAGG - Intronic
1156644980 18:39150031-39150053 AAAAGGTTAATTATCAAACCAGG - Intergenic
1157145214 18:45155602-45155624 AAACTGTTGTTAGTGAAACATGG - Intergenic
1157147620 18:45180753-45180775 GAAATGATATTTTTGAAAAACGG + Intergenic
1157353146 18:46909263-46909285 AAACTTTTTTTTTTGAAACAGGG + Intronic
1157492088 18:48130643-48130665 AAAATTTTATTTATAAAAGGGGG - Intronic
1157872190 18:51240580-51240602 AAAAGCATATATATGAAACATGG + Intergenic
1157907448 18:51582301-51582323 ATATTTTTATTTTTGAAACAGGG + Intergenic
1158346111 18:56518764-56518786 ATAATAATATTTATCAAACAAGG - Intergenic
1158370845 18:56801945-56801967 AACATGAAATTTATGAAACCTGG - Intronic
1158583837 18:58710899-58710921 AATTTGTTTTTTCTGAAACAAGG + Exonic
1158683457 18:59590723-59590745 GAAATTTTGTATATGAAACATGG + Intronic
1158897162 18:61925262-61925284 AAAACTTTATTTACAAAACAAGG + Intergenic
1159083098 18:63757555-63757577 AAAATTTTATTTATAAAATCAGG - Intronic
1159098664 18:63935801-63935823 AAAATGATTTTTTTGAGACAGGG - Exonic
1159371226 18:67529940-67529962 AAAAGGCTATTAATGAGACAGGG - Intergenic
1159578120 18:70204744-70204766 ACATTGGTATTTATGAATCACGG + Intronic
1159865641 18:73701348-73701370 AAAATGTCATATATGATAAATGG - Intergenic
1160098613 18:75899868-75899890 AAAACTTTATTTATAAAACCAGG - Intergenic
1160275929 18:77435879-77435901 CAAATGTTTTTGAGGAAACAGGG - Intergenic
1160277949 18:77456114-77456136 TAAAAGTTATTTATAAAACAAGG - Intergenic
1160459635 18:79028604-79028626 AAAATGTTCTTCAGGAACCAAGG + Intergenic
1160484806 18:79280422-79280444 AAAAAGTTATTTAAGAAAGAGGG + Intronic
1161370010 19:3905852-3905874 AAAATTTTATTTTTGAGACAGGG - Intronic
1161648822 19:5471602-5471624 AAAATTTTTTTTTTGAGACAGGG - Intergenic
1162329301 19:10017639-10017661 AAAAAATTATTTTTGAGACAAGG - Intronic
1163286972 19:16354872-16354894 AAAAATTTTTTTTTGAAACAGGG - Intergenic
1163573317 19:18096233-18096255 AAAATTTTTTTTTTGAGACAGGG - Intronic
1164738106 19:30557022-30557044 AAAGTGTTATTTATAAAATTTGG - Intronic
1164954796 19:32373024-32373046 AAGGTGTTATTTATGAAGCAGGG - Intronic
1165137730 19:33680747-33680769 AAAATGTTTCTTATACAACAGGG + Intronic
1165368563 19:35386626-35386648 GGAAAGTTATTTATGAAACAAGG - Intergenic
1166672120 19:44716898-44716920 CAAATGTTATCTTTGAAGCAGGG - Intergenic
1166904122 19:46092631-46092653 AAAATTTTTTTTTTGAGACAGGG - Intergenic
1167178950 19:47887179-47887201 CAAATATTATTAAGGAAACAGGG - Intergenic
1167206149 19:48103910-48103932 AAAATTTTTTTTTTGAGACAGGG + Intronic
1168611905 19:57807624-57807646 TATATTTTATTTTTGAAACAGGG + Exonic
1168630908 19:57955372-57955394 AAAATTTAATTTAGGAAAGATGG + Intergenic
1168672620 19:58252525-58252547 AAAGGGTTATTTATGAAACAAGG - Intronic
925636237 2:5943413-5943435 AAAATGTTCTCTATCCAACAGGG + Intergenic
925762887 2:7203573-7203595 TAAATATTATTTATGCATCAAGG - Intergenic
926469101 2:13230818-13230840 AATATGCTAGTTATGAAACTAGG - Intergenic
926786942 2:16527275-16527297 AAAACTTTATTTATGAAATCAGG - Intergenic
926814707 2:16788937-16788959 AAATTTTTTTTTATGAGACAAGG + Intergenic
926894575 2:17670865-17670887 ACAATTTTTTTTCTGAAACAGGG + Intronic
927168479 2:20349275-20349297 AAAATTTTATTTCAGAAACCTGG - Intronic
927704746 2:25290153-25290175 AAAATTTTTTTTTTGAGACAAGG + Intronic
927762980 2:25777093-25777115 TATATGTTATTTTTGAGACAGGG + Intronic
927764002 2:25787006-25787028 AATATGTAATTTATGAATAATGG - Intronic
927962017 2:27246784-27246806 AAAATTTTGTTTTTGAGACAGGG + Intergenic
928104539 2:28459692-28459714 AAAAAGTTTTTTAAGAGACAAGG - Intronic
928117183 2:28554332-28554354 GAAATTTTTTTTTTGAAACACGG + Intronic
928221153 2:29403903-29403925 AAAATTTTTTTTTTGAGACAGGG - Intronic
928223857 2:29430548-29430570 AAAATTTTATTTATAAAACCAGG + Intronic
928539735 2:32273295-32273317 AAAATTTTTTTTTTGAGACAGGG - Intergenic
928746668 2:34423695-34423717 AAAATATTATTTATGAAACTGGG - Intergenic
929187578 2:39111317-39111339 AAAATGTTAATTATAAAATCTGG + Intronic
930062279 2:47300083-47300105 AAAATTTTTTTTTTGAGACAGGG - Intergenic
930187180 2:48421722-48421744 ATAATGTTTTTGATGAAATAAGG - Intergenic
930455505 2:51603646-51603668 AAAATGTGTTTTATGAATCTTGG + Intergenic
930504560 2:52266426-52266448 TAAAGGTTATATATAAAACAAGG + Intergenic
930537205 2:52658146-52658168 AAAATGTTACTGTAGAAACATGG - Intergenic
930652939 2:53980344-53980366 AAAATTTTTTTTTTGAGACAGGG - Intronic
930716338 2:54597087-54597109 AAAATGTCTTTAATGAAGCAAGG - Intronic
930763989 2:55065195-55065217 AAAATGCTATTTATGTAAGCTGG - Intronic
930828945 2:55722832-55722854 TAGATATTATCTATGAAACAAGG - Intergenic
931099799 2:58984458-58984480 TAAGTGTTATTTATGAATGATGG - Intergenic
931295540 2:60920929-60920951 AAAATGTTATTTATAAAAACAGG - Intronic
931370916 2:61661787-61661809 AAATTTTTATTTTTGAGACAGGG + Intergenic
931383856 2:61778775-61778797 AAAATTTTTTTTAAGAGACAAGG + Intergenic
931396607 2:61893216-61893238 AAAATATACTTAATGAAACAAGG - Intronic
931754973 2:65365013-65365035 AAAATGTTGTTAATAAAAAATGG + Intronic
931954269 2:67400426-67400448 AAAATTTTTTTTAAGAGACAGGG - Intronic
932518071 2:72374061-72374083 AAAATTTTTTTTTTGAGACAGGG - Intronic
932814742 2:74852659-74852681 TAATTGTTATTTTTGAGACAGGG - Intronic
932923706 2:75945536-75945558 AAAACTTTATTTATAAAACCAGG + Intergenic
933108744 2:78370089-78370111 AAATTGTTGATTAAGAAACATGG - Intergenic
933312441 2:80677438-80677460 TAAATGTTATTGGGGAAACAAGG + Intergenic
933472194 2:82740139-82740161 ATATTGTTATATATTAAACAAGG - Intergenic
933478823 2:82827471-82827493 AGTATTTTCTTTATGAAACAGGG - Intergenic
933686345 2:85144593-85144615 AAAATTTTTTTTTTGAGACAGGG - Intronic
933899399 2:86838503-86838525 AAAAATTTATTTTTGAGACAAGG + Intronic
934082114 2:88477694-88477716 AAAATTTTTTTTTTGAGACAGGG - Intergenic
934834181 2:97567633-97567655 TAAATTTTATTTATGGACCATGG - Intronic
934844269 2:97652146-97652168 AAGTTATTATTTTTGAAACAGGG + Intergenic
934864267 2:97791944-97791966 AAAACTTTATTTATAAAACCAGG + Intronic
935570628 2:104657033-104657055 AGAATGTTATTGATATAACACGG - Intergenic
935781162 2:106510723-106510745 AAAAATTTATTTTTGAGACAAGG - Intergenic
935962577 2:108441718-108441740 AAAAAGTTATTTATAAAATAAGG - Intergenic
936166537 2:110124989-110125011 AAAACTTTATTTATGAAAAGAGG - Intronic
936477966 2:112857323-112857345 GAAAAGTTATGTATAAAACAAGG + Intergenic
936973571 2:118197544-118197566 AAAAGTTTATTTATGGAAGATGG + Intergenic
937191633 2:120107039-120107061 AAAATGTTATTTATAACACTTGG + Intronic
937786164 2:125901190-125901212 GCAATGTTTTTTATGACACATGG + Intergenic
938033855 2:128019273-128019295 AAAATTTTTTTTTTGAGACAAGG + Intronic
938176066 2:129130458-129130480 AAAAGGTTACTTATGAAACAAGG + Intergenic
938226452 2:129620433-129620455 GAATTGTCATTTATAAAACAGGG - Intergenic
938400003 2:130982781-130982803 AAAAGATTATTTATGAAACAAGG - Intronic
938603993 2:132873416-132873438 AAAATGTTTTTTAAGAATAAGGG + Intronic
938806585 2:134811819-134811841 AAAATTTTTTTTTTGAGACAGGG - Intergenic
939105390 2:137942927-137942949 CAAATGATATTTCTCAAACAGGG - Intergenic
939230096 2:139413339-139413361 AATATGTTATTTAGAAAATAAGG - Intergenic
939973739 2:148692132-148692154 GAAATGTTAAATATGAAAGAAGG - Intronic
940178948 2:150910341-150910363 AAATTCTTATTTATAAAATATGG + Intergenic
940250739 2:151673355-151673377 AAACTCTTATTTATGAATTAAGG - Intronic
940300733 2:152174572-152174594 CAAATGTTAACTATGAAACAGGG + Intronic
940358708 2:152773755-152773777 AAAATCTTTTTTTTGAGACAGGG + Intergenic
940755758 2:157680961-157680983 AAAATGTTAGTGGTCAAACATGG - Intergenic
940976849 2:159955752-159955774 AAAATGATGATTATGAAACATGG - Exonic
941052770 2:160753636-160753658 AAAATTTTATTTATAAAAACAGG + Intergenic
941331923 2:164188564-164188586 AAAAAGTTATCTCTGAACCATGG + Intergenic
941736434 2:168981865-168981887 AAAATGTTATTTATAAAAACAGG + Intronic
942242234 2:173973104-173973126 AAATTTTTATTTTTGAGACACGG - Intergenic
942270968 2:174274636-174274658 AACATGTTATTAATTATACATGG - Intergenic
942274773 2:174312569-174312591 AAAATGTTATTTTTAAAATAAGG - Intergenic
942342721 2:174965849-174965871 ATAAAGTGATTTTTGAAACAAGG + Intronic
942494193 2:176521792-176521814 ACAATTTTATTAATGAAAAATGG - Intergenic
942656022 2:178214771-178214793 AAAATTTTTTTTAAGAGACAGGG - Intronic
942765614 2:179452916-179452938 AAAATTTTACTTATGAAAATAGG + Intronic
942783631 2:179675195-179675217 AAAATCTTATTTAGAAAATAAGG + Intronic
943087250 2:183327053-183327075 AGCATGTTATATATAAAACATGG - Intergenic
943247196 2:185471394-185471416 AAAATATAATTTTTCAAACAAGG + Intergenic
943314775 2:186373637-186373659 AAAATCTTAAATATGAAAGAAGG - Intergenic
943385620 2:187201176-187201198 AAAATGTTCTTTACAAAATAAGG + Intergenic
943406065 2:187487655-187487677 AAAATGTTATCAATGGATCAGGG - Intronic
943505718 2:188754545-188754567 TAACTTCTATTTATGAAACATGG - Intronic
943682940 2:190786818-190786840 AAAATGTGAATTCTGAAATAGGG + Intergenic
943798997 2:192034195-192034217 AAAATCATATTTATAAAAAAAGG - Intronic
943813864 2:192226071-192226093 AAAAAATTAATTAAGAAACATGG + Intergenic
943980051 2:194538660-194538682 AATATGACATTTATGATACATGG - Intergenic
944080418 2:195781687-195781709 AAAATCTTAGTTATCAAAAAGGG + Intronic
944354818 2:198774670-198774692 GAAATTTGGTTTATGAAACAAGG - Intergenic
944563706 2:200966263-200966285 AAAATCTAATCTATGAAACAGGG + Intergenic
945074109 2:206020588-206020610 AAAATTTAAATAATGAAACATGG - Intronic
945366026 2:208955180-208955202 AAAAGGTTATTTATGAAACAAGG - Intergenic
945460043 2:210096181-210096203 AAAATGTAATTTAGTAAACATGG + Intronic
945601544 2:211872119-211872141 CAAATGTTATTTAGCAAGCACGG - Intronic
945702431 2:213188759-213188781 AATATGTTATTTATATAACAAGG + Intergenic
945712177 2:213311706-213311728 AAAATGTTTCATATGAAATAAGG - Intronic
945718831 2:213392422-213392444 ATAATTTTATTTATCACACATGG + Intronic
945725570 2:213469419-213469441 AACATGTTTTTAATGAAAGAAGG + Intronic
945968587 2:216214452-216214474 TAAAGGTTAGTTATGAAAGAAGG - Intergenic
946215787 2:218182474-218182496 AAAATTTTTTTTTTGAGACAGGG - Intergenic
946256670 2:218447318-218447340 AAAATCTTTTTTTTGAGACAGGG + Intronic
946271853 2:218600891-218600913 ACTATATTATTTATGAGACAAGG + Intergenic
946846111 2:223860310-223860332 AAAATGTTCTTTATGAACCAGGG + Intronic
946878796 2:224157354-224157376 AAAATTTTTTTAAAGAAACAGGG + Intergenic
946981264 2:225218504-225218526 TAAATGTTATTTTTGCCACATGG + Intergenic
947303867 2:228721629-228721651 ATAATATTATAAATGAAACATGG - Intergenic
947483486 2:230524981-230525003 AAAAGGTTATTTATGAAACAAGG + Intronic
947749663 2:232525691-232525713 TAAATGTTATTTATAATACACGG + Exonic
947775756 2:232707966-232707988 AAAATATTTTTTTTGAGACAAGG + Intronic
948513855 2:238490562-238490584 AAAATTTTATTTTGGAGACAGGG + Intergenic
1168844153 20:931826-931848 AAATGTTTACTTATGAAACAAGG - Intergenic
1168873198 20:1148427-1148449 AAACTGTTTTTTACAAAACATGG - Intronic
1169570083 20:6896868-6896890 AAACTATTATTTTAGAAACAAGG - Intergenic
1170477315 20:16729017-16729039 AAAATGTTATTTCTGAATTCTGG - Intergenic
1170497289 20:16938443-16938465 AAAACTTTATTTATGAAAACAGG - Intergenic
1170659628 20:18324533-18324555 CAAAGGTTATTTATGAAACAAGG + Intergenic
1170667225 20:18397142-18397164 AAAATTTTATTTATAAAATTGGG + Intronic
1171038237 20:21734312-21734334 AAAATGTTATATATATAACATGG - Intergenic
1171086798 20:22245211-22245233 AGAATGTTATTTATTGAACAGGG - Intergenic
1171242557 20:23583539-23583561 AAAATATTAGTAATGAAAAAGGG - Intergenic
1171497583 20:25567097-25567119 AAAATTTTTTTTTTGAGACAGGG - Intronic
1172147932 20:32770117-32770139 AAAAAATTATTTTTGAGACAGGG + Intronic
1172152705 20:32801589-32801611 AAAATATTTTTTTTGAGACAGGG + Intronic
1172294887 20:33802504-33802526 AAAACCTTAATTATGAAACTTGG - Intergenic
1172319852 20:33987764-33987786 AAAATTTTTTTTTTGAGACAAGG - Intergenic
1172462439 20:35130073-35130095 AAATTTTTATTTTTGAGACAGGG + Intronic
1172634784 20:36402732-36402754 AAATTTTTTTTTATGAGACAGGG - Intronic
1173156302 20:40613724-40613746 AAATGGTTATTGATGAAAAAGGG - Intergenic
1173273451 20:41557375-41557397 AAAATGTTCTTATTGAAACCTGG - Intronic
1173372371 20:42448554-42448576 AAAACTTTATTTATGAAAACAGG + Intronic
1174173546 20:48631315-48631337 AAAACTTTATTTACAAAACAGGG + Intronic
1174313682 20:49679824-49679846 AATAGGTTATTTAGGAAATATGG + Intronic
1174663052 20:52232027-52232049 AAAATGTTACTATTGAAACTAGG - Intergenic
1174826547 20:53773711-53773733 AAAATCTTATTTATAAAAACAGG - Intergenic
1174952587 20:55059149-55059171 AAAACTTTATTTATAAAACCAGG + Intergenic
1174954125 20:55077146-55077168 AAAATGTATTATATAAAACATGG + Intergenic
1175040718 20:56048018-56048040 AAAACTTTATTTATGAAAACAGG + Intergenic
1175235522 20:57507947-57507969 AAAAAGTTATTTTAGAGACAGGG + Intronic
1175532134 20:59681064-59681086 AAAACTTTATTTAAAAAACAAGG - Intronic
1175563102 20:59949610-59949632 AAATTGCATTTTATGAAACAGGG - Intergenic
1176329034 21:5530839-5530861 AAAAAATTTTTTTTGAAACAAGG - Intergenic
1176398723 21:6290112-6290134 AAAAAATTTTTTTTGAAACAAGG + Intergenic
1176438434 21:6698992-6699014 AAAAAATTTTTTTTGAAACAAGG - Intergenic
1176462696 21:7026062-7026084 AAAAAATTTTTTTTGAAACAAGG - Intergenic
1176486257 21:7407840-7407862 AAAAAATTTTTTTTGAAACAAGG - Intergenic
1176785104 21:13246889-13246911 AAAGTGTGATTTCAGAAACAGGG + Intergenic
1176911128 21:14566542-14566564 AAAATTTTTTTTTTGAGACAGGG + Intronic
1177078476 21:16608493-16608515 AAAATGTTATTTATAAAACTAGG + Intergenic
1177370976 21:20202690-20202712 AATAAGTGATTTTTGAAACAAGG - Intergenic
1177509788 21:22070810-22070832 AAAATGTCAATCATGAAAAATGG - Intergenic
1177550045 21:22608850-22608872 TAAAGGTTATATATAAAACAAGG - Intergenic
1177589319 21:23142268-23142290 TAAAGGTTATGTATAAAACAAGG - Intergenic
1177602292 21:23331349-23331371 AAAATGCTATTTGTTAAATATGG + Intergenic
1177828943 21:26115301-26115323 AAAATTTTACTTGAGAAACATGG - Intronic
1177878471 21:26664493-26664515 AAAAGGTTATTTATGAAACAAGG - Intergenic
1177972936 21:27812519-27812541 ACAATGTTATTTATAAAATGAGG + Intergenic
1178188837 21:30256843-30256865 ATAATATTATTTTTGAGACAGGG + Intergenic
1178690302 21:34744777-34744799 AAAAAATTTTTTTTGAAACAAGG + Intergenic
1178940917 21:36904873-36904895 AAAATGTTACTGAAGAAAAAAGG + Intronic
1179651795 21:42815608-42815630 TAAATGTTATGTATACAACAGGG - Intergenic
1179993606 21:44961949-44961971 AAAATTTTATTTAGGAAAGTGGG + Intronic
1180687756 22:17683178-17683200 AAAAGGTTATTATTGAAAGAGGG - Intronic
1181296250 22:21841872-21841894 AAAATTTTATTTTAGAGACAGGG - Intronic
1181481244 22:23200562-23200584 AAAAAATTTTTTTTGAAACAAGG + Intronic
1181691143 22:24561679-24561701 AAAATGTTATTGAACAAGCAAGG - Intronic
1182568004 22:31213751-31213773 AAAATCTTTTTTAAGAGACAAGG - Intronic
1183072172 22:35403758-35403780 AAAATGTTAATTATTAAATCTGG - Intronic
1183112871 22:35664849-35664871 AAAAGGTTATATATAAAACAAGG + Exonic
1183498030 22:38161544-38161566 AAAGTGTTATGTAGGAAAGAGGG + Intronic
1184496432 22:44845040-44845062 AAAGGGATATTTATGATACAGGG - Intronic
1184576712 22:45374013-45374035 TAAAGGTTATGTATAAAACAAGG + Intronic
1184851981 22:47126287-47126309 AAGATGTTTTTTAAGAAAGAGGG + Intronic
1185027379 22:48423276-48423298 AAAACTTTATTTATAAAACCGGG + Intergenic
1185405750 22:50648689-50648711 TAAAGGTTATATATAAAACAAGG + Intergenic
949131281 3:504211-504233 AAAATGTTATTTAAGACCTATGG - Intergenic
949420807 3:3863824-3863846 AAAATGTTCTTTAAAAAACTTGG + Intronic
949529802 3:4944606-4944628 AAAATGATATTTAGAAACCAAGG - Intergenic
949673908 3:6430892-6430914 TAAATGTTATTTATGAAGAATGG + Intergenic
949822409 3:8130228-8130250 AAATTGTTATGTTTGAAAGATGG + Intergenic
949950030 3:9221356-9221378 AAAATGTTTTTGTAGAAACAGGG - Intronic
950065889 3:10111453-10111475 GAAATGTTGTTGATGCAACAAGG - Intergenic
950204360 3:11067173-11067195 AAATGGTTATTTATGAAACAAGG + Intergenic
950220625 3:11192706-11192728 AAAATTTTATTTTAGAGACAGGG - Intronic
950373029 3:12547173-12547195 GAAATGTTATGTGAGAAACAAGG - Intronic
950600148 3:14028039-14028061 TAAAGGTTATGTATAAAACAAGG - Intronic
950918963 3:16673967-16673989 TAAATGTCATATATAAAACAAGG + Intergenic
950974774 3:17228959-17228981 AAAATATTATTCATGGGACATGG - Intronic
951174992 3:19588838-19588860 AAAACATTTTTTTTGAAACAGGG + Intergenic
951195652 3:19820433-19820455 AAAATATTATGTATCAAACACGG - Intergenic
951306507 3:21069410-21069432 AACATATTATTTATGTAACTTGG - Intergenic
951496608 3:23335535-23335557 AAAAGGTTTTTTAAGAGACATGG + Intronic
951813921 3:26731691-26731713 AAGATGTCATTTATAAGACAAGG - Intergenic
952072104 3:29649695-29649717 ACATTGTCATTCATGAAACAAGG + Intronic
952116952 3:30194119-30194141 AAAATATCTTTTATGAAACAGGG + Intergenic
952313652 3:32213393-32213415 AAAATTTTTTTTTTGAGACAGGG + Intergenic
952876359 3:37947850-37947872 AACATGTTTGTTATTAAACAAGG - Intronic
952949976 3:38515073-38515095 AAAAAGTTATCTATAAAAAAGGG - Intronic
953251990 3:41253068-41253090 AAAATATTATTTAGGAATGAAGG + Intronic
953450751 3:43003749-43003771 AATATGTTCATTATAAAACATGG - Intronic
953470226 3:43159928-43159950 AAAATGTGATTTCTCAACCATGG - Intergenic
953720929 3:45354542-45354564 AAAATTTTTTTTTTGAAACAGGG - Intergenic
953802602 3:46037285-46037307 AAAATGTTATTTATGAAACAAGG + Intergenic
954061294 3:48069978-48070000 AAAATTTTTTTTCTGAGACAGGG + Intronic
954348597 3:50023092-50023114 AAAATCTTTTTTTTGAGACAGGG - Intronic
954928343 3:54257637-54257659 AAAAGCTTATTTGTGAAAGAGGG + Intronic
955388330 3:58498284-58498306 AAAAGGTCATTTAAGAAAAAGGG - Exonic
955661653 3:61305803-61305825 AAAATTTTATTTAAAAATCATGG - Intergenic
955739167 3:62071577-62071599 AAAATATCATTAATGAGACAAGG - Intronic
955805963 3:62734887-62734909 AAAATTTTACATTTGAAACATGG + Intronic
956415788 3:69027566-69027588 AAAATGATACTTATAAAGCAGGG + Intronic
956416506 3:69036440-69036462 AAACTGTCATTTATGTAAAAAGG + Intronic
956441163 3:69281518-69281540 AAAATTTTATGTATGAAATGTGG - Intronic
956847955 3:73201350-73201372 AAAATGTCCTTTATGATTCATGG - Intergenic
957197358 3:77086587-77086609 AAAATGTGATTCATAAATCATGG - Intronic
957207616 3:77217851-77217873 AAACTGTTATTTCATAAACAAGG + Intronic
957227078 3:77463528-77463550 AAAATTTTATATATGGGACAGGG + Intronic
957438578 3:80212185-80212207 AAAATGTTAGAAATAAAACAAGG - Intergenic
957508978 3:81162921-81162943 AAAATGCAATTTCTGAAACTAGG - Intergenic
957819109 3:85346560-85346582 AAAATATTATTAATGAGAAAAGG + Intronic
957836618 3:85601266-85601288 GAAATATTATTTTTGAAATATGG + Intronic
957864135 3:86000346-86000368 AAAATCTTTTTCAGGAAACATGG - Intronic
957880873 3:86211481-86211503 AAAATTTTTTTTAAAAAACAGGG + Intergenic
958009633 3:87860151-87860173 AGAATGTTATTAATGTAAAATGG - Intergenic
958169526 3:89921079-89921101 GAAAAGTCATTTATGAAATAAGG - Intergenic
959232305 3:103670090-103670112 AAAATGTTATTTAATAATCCAGG + Intergenic
959321487 3:104880951-104880973 TAAATGTTATATATGAAAAAGGG - Intergenic
959372102 3:105539751-105539773 AAATTGATTTTTATGTAACAGGG + Intronic
959602658 3:108205736-108205758 AATATGTTATATATTAATCAAGG - Intronic
959980641 3:112512716-112512738 TAAAGGTTATGTATAAAACAAGG - Intergenic
960271679 3:115681071-115681093 TAAATGCTGTTTATAAAACATGG + Intronic
960328367 3:116325306-116325328 TAAATATTATTTCTTAAACAAGG + Intronic
960537782 3:118832269-118832291 AATTTGTTATTTTTGAAACAGGG - Intergenic
960562349 3:119098444-119098466 ACAATTTTTTTCATGAAACAGGG + Intronic
960648856 3:119923318-119923340 AAAACATTTTTTATGAACCAAGG - Intronic
960796192 3:121491042-121491064 AAAATTTTTTTAATGAGACAGGG - Intronic
960815802 3:121671012-121671034 AAAACCTTATTTATGATAAAAGG - Intronic
961322686 3:126087533-126087555 TAAAGGTTATGTATAAAACAAGG + Intronic
961490112 3:127250453-127250475 TAAAAGTTATTTATAAAAGAAGG - Intergenic
961544099 3:127619975-127619997 AATATTTTTTTTTTGAAACAGGG - Intronic
961741377 3:129035203-129035225 AAAAAGTTATTTAAGGAACTAGG - Intronic
961803981 3:129475643-129475665 AAAATTTTTTTTTTGAAAAAGGG - Intronic
961909946 3:130304019-130304041 AAAATGTTATTTAATTGACAGGG + Intergenic
962148656 3:132869406-132869428 AAAACTTTATTTATAAAACCAGG + Intergenic
963012320 3:140782349-140782371 AAAATATTCTTTATGAATGAAGG + Intergenic
963027300 3:140932785-140932807 AAATTTTTGTTTATGAGACAGGG + Intergenic
963135502 3:141900022-141900044 AAAATTTTTTTTTTGAGACAGGG - Intronic
963325126 3:143853786-143853808 AAAATTTTATTTTTGAAAAATGG - Intergenic
963393475 3:144700777-144700799 AAAATGATATCTAGCAAACAGGG + Intergenic
963454730 3:145530243-145530265 AAAATGTTAAATAAGAAAAAGGG + Intergenic
963497902 3:146091916-146091938 AAAAGGTTATTAATGAAAGCAGG + Intronic
963502432 3:146144688-146144710 AAAATGTTACTTAAAAATCATGG + Intronic
963536094 3:146529992-146530014 AAAATATAATTTGAGAAACAAGG + Intronic
963720820 3:148860019-148860041 AAAATGAGAATTTTGAAACAAGG - Exonic
964090442 3:152869905-152869927 AAAATGATATTTATTTAGCATGG - Intergenic
964124781 3:153224892-153224914 AAAATTTTATTCATGAAAGTTGG + Intergenic
964335549 3:155650225-155650247 GAAATTTTACTTCTGAAACAAGG - Intronic
964590207 3:158353489-158353511 TAAAACTTATTTATGAAACCAGG + Intronic
965361416 3:167743931-167743953 AAAACTTTATTTATAAAACAAGG - Intronic
965562992 3:170079405-170079427 AAAATGTTATTTAAATAATATGG - Intronic
965754801 3:172014851-172014873 AGTTTGTTATTGATGAAACAAGG + Intergenic
965901006 3:173641810-173641832 AAAATATTATTTACAAAACCAGG - Intronic
966016296 3:175141808-175141830 ATAATGTTTATTATGTAACAGGG + Intronic
966504788 3:180687483-180687505 ACAATTTTATTTAAGAAACAGGG - Intronic
966601261 3:181777413-181777435 GAAATGTTATTTATGAGGCTGGG + Intergenic
967244629 3:187473435-187473457 TAAAGGTTATGTATAAAACAAGG + Intergenic
967581049 3:191155233-191155255 GAAATCTTATTTTTGAAAAATGG - Intergenic
967675258 3:192291044-192291066 TTAATGTTATTTAATAAACAAGG - Intronic
967743348 3:193027437-193027459 AAAATGCTCTTTATGCAATAAGG + Intergenic
968160840 3:196425416-196425438 AAAATTTTATTTATTAAAAAAGG - Intronic
968342079 3:197964699-197964721 AAAAAGTTTTTTAAGAGACAGGG + Intronic
968797630 4:2718714-2718736 AAAAATTTATTTTTGAGACAGGG - Intronic
969112025 4:4850248-4850270 AAAATGTCATTCAAGAAACCTGG + Intergenic
970092218 4:12422738-12422760 CAAATGTTATATATAAAACAAGG + Intergenic
970291077 4:14572956-14572978 TAGATGTTATTTCTGAAAGATGG - Intergenic
970300417 4:14675581-14675603 AAAACTTTATTTATGAAAATAGG - Intergenic
970360550 4:15304628-15304650 AAAATTTTTTTTAAGAGACAGGG - Intergenic
970749719 4:19343295-19343317 AAAATGTTATTTTTAAATAATGG + Intergenic
970806213 4:20037053-20037075 AAAATCTCAGTTATGAAAAAAGG - Intergenic
971103200 4:23492969-23492991 AAAATATATTTTATGAAATAAGG - Intergenic
971109540 4:23568849-23568871 AAAATATTATATATGAAAGAAGG - Intergenic
971146548 4:23982926-23982948 AAAACTTTATTTATAAAACCAGG - Intergenic
971192668 4:24442509-24442531 AAACTGTTATTTATGAACATAGG - Intergenic
971295594 4:25387145-25387167 AGAATTATTTTTATGAAACAAGG - Intronic
971382578 4:26112244-26112266 GAAATGTTCTTGAAGAAACAGGG - Intergenic
971789093 4:31143973-31143995 AAAATAGTATTTATGGATCATGG + Intronic
971882780 4:32401564-32401586 AAAATGCTTTTTATAAAAAATGG + Intergenic
971904855 4:32713136-32713158 TAAAGGTTATTTATAAAAGAAGG - Intergenic
972867050 4:43245532-43245554 AAAATGTCAATTGTGAAAGATGG + Intergenic
973340609 4:48999719-48999741 TAAATGGCATTTTTGAAACACGG - Intronic
973547637 4:51997785-51997807 AAAATTTTATTTCTGAATCCTGG - Exonic
973671409 4:53222256-53222278 AAAATCTTGGTTTTGAAACACGG + Intronic
973691891 4:53443893-53443915 ATAATTTTATTAATAAAACATGG - Intronic
973694232 4:53474335-53474357 AAAATTTTACTTATAAAACCAGG - Intronic
974221261 4:58974747-58974769 ATAATGTTAATTCTGAAGCATGG + Intergenic
974348650 4:60715579-60715601 AAAATGTACATTTTGAAACAGGG + Intergenic
974429084 4:61772936-61772958 AACATGGTATTTTTTAAACAGGG - Intronic
974718748 4:65708190-65708212 AAAATGTCATAATTGAAACAAGG - Intergenic
974751518 4:66147620-66147642 AAAAGATTATTTATGAAACAAGG + Intergenic
974803484 4:66850212-66850234 AAAAGATTATATATGAAAAAAGG + Intergenic
974947861 4:68549741-68549763 AAATTGTTGTTTATGAAGAATGG - Intronic
974948334 4:68555848-68555870 TAAAGGTTATGTATAAAACAAGG + Intronic
975068427 4:70099856-70099878 AAAAAGTATTTTAAGAAACACGG + Intergenic
975451589 4:74533670-74533692 ATAATGTCATTTTTAAAACACGG + Intergenic
975563760 4:75732519-75732541 ATAATGTTTTTAATGAAATAAGG - Intronic
975648225 4:76566429-76566451 AAAGTGTGGTTTTTGAAACATGG - Intronic
975651733 4:76599970-76599992 AAAATGTTTTTTTAGAAATAGGG - Intronic
975994389 4:80297530-80297552 AAAATGTGTTTTATGAAGAAAGG - Intronic
976586786 4:86806910-86806932 AAAATGTAATTTTTTAAACCAGG - Intronic
976634537 4:87274743-87274765 AAAATGTTATTAAGAAAATAAGG + Intergenic
976697987 4:87938369-87938391 AAAATGTTATATATGAGACAGGG - Intergenic
976857474 4:89622221-89622243 AAAAAGTTATTGATGAAGGAGGG + Intergenic
976937789 4:90660313-90660335 AAAATGATATCTATGCATCATGG + Intronic
976942438 4:90719816-90719838 AAAGTGTAATGTATGAAAAAAGG - Intronic
977187920 4:93963471-93963493 AAAAATTTATTTTTGAGACAGGG + Intergenic
977586089 4:98777111-98777133 ATAATGTAATTTGTGAACCATGG + Intergenic
977804022 4:101275038-101275060 AAAAAGTTAATTATTTAACATGG + Intronic
977809506 4:101344336-101344358 AAAATCTTATGTATGACAAAAGG + Intronic
977832532 4:101610679-101610701 AAAAGGTTATTTCTGAAACAAGG + Intronic
977865839 4:102026501-102026523 AAAATTTACTTTTTGAAACAAGG - Intronic
978032294 4:103949862-103949884 TAAAGGTTATATATAAAACAAGG + Intergenic
978063087 4:104363067-104363089 AAAATTTTATTTATAAAATAAGG - Intergenic
978088086 4:104679409-104679431 ATAATGTTTCTTATGAAAAAAGG + Intergenic
978119033 4:105056212-105056234 AAAATAATAATTTTGAAACATGG + Intergenic
978225643 4:106331378-106331400 AAAACTTTATTTATGAAAACAGG + Intronic
978236018 4:106461795-106461817 CAAATGTTTTTTGTGAAACATGG - Intergenic
978950407 4:114551984-114552006 TAAAGGTTATGTATAAAACAAGG - Intergenic
979011065 4:115369235-115369257 AAAAAGTTATTTCTGAAAACAGG - Intergenic
979028990 4:115615333-115615355 AAAATGGTATTTTTCAAAGATGG + Intergenic
979188564 4:117830359-117830381 AAATTATTATTTTGGAAACAAGG + Intergenic
979229191 4:118327159-118327181 AAATTTTTTTTTTTGAAACAGGG + Intronic
979254198 4:118594741-118594763 GCTATGTTATTTATGAAACATGG - Intergenic
979572189 4:122240648-122240670 AAAATTTTATTTTTAAGACACGG - Intronic
979596398 4:122539395-122539417 AAAATGGTATTTATGGTACCTGG + Intergenic
980020226 4:127700496-127700518 GAAATGTTATTTATACACCATGG - Intronic
980046354 4:127993065-127993087 AAAATTTTTTTTTTGACACAGGG - Intronic
980101504 4:128545702-128545724 AAAATTTTTTTTTTGAGACAGGG - Intergenic
980190073 4:129513062-129513084 AAAACTCTATTTATGAAAAAAGG + Intergenic
980269949 4:130571408-130571430 TAAAGGTTATGTATTAAACAAGG - Intergenic
980280923 4:130718338-130718360 AAAATGTTTATTACAAAACAAGG - Intergenic
980321094 4:131277303-131277325 AAAATGTTAACTCGGAAACAAGG + Intergenic
980725039 4:136747713-136747735 AAAAGGTTATTTTTGAACCAAGG - Intergenic
981147054 4:141336528-141336550 AAAAGGTTATGTATGCAACAAGG + Intergenic
981292601 4:143093516-143093538 TAAAGGTTATGTATAAAACAAGG + Intergenic
981366241 4:143906972-143906994 AAAATGCTATTTCTGAAAATGGG + Intergenic
981386867 4:144142099-144142121 AAAATGCTATTTCTGAAAATGGG + Intergenic
981421860 4:144559843-144559865 GAAGTTTTATTTATGAAACCTGG - Intergenic
981800896 4:148654453-148654475 AAAATCTGTTTTAAGAAACATGG + Intergenic
981831171 4:149003935-149003957 CAAAAGTTATTTATGAAATTAGG + Intergenic
981896800 4:149811341-149811363 TATATGTTATTCATTAAACATGG - Intergenic
982170566 4:152657211-152657233 AAAACCTTTTTAATGAAACAAGG + Intronic
982196505 4:152921171-152921193 TAAAAGTTATTTATGAAATAAGG - Intergenic
982460636 4:155665630-155665652 ACACTGTTATTCAAGAAACAAGG - Intergenic
982475636 4:155846918-155846940 TAAAGGTTATGTATAAAACAAGG + Intronic
982577059 4:157126122-157126144 ATAATGTTGATTATCAAACAAGG + Intronic
982832654 4:160083821-160083843 AAAATATTATTCGTAAAACAAGG + Intergenic
983012118 4:162560509-162560531 TAAAGGTTATATATAAAACAAGG - Intergenic
983182591 4:164666551-164666573 ATTATTTTTTTTATGAAACAGGG - Intergenic
983408105 4:167357836-167357858 CAAATTTTATTTTTGAAACAAGG - Intergenic
983416081 4:167456751-167456773 TAAAATTTATTTATAAAACAAGG + Intergenic
983416635 4:167464946-167464968 AAAATGGTATTTAAGTATCAAGG + Intergenic
983588797 4:169384642-169384664 AAAAAATTATTTTTGAGACATGG - Intergenic
983589291 4:169390002-169390024 AAAATGTTATTAATAAAATCAGG + Intergenic
983907587 4:173200074-173200096 AAAATCTTATTTATCTAAAATGG - Intronic
984001479 4:174251973-174251995 CAATGTTTATTTATGAAACAGGG + Intronic
984151469 4:176138188-176138210 AAAATATTAGGTATGAATCAGGG + Intronic
984885721 4:184447552-184447574 AAAATATTTTTTATGACAAAGGG + Intronic
985227139 4:187773968-187773990 TAAAGGTTATGTATAAAACAAGG - Intergenic
985501993 5:254032-254054 AAAATTTTTTTTTTGAGACAGGG - Intronic
985543324 5:497042-497064 AAAATTTTTTTTTTGAGACAAGG - Intronic
985735024 5:1574634-1574656 AAAATTTTTTTTTTGAGACAGGG + Intergenic
985754979 5:1708488-1708510 CATATGTGATTGATGAAACAGGG + Intergenic
986204080 5:5606974-5606996 AAAATTTTTTTTTTGAGACAGGG - Intergenic
986585946 5:9318808-9318830 AAAATCTTAATTATAAAACATGG - Intronic
986702831 5:10428254-10428276 AATATGGTATTTATGATACTTGG - Intronic
986790550 5:11155440-11155462 AAAATGTTTTTTGTTAAAAATGG + Intronic
986811746 5:11367356-11367378 AAAATGTTCTTTCTTGAACACGG - Intronic
987348011 5:16996085-16996107 AAAATCTTGTTTTAGAAACAAGG + Intergenic
987481440 5:18463641-18463663 AAAATGTTATTTAAGATATAAGG - Intergenic
987623986 5:20373988-20374010 AACATAATATTTAAGAAACAAGG + Intronic
987661873 5:20888612-20888634 AAAATGTTATTGATAATAAAAGG - Intergenic
987888334 5:23841281-23841303 AAAATTTTATTAATTAAACCAGG - Intergenic
987965998 5:24873774-24873796 AACATGTAACTTATAAAACAAGG + Intergenic
987992892 5:25238281-25238303 AAAAACTTATTTATGAATGAAGG - Intergenic
988016914 5:25570765-25570787 TAAGTGTTATATATGAAACAAGG + Intergenic
988074461 5:26335201-26335223 AAAAAGATATTTATGAAAGCTGG - Intergenic
988429741 5:31105484-31105506 AAAATGTCATTTTTCAAATAAGG - Intergenic
988433098 5:31142729-31142751 AGAATGTTTTTTATTAATCATGG - Intergenic
988761713 5:34316707-34316729 AAAATGTTATTGATAATAAAAGG + Intergenic
988769544 5:34418065-34418087 TAAAAGTTATGTATAAAACAAGG + Intergenic
988770012 5:34423043-34423065 CAAAGGTTATTTATAAAACAAGG + Intergenic
988774010 5:34460312-34460334 TAAAGGTTATATATAAAACAAGG - Intergenic
988861143 5:35281142-35281164 CAGATGTTATTTATGAAATTTGG + Intergenic
988910972 5:35843284-35843306 AAAAGGTTATTTATAAAACAAGG - Intergenic
988920074 5:35932974-35932996 AAAATGTTATTTACAAAACCAGG - Intronic
989010110 5:36861572-36861594 AAAATGTTATCTCTGAAAGATGG - Intergenic
989260230 5:39411288-39411310 ATTATGTTTTTTATGAACCAAGG - Intronic
989320151 5:40124807-40124829 AAAAGTTTATATATAAAACAAGG - Intergenic
989386471 5:40859344-40859366 AAAATGTTATTCATGAGTAATGG - Intronic
989411101 5:41120916-41120938 CAAATATTAGTTAAGAAACAGGG - Intergenic
989477107 5:41886802-41886824 TAAAGGTTATATATAAAACAAGG - Intergenic
989510660 5:42283637-42283659 AAAATGAGATTTCTAAAACACGG - Intergenic
989781811 5:45275310-45275332 AAAATATTCTTCATAAAACAAGG + Intronic
990971100 5:61506588-61506610 AAAAAGTTATTTTCCAAACATGG + Intronic
991049645 5:62258888-62258910 AAAATTTTATTTTAGAAACAGGG - Intergenic
991142303 5:63258848-63258870 AAAATTTTAATTATGTAAAATGG - Intergenic
991150833 5:63367208-63367230 AAAATGTTATATTTGGACCATGG - Intergenic
991457322 5:66818221-66818243 AAAATGTTATTAAGAAAACTAGG + Intronic
991707542 5:69372616-69372638 AAAATTTTTTTTTTGAGACAGGG + Intronic
992165470 5:74046133-74046155 AATAAGTTATATATGACACAAGG + Intergenic
992225156 5:74613216-74613238 AAAAAGTTTTTTTAGAAACAGGG - Intergenic
992293462 5:75304269-75304291 TAAAGGTTATATATAAAACAAGG + Intergenic
992307517 5:75458497-75458519 GAAATGTGTTTTATGAAAAAGGG + Intronic
992539930 5:77754313-77754335 TAAAGGTTATGTATAAAACAAGG - Intronic
992755255 5:79898850-79898872 AAATTGTTAATCATGAATCAAGG + Intergenic
992823499 5:80522753-80522775 AAAGTATTATTTTTGAGACAGGG - Intronic
992864637 5:80945408-80945430 AAAATGTTATTTTCAAAAAATGG + Intergenic
992918230 5:81481946-81481968 AAAATTTTTTTTTTGAGACAGGG + Intronic
993201000 5:84814854-84814876 AAAAAATTCTTTATAAAACAGGG + Intergenic
993285087 5:85985108-85985130 AAAATGTTATGTCTGAAAAAGGG + Intergenic
993385983 5:87263854-87263876 AAAATATTATCTGTGAAAAATGG + Intergenic
993388906 5:87294176-87294198 CAAATTTTATTTAAGAGACAGGG + Intronic
993479120 5:88401104-88401126 AAAATTTAATGCATGAAACAAGG - Intergenic
993523955 5:88941530-88941552 AAAATGTTTTTAATAATACACGG + Intergenic
993701456 5:91123639-91123661 AAAACGAGATTTATAAAACAAGG - Intronic
993702702 5:91137003-91137025 AAAATGTACTTTTTAAAACAAGG + Intronic
994339965 5:98615098-98615120 TAGGTGTTATTTTTGAAACAAGG - Intergenic
994547981 5:101191999-101192021 AAAATGTTAATTTTCTAACAAGG + Intergenic
994641075 5:102410572-102410594 AAAAGCTTATTTATGCAACTTGG + Intronic
995149805 5:108829630-108829652 AAAAAGTTTTTTTTGAGACAGGG - Intronic
995348890 5:111152443-111152465 AAAATAGTATTTATGAAAATAGG + Intergenic
996037868 5:118778805-118778827 GGAAGGTTATGTATGAAACAAGG + Intergenic
996048121 5:118899308-118899330 TCAATGATATTTATGAAATATGG + Intronic
996083398 5:119279376-119279398 AAAATGTGAAGAATGAAACATGG - Intronic
996107466 5:119521182-119521204 AAAATCTTATTTCTTAAAAATGG + Intronic
996134271 5:119819586-119819608 AAAATAATAATTATGAAAAATGG + Intergenic
996238706 5:121168425-121168447 AAAATGTTGTTTATAAAAGCTGG - Intergenic
996261351 5:121473542-121473564 AAAATGTATACTATGAAACAAGG - Intergenic
996448106 5:123582446-123582468 AAGATAGTATATATGAAACATGG + Intronic
996474940 5:123906647-123906669 AAAATGTTAATTATAAAATGTGG + Intergenic
996625340 5:125563973-125563995 AACATATTATTTATGGACCATGG + Intergenic
997139866 5:131367018-131367040 AAAATTTGTTTTTTGAAACAGGG - Intronic
997176961 5:131788727-131788749 AAAGTGTAGTTTATGAAACTTGG - Intronic
997497120 5:134337673-134337695 AAAATGTTAATGTAGAAACAAGG - Intronic
998050188 5:139025931-139025953 AAAATTTTATTTAGGAAAGGAGG + Intronic
998189028 5:140006826-140006848 AACATGTTACTTTTCAAACAAGG + Intronic
998470047 5:142376603-142376625 AAAATATAATTTATCAAACCAGG - Intergenic
998538365 5:142955292-142955314 AAAATTTTTTTTTTGAGACAGGG - Intronic
998646901 5:144072110-144072132 AAAAGTTTATTTATGAAAATGGG - Intergenic
998667364 5:144313418-144313440 TAAGGGTTATTCATGAAACAGGG - Intronic
998706778 5:144771141-144771163 AAAATTTTATTCTTGAGACAGGG - Intergenic
998999426 5:147903752-147903774 AATGTTTTATTTTTGAAACAGGG + Intronic
999167171 5:149559643-149559665 AAATTGTTGTTTATGATACAAGG - Intronic
999633071 5:153591708-153591730 ATACTGTTATTTAAGAAGCAAGG + Intronic
999789467 5:154925470-154925492 AAAATGTCAATTATAAAACATGG - Intronic
999811291 5:155129916-155129938 ACAAGGTTATTTTTGAAATAAGG + Intergenic
999947853 5:156616822-156616844 AAAATATTATTTACAAAACTAGG - Intronic
1000084504 5:157877516-157877538 AAAATTTTGTTTTAGAAACAAGG + Intergenic
1000623444 5:163511271-163511293 AAAATTTTTTTTTTGAAACAGGG + Intronic
1000672756 5:164082441-164082463 TCAATGTTATATATGCAACAGGG + Intergenic
1001216074 5:169857127-169857149 AAAATGCAATTTAAGAGACAAGG - Intronic
1001817825 5:174685327-174685349 AAAATTTCAGTTATGAAAAATGG + Intergenic
1002984535 6:2176254-2176276 AAAATTTTTTTTAAGAAAAATGG - Intronic
1003167667 6:3695376-3695398 AAAATGTTATTAAGAAAATAAGG - Intergenic
1003540255 6:7012193-7012215 AAATTGTTTTTTAAGAGACAGGG - Intergenic
1003627153 6:7752252-7752274 GAAACGTTATTTATAAAACTAGG + Intronic
1003660791 6:8059355-8059377 AAAATTTTATTTGTAAAAGAAGG - Intronic
1003730748 6:8820385-8820407 AAAATGTTATTTTTGAGAAGTGG - Intergenic
1003906372 6:10703602-10703624 ATAATTTTGTGTATGAAACAAGG - Intronic
1004616321 6:17293944-17293966 AAAATGTTACGTATCAATCATGG - Intergenic
1004730051 6:18348774-18348796 AAAATGTTATGTACGAAAGTTGG - Intergenic
1004975955 6:20966464-20966486 TAAAAGTGATTTATTAAACATGG - Intronic
1005297968 6:24445409-24445431 AGAATGTTATTAATGAAAAAAGG + Intronic
1005478628 6:26233892-26233914 AAAATTTTATTTCTGACACAGGG - Intergenic
1006687218 6:35845918-35845940 GAAATGTTATTTTAGAAAAAAGG + Intronic
1007532231 6:42553357-42553379 AAAATTTTTTTTTTGAGACAAGG + Intergenic
1008035285 6:46738709-46738731 AGCATGTTATTTTGGAAACATGG + Intergenic
1008200519 6:48582596-48582618 AAAATGTGAATTATAAAATATGG - Intergenic
1008454679 6:51695797-51695819 AAAAAATTCTTTATGTAACAGGG + Intronic
1009290646 6:61877007-61877029 AAAACTTTATTTATGAAAACAGG - Intronic
1009790009 6:68390295-68390317 ATAGTTTTATTTTTGAAACAGGG + Intergenic
1009816379 6:68741382-68741404 AATATTTTATTTTTGAGACAGGG + Intronic
1009916176 6:69999525-69999547 AAAAATTTTTTTATGAGACAGGG - Intronic
1009958140 6:70481936-70481958 AAAATGTTACATGTGAAACTTGG - Intronic
1010053306 6:71533710-71533732 AATATATTTTTTATGAAAAACGG - Intergenic
1010560965 6:77349969-77349991 AAAATGTGAATTATGAAGTATGG - Intergenic
1010776342 6:79890558-79890580 AAAAATTTATTTGTGAAACTAGG + Intergenic
1010786713 6:80011034-80011056 AAAATATTATTTATGTAGAATGG + Intronic
1010843171 6:80672544-80672566 AAAGTGATATTTATGACATACGG - Intergenic
1010954312 6:82072769-82072791 AAAATGTTAAGCATGAAATAAGG + Intergenic
1011121373 6:83957217-83957239 AAAAAATTTTTTATGAAAAAAGG + Intronic
1011122889 6:83973921-83973943 TAAAGGTTATTTATAAAACAAGG - Intergenic
1011140654 6:84151929-84151951 AAAATACTATTTGTGAAAAACGG + Intronic
1011352465 6:86437380-86437402 AAAATGGTATCTACTAAACATGG + Intergenic
1011489146 6:87872697-87872719 AAAATTTTTTTTAAGACACAAGG + Intergenic
1011652726 6:89521758-89521780 AAAATATTATTTATATAATAAGG - Intronic
1011939829 6:92829243-92829265 TAAAGGTTATTTACGAAACAAGG + Intergenic
1011993990 6:93561646-93561668 ATAATTTCATTCATGAAACAAGG - Intergenic
1012147228 6:95700339-95700361 AAAATCATCTTTATGAAACTAGG + Intergenic
1012390534 6:98733108-98733130 AAAATGTTTTTTTAGAGACAAGG - Intergenic
1012711647 6:102614716-102614738 AAAGGGTTATTTATGAGACAAGG + Intergenic
1012713170 6:102634179-102634201 TAGAGGTTATTTATAAAACAAGG + Intergenic
1012759500 6:103280363-103280385 AAATGGTTATTTATGAGACAAGG + Intergenic
1013241502 6:108250415-108250437 AAAACTTTATTTATAAAAAAAGG + Intronic
1013641299 6:112084978-112085000 AAAATTTTATTTAGGAAAACAGG - Intronic
1013762075 6:113530542-113530564 GAAGTGTTTTTTTTGAAACAGGG - Intergenic
1014047004 6:116900832-116900854 GAAATGTTAATTATAAAAAAAGG + Intronic
1014048484 6:116923355-116923377 AAAATGGTATTTATGAGCCTGGG + Intronic
1014099337 6:117492955-117492977 AAAATGGCATTTCTGAAACCTGG - Intronic
1014133112 6:117857364-117857386 TAAAAGTTATGTATAAAACAAGG - Intergenic
1014182742 6:118403327-118403349 AAAATGTTTTATATGAGACTGGG - Intergenic
1014322657 6:119950851-119950873 AAAATGTTATTTGTAAAAGCAGG - Intergenic
1014463917 6:121731195-121731217 AAAGTGGTATTCATTAAACACGG + Intergenic
1014577002 6:123085974-123085996 AGAATGTTCTTTATGGAACAGGG + Intergenic
1014804019 6:125809056-125809078 AAAAAGTTATTCCTGAAGCAAGG - Intronic
1014839133 6:126196855-126196877 AAAATTTTTTTTAAAAAACAAGG + Intergenic
1014957500 6:127638858-127638880 AAAATGGCATTCATGAAATAAGG - Intergenic
1015007805 6:128304996-128305018 AAAAAATTATTTAAGAAATATGG - Intronic
1015185580 6:130412215-130412237 AAAATGGTATTTAGAAACCAAGG + Intronic
1015282540 6:131449220-131449242 ACAATGTTATTTATTTAAAAGGG - Intergenic
1015417657 6:132968056-132968078 AAAAGTTTATTTATGAAACCAGG - Intergenic
1016097517 6:140056554-140056576 AACATATTATTTAAGGAACATGG + Intergenic
1016180020 6:141134145-141134167 AAAATGCTATTTATATAAAATGG + Intergenic
1016232947 6:141828295-141828317 AAAAGATTGTTTATGAAACAAGG - Intergenic
1016487595 6:144559355-144559377 ATATTGTTATCTATAAAACAGGG + Intronic
1016903499 6:149126369-149126391 TAAATGTTACTTCTGAAATAAGG + Intergenic
1017150534 6:151275095-151275117 AAAATTTTTTTTTTGAGACAGGG - Intronic
1017351385 6:153446315-153446337 TAAAGGTTATATATAAAACAAGG - Intergenic
1017353245 6:153469587-153469609 AAAATGTGAGTTATGACTCAAGG + Intergenic
1017701680 6:157079486-157079508 AAAATGATAGTTGTGAAATAAGG + Intronic
1017797501 6:157859358-157859380 AAAAGGTAACTTATGGAACAGGG - Intronic
1017862824 6:158414860-158414882 ATAATGATATTTTTGGAACAGGG - Intronic
1018145714 6:160886089-160886111 TAAAGGTTATGTATAAAACAAGG + Intergenic
1018193571 6:161333737-161333759 AAAAAGTTATTTATGAGACAAGG + Intergenic
1018223177 6:161601937-161601959 AAACTGTTATTTTTTTAACAGGG + Intronic
1019042011 6:169114264-169114286 TAAAGATTATTTATGAATCAAGG + Intergenic
1020020880 7:4867726-4867748 AAAATATTATTTATGTATTAAGG + Intronic
1020340726 7:7107466-7107488 TAAAGGTTATATATAAAACAAGG + Intergenic
1020356334 7:7279759-7279781 AAACTGTTATTTATGCATGAAGG + Intergenic
1020412951 7:7913509-7913531 AAAATTTTATTTATGAAAACAGG - Intronic
1020528914 7:9303503-9303525 AAAATGTTATTGAGGAAAACTGG + Intergenic
1020735394 7:11942591-11942613 CAAATGTAATTTATGAAATGAGG - Intergenic
1020759059 7:12245360-12245382 AAACTTTTATTTTTGAGACAGGG + Intergenic
1020765521 7:12314931-12314953 AATATTTTATTTAAAAAACAGGG + Intergenic
1021284395 7:18761444-18761466 AAAATGTTAAAAATGAAATACGG + Intronic
1021284541 7:18764014-18764036 AAACTTTTATTCATAAAACATGG + Intronic
1021636206 7:22696528-22696550 AAAATCATATTTAAGAAAGAGGG + Intergenic
1021834785 7:24659159-24659181 AAAATGTCCTTTAAGCAACATGG - Intronic
1021928643 7:25557493-25557515 AAAAAATTATTTATGAAACGGGG + Intergenic
1022196080 7:28068695-28068717 GAAATGTTATTTTTTAAAAAAGG + Intronic
1022206239 7:28166657-28166679 AAAACTATATTTATCAAACATGG + Intronic
1022250735 7:28605509-28605531 AAAAAGATATTTTTGAAATAAGG - Intronic
1022312983 7:29214762-29214784 AATATTTTATCTATGAAACTTGG + Intronic
1022458031 7:30576324-30576346 AAAGAGTTATTTATGAAACAAGG - Intergenic
1022784889 7:33628198-33628220 AAAACAGTATTTAGGAAACAAGG + Intergenic
1023387392 7:39673822-39673844 AAAATGATTTTTAAGAGACAGGG + Intronic
1023421159 7:39981379-39981401 AAAAAATTATCTATTAAACAAGG + Intronic
1023480644 7:40630143-40630165 AAACTGTTCTTTATGCTACAGGG + Intronic
1024150441 7:46566710-46566732 AAAATGTAATGTCTGGAACACGG + Intergenic
1024316490 7:48023705-48023727 AAACTGAAATTTATAAAACATGG + Intronic
1024351351 7:48368053-48368075 AAAATCTTCTTTCTGGAACAGGG - Intronic
1024359109 7:48449160-48449182 AAACAATTATTTATTAAACATGG - Intronic
1024467339 7:49725581-49725603 CAAATGTTATTTAAGATATAGGG - Intergenic
1024912320 7:54459317-54459339 AATGTTTTATTTCTGAAACAGGG + Intergenic
1025081596 7:55988247-55988269 AAAATTTTTTTTTTGATACAGGG - Intronic
1025111946 7:56224690-56224712 AAAATATTTTTTAAGAGACAAGG + Intergenic
1026124194 7:67565153-67565175 AAAATGTTATTTACAAAAGCAGG + Intergenic
1026398133 7:69979849-69979871 AAAATGGCATTTAAAAAACAAGG - Intronic
1026639716 7:72113612-72113634 AAAACTTTATTTGTGAAAGAAGG - Intronic
1027130040 7:75584268-75584290 AAAATTTTTTTTAAGAGACAGGG + Intronic
1027306628 7:76905144-76905166 AAAATGTTAATTGTGCAGCATGG - Intergenic
1027362498 7:77423946-77423968 AAAATTTTTTTTTTGAGACAGGG + Intergenic
1027496587 7:78894450-78894472 AAAATGTTATTTTTTAATCCTGG - Intronic
1027529168 7:79308960-79308982 AAAATTTTATTTTTTAATCAGGG - Intronic
1027553195 7:79627454-79627476 AATATTTTATTGAAGAAACAGGG + Intergenic
1027722665 7:81764485-81764507 AACATGTTATTTATTGAGCATGG + Intronic
1027805152 7:82810394-82810416 AAAATGTAATTCATAAAAAATGG - Intronic
1027982035 7:85236982-85237004 AAAAAGTTATTGAAGAAACTGGG - Intergenic
1028267942 7:88751113-88751135 AAAATGTAATATATCAATCAAGG - Intergenic
1028302543 7:89218782-89218804 AAAATGTTATTAAGAAAATAAGG + Intronic
1028400368 7:90419005-90419027 AAAATGTTATCTGTGATAAAGGG + Intronic
1028423110 7:90655426-90655448 AAAATGTGATTTCTGAAAAGGGG + Intronic
1028564393 7:92212260-92212282 AAAATATTATATGTGACACAAGG - Intronic
1028569848 7:92274918-92274940 AAAATATTTTTTTTGAGACAGGG - Intronic
1028744148 7:94308588-94308610 AAAATGTTTTTCATGGAACTAGG - Intergenic
1028972355 7:96872973-96872995 ATAATATTATTTTTAAAACATGG + Intergenic
1029606917 7:101604819-101604841 GAAATGTGATTTATTAAACCAGG - Intergenic
1030130838 7:106198306-106198328 AAAATTTTTTTTTTGAGACAGGG + Intergenic
1030334626 7:108311361-108311383 CAGGTGTTCTTTATGAAACAAGG + Intronic
1030355026 7:108532048-108532070 AAAATTTTACTAATGAAAAAAGG - Intronic
1031085841 7:117300790-117300812 TATATGTTATTTTTGAGACAAGG - Intronic
1031232564 7:119127456-119127478 AAAATGTAATCTATGTTACATGG + Intergenic
1031258510 7:119486593-119486615 AGAATGTTATTTTAGAAAGAGGG + Intergenic
1031403635 7:121356172-121356194 GAAATGTAATCTCTGAAACATGG + Intronic
1031472968 7:122189796-122189818 GAAATGATATTTATGAATGAGGG + Intergenic
1031621960 7:123945223-123945245 TAAAGGTTATGTATAAAACAAGG - Intronic
1031678570 7:124641958-124641980 AAAATGATATTTGTAAAATATGG - Intergenic
1032104545 7:129015824-129015846 TATATTTTATTTTTGAAACAGGG - Intronic
1032599814 7:133281546-133281568 AAAAAGTTATCTATGAGTCAAGG - Intronic
1032871092 7:135986535-135986557 TAAAGGTTATTTATAAAACAAGG - Intergenic
1033054388 7:138036120-138036142 AAAAGGTTATTTATGAAACAAGG + Intronic
1033252689 7:139774970-139774992 GAAATGCTGTTTTTGAAACAAGG - Intronic
1033328949 7:140402200-140402222 AAAATGTTTTTTTTGAGACAGGG - Intronic
1033334073 7:140437462-140437484 AAATTGTTTTTTTTGAGACAGGG - Intergenic
1033463228 7:141566381-141566403 CACATTTTATTTATGAAAGATGG + Intronic
1033492838 7:141861216-141861238 AAAATGATATTTGGGTAACAAGG - Intergenic
1033965021 7:146964866-146964888 AAAATGTTATTTACTAAAACAGG + Intronic
1034049160 7:147963897-147963919 AAAATATTAATTCTGAAAAATGG - Intronic
1034596518 7:152199643-152199665 AAAATCTTATTTTTAAAATAAGG - Intronic
1034736519 7:153433933-153433955 AAAATGTTGATAATGAAAAATGG - Intergenic
1034906766 7:154955684-154955706 AAAATTTTCTTTAGAAAACAAGG + Intronic
1035656906 8:1315106-1315128 AAAATGTTACTTACTAAATACGG - Intergenic
1036134699 8:6149970-6149992 AAAACTTTATTTACAAAACAGGG - Intergenic
1036285080 8:7437185-7437207 AAAAATTTATTTATAAAACTGGG + Intergenic
1036336396 8:7874344-7874366 AAAAATTTATTTATAAAACTGGG - Intergenic
1036528926 8:9563496-9563518 AAAATTTTATTTATGAGAATAGG + Intronic
1036959920 8:13232925-13232947 AAAATGTTATTGATTAGTCAGGG - Intronic
1037240691 8:16773889-16773911 AGATTGATATTTATGGAACATGG + Intergenic
1037257695 8:16973658-16973680 AAAATTTTATTGATAAAAGAAGG + Intergenic
1037263238 8:17031058-17031080 AAAATAGTATTTCTGAAAAATGG - Intronic
1037512272 8:19595691-19595713 AAATTTTTGTTTTTGAAACAGGG - Intronic
1037587654 8:20288934-20288956 AAAATTTTATTTGTAAAAGAAGG + Intronic
1037955368 8:23052622-23052644 TAAAGGTTATATATAAAACAAGG + Intronic
1037972696 8:23185291-23185313 CAAAGGTTATTTATTAAACAAGG - Intergenic
1038156888 8:24999848-24999870 AAAATGTTATATATAAATAAGGG - Intergenic
1039227617 8:35405330-35405352 AACATGTTAATTAGGATACAAGG - Intronic
1040508128 8:48069909-48069931 AAAATTTTTTTTTTGAGACAGGG - Intergenic
1040752912 8:50732886-50732908 AAGATGTTATTTTTTAAAAAAGG - Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040994577 8:53388997-53389019 ACAATGTGATTTCAGAAACATGG - Intergenic
1040995209 8:53394101-53394123 ACAATGTGATTTCAGAAACATGG + Intergenic
1041014249 8:53575298-53575320 AAAATATTTTTTTTGAGACATGG + Intergenic
1041503240 8:58562583-58562605 AAAATGTTATTTTCAAAAAATGG + Intronic
1041633254 8:60112671-60112693 TTAATGTTATTTATGAAAATGGG + Intergenic
1041651048 8:60303399-60303421 TAAAGGTTATATATAAAACAAGG - Intergenic
1041890191 8:62859551-62859573 AAAATGTTATTTATTTAATTTGG - Intronic
1042940690 8:74104497-74104519 AAAAAGTTATTTATACAGCATGG + Intergenic
1043074779 8:75684382-75684404 TAAATGGTATTTAATAAACATGG - Intergenic
1043127967 8:76424687-76424709 ACAATAATTTTTATGAAACAGGG - Intergenic
1043160566 8:76841361-76841383 AGAACGTTATTAATAAAACATGG + Intronic
1043325260 8:79042607-79042629 AGAAAGTTATTTAGGCAACAAGG - Intergenic
1043460653 8:80456848-80456870 AAAATATTATTTTTGAGATAGGG + Intergenic
1043493936 8:80779506-80779528 AAAATTTTATTTATATAATAGGG - Intronic
1043733522 8:83715753-83715775 AATATGTTTTTTATGAAATAAGG + Intergenic
1043790450 8:84460514-84460536 AAAATGTTCTTCAAGATACAAGG + Intronic
1043851471 8:85220945-85220967 AAAATTCTCTTTTTGAAACAAGG - Intronic
1044013825 8:87026739-87026761 AAAAGGTTATTTATGAAACAAGG - Intronic
1044029479 8:87216751-87216773 AAAATGTAATTCATGGAAAAGGG - Intronic
1044109535 8:88255003-88255025 AAATTATTATTTAAAAAACATGG + Intronic
1044252275 8:90017748-90017770 AAAATGTTTCTTTTGAGACAAGG - Intronic
1044689112 8:94859284-94859306 AAAATTTTATTTTTGAGACAAGG + Intronic
1044724215 8:95179701-95179723 AAGAAATTATTTTTGAAACATGG - Intergenic
1045029243 8:98119266-98119288 AAAATATTTCTTGTGAAACAAGG + Intronic
1045117164 8:98995257-98995279 AAATTGTTATTTAAGAGAAAAGG - Intergenic
1045142408 8:99301206-99301228 AAAATTTTTTTTTTGAAACAAGG - Intronic
1045978483 8:108156470-108156492 GAAATCTTATTTTTGAAAAAAGG - Intergenic
1046010893 8:108545801-108545823 AAAATTTTTTTTTTGAGACAAGG + Intergenic
1046145862 8:110157603-110157625 AAAATGTTTTTTACAAAACATGG - Intergenic
1046383411 8:113478689-113478711 AAAAGGTTATTTATGAAATGAGG - Intergenic
1046415237 8:113905338-113905360 ATAATGATGTTTATGAAACATGG - Intergenic
1046474707 8:114727266-114727288 AAAAGGATCATTATGAAACAAGG - Intergenic
1046478121 8:114776550-114776572 AAATTGTCATTTAATAAACAAGG + Intergenic
1046822137 8:118645602-118645624 AAAATCTTATTTATAAAAACAGG - Intergenic
1046843862 8:118892996-118893018 TAAATGTTATTTTTAAAAGAAGG + Intergenic
1047566538 8:126049947-126049969 TAAATGATAGTTATGGAACACGG + Intergenic
1047676707 8:127210460-127210482 CAGATGTTATTGATGAATCATGG + Intergenic
1048024350 8:130571013-130571035 AAAATGTTCTGAATGAAACAAGG + Intergenic
1048150953 8:131893247-131893269 AAAATGTTATTCATGACTTAGGG + Intergenic
1048237569 8:132706571-132706593 GAAATTTTATATATTAAACATGG + Intronic
1048363400 8:133717090-133717112 AGGATGTTAAGTATGAAACAAGG + Intergenic
1048420630 8:134274963-134274985 AAAATGGGATTTAGGAAACATGG + Intergenic
1049113296 8:140663679-140663701 AAACTTTTTTTTTTGAAACAGGG + Intronic
1049456357 8:142692893-142692915 AAATAGTTACTTATGAAGCAAGG - Intergenic
1050105191 9:2158095-2158117 AAAATGTTTTTCATGACTCAGGG - Intronic
1050384976 9:5079810-5079832 AAAATTTTTTTTTTGAGACAGGG - Intronic
1050454561 9:5821080-5821102 AAAAAATTAATTTTGAAACATGG + Intronic
1050621055 9:7452353-7452375 AAAAAGGGATTTATGAAGCAAGG + Intergenic
1050798861 9:9583460-9583482 ACAATGTCATTCATGAAAAAGGG - Intronic
1050978458 9:11973930-11973952 ATAATGTTATTTATAAAAAAGGG - Intergenic
1051010077 9:12401341-12401363 AAAATGTTACCTATAAATCAAGG - Intergenic
1051260283 9:15257453-15257475 AAAATTTTTTTTTTGAGACAGGG + Intronic
1051576339 9:18620265-18620287 AAAATGATAATCATGAAAAAAGG - Intronic
1051609725 9:18949448-18949470 AAAATTTTTTTTTTAAAACAAGG - Intronic
1051922112 9:22279318-22279340 AGAATGATGTTTAAGAAACATGG + Intergenic
1052141200 9:24987055-24987077 AAAATGCCATTTTTTAAACAAGG + Intergenic
1052183635 9:25562981-25563003 ATAATGATATTTATTAAATAGGG + Intergenic
1052584873 9:30413573-30413595 AAAATATTTTTTAAGAGACAGGG - Intergenic
1052590579 9:30488684-30488706 AACATGTTGTTTCTGAAAGATGG - Intergenic
1052753638 9:32518213-32518235 GAAAGGTTACTTATGAAACAAGG + Intronic
1053191840 9:36078009-36078031 AAAATTTTTTTTAAGACACAGGG - Intronic
1053332404 9:37226091-37226113 AAAATTTTTTGTAAGAAACAAGG + Intronic
1054737095 9:68765428-68765450 AAATTTTTATTAATGCAACATGG + Intronic
1054839070 9:69716146-69716168 AAAATGATTTTTAGGAAAAAAGG + Intronic
1054879345 9:70128661-70128683 AAAAAATTATTTTTGAAACAGGG + Intronic
1054933110 9:70656854-70656876 TAAAGGTTATGTATAAAACAAGG + Intronic
1055100774 9:72462580-72462602 AAAACTTTATTTATGAAAATAGG - Intergenic
1055504586 9:76934959-76934981 AAAAGATTATTTTTGAAAGAAGG + Intergenic
1055660558 9:78499717-78499739 AAAATGTAATTGATCAAACTGGG + Intergenic
1055841410 9:80509289-80509311 AAAGTGTTATTTTTCACACATGG - Intergenic
1055864384 9:80795402-80795424 AAAATGATTTTTATGTAATAAGG - Intergenic
1056673255 9:88650167-88650189 AAAATCTTTTTTAAGAGACAGGG + Intergenic
1056854286 9:90111920-90111942 AAGATGTTACTCATGAAACAAGG - Intergenic
1057467397 9:95327712-95327734 TAAATGTTATATATAAAACAAGG - Intergenic
1057584773 9:96319510-96319532 AAAAAGTTTTTTTTGAGACAGGG + Intergenic
1058331620 9:103768532-103768554 AAAATATTATGTAAGAATCATGG + Intergenic
1058384056 9:104412216-104412238 TAAAGGTTATATATAAAACAAGG + Intergenic
1058997212 9:110311445-110311467 TAAAGGTTATGTATAAAACAAGG + Intronic
1059054450 9:110964553-110964575 AAAATGTTATTACTGAATCTAGG + Intronic
1059179929 9:112201958-112201980 ATAATTTTTTTTTTGAAACAGGG - Intergenic
1059518378 9:114916701-114916723 AAAACGTTATTTATCAAATGAGG - Intronic
1059662224 9:116413207-116413229 AAAACTTTATTTATGAAAATAGG - Intergenic
1059684249 9:116619528-116619550 AAAATGTTGTTGTTGAGACAGGG + Intronic
1059701707 9:116781326-116781348 AAAATGTAAATTCAGAAACAGGG + Intronic
1059748301 9:117224384-117224406 AAATTTTTTTTTAGGAAACAAGG - Intronic
1059998215 9:119934299-119934321 AAAATATAATTTGAGAAACAGGG + Intergenic
1060691195 9:125662373-125662395 AAAATTTTTGTTTTGAAACAGGG - Intronic
1061072756 9:128321784-128321806 AAAATATTTTTTAAGAGACAGGG + Intronic
1061529729 9:131201044-131201066 AAAATGTTAGCAATGAAAAATGG + Intronic
1062259336 9:135652466-135652488 TAAAGGTCATTTTTGAAACAAGG + Intergenic
1203433061 Un_GL000195v1:109482-109504 AAAAAATTTTTTTTGAAACAAGG + Intergenic
1185804265 X:3042814-3042836 TAAGGGTTATTTATGAAATATGG + Intronic
1185983039 X:4800646-4800668 AAAATATTATTTTTAAAACTAGG + Intergenic
1186160452 X:6771878-6771900 AAAACTTTATTTATAAAACCAGG + Intergenic
1186209646 X:7235896-7235918 TAAAGGTTATGTATAAAACAAGG - Intronic
1186289649 X:8082717-8082739 AAAATGTTATATATGAGAATGGG - Intergenic
1186310744 X:8316132-8316154 AAAATGTTCTAAATGAAAAATGG + Intergenic
1186376386 X:9006318-9006340 AATCTTTTATTTATGAGACAAGG - Intergenic
1186384541 X:9095368-9095390 AAAAAATTATTTTTAAAACATGG + Intronic
1186440568 X:9582280-9582302 AAGATCTAATTTATGTAACATGG - Intronic
1186518740 X:10186770-10186792 AAAACTTTATTTCTAAAACAAGG - Intronic
1187084412 X:16027155-16027177 AAAACGTTATTTTTGAAAACAGG - Intergenic
1187157132 X:16731098-16731120 TAAAGGTTATATATAAAACATGG - Intronic
1187331600 X:18345397-18345419 ACAATTTTTTTTTTGAAACAGGG + Intronic
1187434501 X:19254916-19254938 AAAACTTTATTTATGAAAACAGG + Intergenic
1187538549 X:20167019-20167041 AAAATCGTATTTTTAAAACAAGG - Intronic
1187816449 X:23237693-23237715 TAAACGTTATGTATAAAACAAGG + Intergenic
1187912758 X:24126069-24126091 AAAATGTTATTTCTAACAAAGGG + Intergenic
1187914605 X:24141773-24141795 AAAATGTTATTCAGGAAACAAGG + Intergenic
1187987351 X:24828722-24828744 TAAATGTCATTCATGAGACAAGG - Intronic
1188050560 X:25480031-25480053 AAAATGTTATTTACAAAAACAGG + Intergenic
1188303812 X:28537939-28537961 TAAATGTTATTTGTAAAACCAGG + Intergenic
1188454699 X:30350534-30350556 AAAATATTATTTATGAAAACAGG + Intergenic
1188485322 X:30675678-30675700 AAAATTTTTTTTTAGAAACAAGG + Intronic
1188602316 X:31982891-31982913 AAAATGTTATTTATGATTTTTGG - Intronic
1188858465 X:35226423-35226445 AAAAAGGCATTTATGAAACAAGG + Intergenic
1188904568 X:35776619-35776641 TAAAGGTTATATATAAAACAAGG - Intergenic
1188908575 X:35818241-35818263 GAAAGGTTATTTATGAAATAAGG - Intergenic
1189031459 X:37455678-37455700 AAAATGTCATTTCTGAGACCAGG - Exonic
1189443204 X:41056162-41056184 TAACTTCTATTTATGAAACAAGG - Intergenic
1189781102 X:44515063-44515085 AAAATGTGATTTCTTAAAAACGG - Intergenic
1190803748 X:53815203-53815225 AAAATGTTATTGAGAAAACTGGG + Intergenic
1190819358 X:53959070-53959092 AAAATATTATTTATAAACAATGG + Intronic
1190842226 X:54155918-54155940 AAAATTTTTTTTAAGAGACAGGG - Intronic
1190951424 X:55148386-55148408 TAAAAGTTATTTATGAAACAAGG + Intronic
1191068777 X:56379433-56379455 TAAAGGTTTTGTATGAAACAAGG - Intergenic
1191593829 X:62919742-62919764 AAAATTATTTTTATGAGACAAGG + Intergenic
1191616898 X:63178797-63178819 TAAAAGGTATTTATAAAACAAGG - Intergenic
1191619399 X:63200126-63200148 TAAAAGGTATTTATAAAACAAGG + Intergenic
1191625672 X:63268463-63268485 TAAGGGTTATGTATGAAACAAGG - Intergenic
1192066873 X:67894322-67894344 TAAATTTTATGTATAAAACAGGG - Intergenic
1192215468 X:69155113-69155135 AAGATGATATATAAGAAACAGGG - Intergenic
1192623033 X:72699150-72699172 TAAAGGTTATGTATAAAACAAGG + Intronic
1193319271 X:80101507-80101529 TAAAAGTTATTTATAAAACAAGG + Intergenic
1193950015 X:87786170-87786192 AAAATGTGACATATGGAACAAGG - Intergenic
1193958852 X:87898857-87898879 AAAATATTAATTATTAAACATGG - Intergenic
1194003912 X:88467034-88467056 TAAAGGTTATGTATAAAACAAGG + Intergenic
1194008913 X:88534225-88534247 AAAGTGTTATTTATGAAACATGG - Intergenic
1194149188 X:90302155-90302177 CAGAGGTTATTTATGAAAGAAGG - Intergenic
1194159163 X:90429438-90429460 TAAATATTATATATAAAACAAGG - Intergenic
1194205367 X:91005271-91005293 TAAAGGTTATGTATAAAACAAGG + Intergenic
1194229742 X:91307223-91307245 AAAATGTCATCTAGGAACCAGGG + Intergenic
1194485986 X:94487037-94487059 AACTTGTTATTTAAGAAAGAAGG + Intergenic
1194614315 X:96082777-96082799 AAAATTTTGTTTTTGAAACAGGG - Intergenic
1194755040 X:97729081-97729103 AAAATGTTATTAATTAAATGTGG - Intergenic
1194767734 X:97861838-97861860 TAAATGTTATTTTGGAAAAATGG + Intergenic
1194886878 X:99326764-99326786 TAAAGGTTATATATAAAACAAGG + Intergenic
1194905611 X:99573064-99573086 TAAAGGTTATGTATAAAACAAGG - Intergenic
1194938855 X:99985144-99985166 AAAAAGTTAATTATGGAATAAGG - Intergenic
1195478552 X:105316470-105316492 AAACAGTTATTGATGAAACCAGG + Intronic
1195758987 X:108225970-108225992 CAAATGGTATTTATGAAGCAGGG + Intronic
1195959331 X:110369381-110369403 AAAATGTTATGTATCAGAAAAGG - Intronic
1196159614 X:112468432-112468454 AAAATTTTATTTATAAAAATAGG - Intergenic
1196476569 X:116093117-116093139 AGTATATTATTTATGAAAAATGG - Intergenic
1196695925 X:118611642-118611664 AAAACTATATTTATGAAAGATGG + Intronic
1196864462 X:120058369-120058391 AAAATATTTTTTTTGAGACAGGG - Intergenic
1196872644 X:120127311-120127333 AAAATTTTTTTTTTGAGACAGGG + Intergenic
1196878639 X:120177962-120177984 AAAATATTTTTTTTGAGACAGGG + Intergenic
1197254245 X:124246058-124246080 AAAATTTTATTTTTGAGACAGGG + Intronic
1197687760 X:129460138-129460160 TAAATTTTTTTTTTGAAACAGGG - Intronic
1198171856 X:134114762-134114784 ATAATGTTATTTATTTAGCATGG + Intergenic
1198597151 X:138249169-138249191 AAAGTGGTATTTAGGAAAGAAGG - Intergenic
1198801904 X:140456782-140456804 AAAACTTTATTTATAAAACCAGG - Intergenic
1198854219 X:140999503-140999525 TAAAAGTTATTTATGAAATTAGG + Intergenic
1198877793 X:141245626-141245648 TAAAAGTTATTTATGAAATTAGG - Intergenic
1198908311 X:141586572-141586594 TAAAAGTTATTTATGAAATTAGG + Intronic
1198910313 X:141606539-141606561 CAAATCTTAATTAAGAAACATGG + Intronic
1198915439 X:141666052-141666074 AAAATATTATTTATAAAAGCAGG - Intronic
1198952304 X:142085169-142085191 TAAAGGTTATATATAAAACAAGG + Intergenic
1199091415 X:143697281-143697303 AAGATATTATTTATAAGACATGG - Intergenic
1199096803 X:143752738-143752760 AAAACATCATTTATGTAACATGG - Intergenic
1199425522 X:147696779-147696801 AAAATTTTATTTATGAAAATAGG + Intergenic
1199644669 X:149895103-149895125 TAATGGTTATTTTTGAAACAAGG - Intergenic
1199789236 X:151135961-151135983 AAAAGGTTATTTATGAAACAAGG - Intergenic
1200285442 X:154817782-154817804 TAAAGGTTATGTATAAAACAAGG - Intronic
1200495561 Y:3878892-3878914 CAGAGGTTATTTATGAAAGAAGG - Intergenic
1200505470 Y:4006406-4006428 TAAATATTATATATAAAACAAGG - Intergenic
1200551183 Y:4580414-4580436 TAAAGGTTATGTATAAAACAAGG + Intergenic
1200800071 Y:7378397-7378419 AAAAGGTCACTGATGAAACAGGG - Intergenic
1201363319 Y:13176885-13176907 TAAAGGTTATATATAAAACAAGG + Intergenic