ID: 1140546757

View in Genome Browser
Species Human (GRCh38)
Location 16:75817122-75817144
Sequence GGAGGACCCTAGACCCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140546754_1140546757 -3 Left 1140546754 16:75817102-75817124 CCACATGAGAGCAAGTTCAAGGA No data
Right 1140546757 16:75817122-75817144 GGAGGACCCTAGACCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140546757 Original CRISPR GGAGGACCCTAGACCCTGTA GGG Intergenic
No off target data available for this crispr