ID: 1140550245

View in Genome Browser
Species Human (GRCh38)
Location 16:75857227-75857249
Sequence GGTTGTGGTTCCTCATCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140550245_1140550251 21 Left 1140550245 16:75857227-75857249 CCATGAGATGAGGAACCACAACC No data
Right 1140550251 16:75857271-75857293 CATTAGTGAGTGAGCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140550245 Original CRISPR GGTTGTGGTTCCTCATCTCA TGG (reversed) Intergenic
No off target data available for this crispr