ID: 1140551359

View in Genome Browser
Species Human (GRCh38)
Location 16:75869692-75869714
Sequence CAGGGTCACCCAGGGCAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140551350_1140551359 2 Left 1140551350 16:75869667-75869689 CCTGAGGGGCTCCTGTCTGTTGT No data
Right 1140551359 16:75869692-75869714 CAGGGTCACCCAGGGCAGGTTGG No data
1140551353_1140551359 -9 Left 1140551353 16:75869678-75869700 CCTGTCTGTTGTCCCAGGGTCAC No data
Right 1140551359 16:75869692-75869714 CAGGGTCACCCAGGGCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140551359 Original CRISPR CAGGGTCACCCAGGGCAGGT TGG Intergenic
No off target data available for this crispr