ID: 1140555539

View in Genome Browser
Species Human (GRCh38)
Location 16:75916841-75916863
Sequence CAGATTCTACAGATGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140555531_1140555539 -10 Left 1140555531 16:75916828-75916850 CCATTTCCCCTCCCAGATTCTAC No data
Right 1140555539 16:75916841-75916863 CAGATTCTACAGATGCAGGGTGG No data
1140555528_1140555539 7 Left 1140555528 16:75916811-75916833 CCAGGAAGCCCACAGCTCCATTT No data
Right 1140555539 16:75916841-75916863 CAGATTCTACAGATGCAGGGTGG No data
1140555529_1140555539 -1 Left 1140555529 16:75916819-75916841 CCCACAGCTCCATTTCCCCTCCC No data
Right 1140555539 16:75916841-75916863 CAGATTCTACAGATGCAGGGTGG No data
1140555530_1140555539 -2 Left 1140555530 16:75916820-75916842 CCACAGCTCCATTTCCCCTCCCA No data
Right 1140555539 16:75916841-75916863 CAGATTCTACAGATGCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140555539 Original CRISPR CAGATTCTACAGATGCAGGG TGG Intergenic
No off target data available for this crispr