ID: 1140556293

View in Genome Browser
Species Human (GRCh38)
Location 16:75925224-75925246
Sequence ACCCAAAATGTCTCAAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140556283_1140556293 26 Left 1140556283 16:75925175-75925197 CCCTGGTCTTTACCCACTAGATG No data
Right 1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG No data
1140556282_1140556293 29 Left 1140556282 16:75925172-75925194 CCTCCCTGGTCTTTACCCACTAG No data
Right 1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG No data
1140556289_1140556293 -9 Left 1140556289 16:75925210-75925232 CCCATCCAGTGGCCACCCAAAAT No data
Right 1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG No data
1140556287_1140556293 3 Left 1140556287 16:75925198-75925220 CCAGCACTGTGTCCCATCCAGTG No data
Right 1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG No data
1140556286_1140556293 13 Left 1140556286 16:75925188-75925210 CCACTAGATGCCAGCACTGTGTC No data
Right 1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG No data
1140556290_1140556293 -10 Left 1140556290 16:75925211-75925233 CCATCCAGTGGCCACCCAAAATG No data
Right 1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG No data
1140556284_1140556293 25 Left 1140556284 16:75925176-75925198 CCTGGTCTTTACCCACTAGATGC No data
Right 1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG No data
1140556285_1140556293 14 Left 1140556285 16:75925187-75925209 CCCACTAGATGCCAGCACTGTGT No data
Right 1140556293 16:75925224-75925246 ACCCAAAATGTCTCAAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140556293 Original CRISPR ACCCAAAATGTCTCAAGACA TGG Intergenic
No off target data available for this crispr