ID: 1140558165

View in Genome Browser
Species Human (GRCh38)
Location 16:75945651-75945673
Sequence CAGCCAGCACATTATTGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140558163_1140558165 1 Left 1140558163 16:75945627-75945649 CCTAATTTCTCATTGTGGTTGTA No data
Right 1140558165 16:75945651-75945673 CAGCCAGCACATTATTGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140558165 Original CRISPR CAGCCAGCACATTATTGCAT AGG Intergenic
No off target data available for this crispr