ID: 1140558383

View in Genome Browser
Species Human (GRCh38)
Location 16:75947733-75947755
Sequence GACTTAGTCCCTGTTCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140558383_1140558385 9 Left 1140558383 16:75947733-75947755 CCTGGAGGAACAGGGACTAAGTC No data
Right 1140558385 16:75947765-75947787 AGATGTCTGCCAAATTTGAGAGG No data
1140558383_1140558389 29 Left 1140558383 16:75947733-75947755 CCTGGAGGAACAGGGACTAAGTC No data
Right 1140558389 16:75947785-75947807 AGGCTAAAAAGACAGTACAGGGG No data
1140558383_1140558387 27 Left 1140558383 16:75947733-75947755 CCTGGAGGAACAGGGACTAAGTC No data
Right 1140558387 16:75947783-75947805 AGAGGCTAAAAAGACAGTACAGG No data
1140558383_1140558388 28 Left 1140558383 16:75947733-75947755 CCTGGAGGAACAGGGACTAAGTC No data
Right 1140558388 16:75947784-75947806 GAGGCTAAAAAGACAGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140558383 Original CRISPR GACTTAGTCCCTGTTCCTCC AGG (reversed) Intergenic