ID: 1140571955

View in Genome Browser
Species Human (GRCh38)
Location 16:76118001-76118023
Sequence TGTTTCCTATAACAGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140571947_1140571955 21 Left 1140571947 16:76117957-76117979 CCTTGGGCTAGGGATGAGCAGAA No data
Right 1140571955 16:76118001-76118023 TGTTTCCTATAACAGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140571955 Original CRISPR TGTTTCCTATAACAGGTGGT GGG Intergenic
No off target data available for this crispr