ID: 1140573402

View in Genome Browser
Species Human (GRCh38)
Location 16:76135437-76135459
Sequence AAATATCCTGCAAAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140573402_1140573405 -10 Left 1140573402 16:76135437-76135459 CCTGTCTCCTTTGCAGGATATTT No data
Right 1140573405 16:76135450-76135472 CAGGATATTTAGCTCAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140573402 Original CRISPR AAATATCCTGCAAAGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr