ID: 1140573954

View in Genome Browser
Species Human (GRCh38)
Location 16:76141355-76141377
Sequence GGGGAGGCTGCCAAATAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140573954_1140573962 24 Left 1140573954 16:76141355-76141377 CCATTCTATTTGGCAGCCTCCCC No data
Right 1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG No data
1140573954_1140573957 -7 Left 1140573954 16:76141355-76141377 CCATTCTATTTGGCAGCCTCCCC No data
Right 1140573957 16:76141371-76141393 CCTCCCCAGGTTTCAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140573954 Original CRISPR GGGGAGGCTGCCAAATAGAA TGG (reversed) Intergenic
No off target data available for this crispr