ID: 1140573956

View in Genome Browser
Species Human (GRCh38)
Location 16:76141371-76141393
Sequence CCATTGTCTGAAACCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140573956_1140573962 8 Left 1140573956 16:76141371-76141393 CCTCCCCAGGTTTCAGACAATGG No data
Right 1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG No data
1140573956_1140573965 30 Left 1140573956 16:76141371-76141393 CCTCCCCAGGTTTCAGACAATGG No data
Right 1140573965 16:76141424-76141446 GTGTAGTTTTTTCATGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140573956 Original CRISPR CCATTGTCTGAAACCTGGGG AGG (reversed) Intergenic
No off target data available for this crispr