ID: 1140573957

View in Genome Browser
Species Human (GRCh38)
Location 16:76141371-76141393
Sequence CCTCCCCAGGTTTCAGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140573949_1140573957 26 Left 1140573949 16:76141322-76141344 CCATCTATGGATGGCCAGAACTC No data
Right 1140573957 16:76141371-76141393 CCTCCCCAGGTTTCAGACAATGG No data
1140573952_1140573957 4 Left 1140573952 16:76141344-76141366 CCTACTGGCTGCCATTCTATTTG No data
Right 1140573957 16:76141371-76141393 CCTCCCCAGGTTTCAGACAATGG No data
1140573948_1140573957 27 Left 1140573948 16:76141321-76141343 CCCATCTATGGATGGCCAGAACT No data
Right 1140573957 16:76141371-76141393 CCTCCCCAGGTTTCAGACAATGG No data
1140573954_1140573957 -7 Left 1140573954 16:76141355-76141377 CCATTCTATTTGGCAGCCTCCCC No data
Right 1140573957 16:76141371-76141393 CCTCCCCAGGTTTCAGACAATGG No data
1140573951_1140573957 12 Left 1140573951 16:76141336-76141358 CCAGAACTCCTACTGGCTGCCAT No data
Right 1140573957 16:76141371-76141393 CCTCCCCAGGTTTCAGACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140573957 Original CRISPR CCTCCCCAGGTTTCAGACAA TGG Intergenic
No off target data available for this crispr