ID: 1140573959

View in Genome Browser
Species Human (GRCh38)
Location 16:76141375-76141397
Sequence CAAGCCATTGTCTGAAACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140573959_1140573962 4 Left 1140573959 16:76141375-76141397 CCCAGGTTTCAGACAATGGCTTG No data
Right 1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG No data
1140573959_1140573965 26 Left 1140573959 16:76141375-76141397 CCCAGGTTTCAGACAATGGCTTG No data
Right 1140573965 16:76141424-76141446 GTGTAGTTTTTTCATGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140573959 Original CRISPR CAAGCCATTGTCTGAAACCT GGG (reversed) Intergenic
No off target data available for this crispr