ID: 1140573960

View in Genome Browser
Species Human (GRCh38)
Location 16:76141376-76141398
Sequence GCAAGCCATTGTCTGAAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140573960_1140573965 25 Left 1140573960 16:76141376-76141398 CCAGGTTTCAGACAATGGCTTGC No data
Right 1140573965 16:76141424-76141446 GTGTAGTTTTTTCATGCTGCTGG No data
1140573960_1140573962 3 Left 1140573960 16:76141376-76141398 CCAGGTTTCAGACAATGGCTTGC No data
Right 1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140573960 Original CRISPR GCAAGCCATTGTCTGAAACC TGG (reversed) Intergenic
No off target data available for this crispr