ID: 1140573962

View in Genome Browser
Species Human (GRCh38)
Location 16:76141402-76141424
Sequence TTGTCCCTCTAGAAAAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140573960_1140573962 3 Left 1140573960 16:76141376-76141398 CCAGGTTTCAGACAATGGCTTGC No data
Right 1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG No data
1140573954_1140573962 24 Left 1140573954 16:76141355-76141377 CCATTCTATTTGGCAGCCTCCCC No data
Right 1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG No data
1140573959_1140573962 4 Left 1140573959 16:76141375-76141397 CCCAGGTTTCAGACAATGGCTTG No data
Right 1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG No data
1140573958_1140573962 5 Left 1140573958 16:76141374-76141396 CCCCAGGTTTCAGACAATGGCTT No data
Right 1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG No data
1140573956_1140573962 8 Left 1140573956 16:76141371-76141393 CCTCCCCAGGTTTCAGACAATGG No data
Right 1140573962 16:76141402-76141424 TTGTCCCTCTAGAAAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140573962 Original CRISPR TTGTCCCTCTAGAAAAGAGA TGG Intergenic
No off target data available for this crispr