ID: 1140573965

View in Genome Browser
Species Human (GRCh38)
Location 16:76141424-76141446
Sequence GTGTAGTTTTTTCATGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140573963_1140573965 -5 Left 1140573963 16:76141406-76141428 CCCTCTAGAAAAGAGATGGTGTA No data
Right 1140573965 16:76141424-76141446 GTGTAGTTTTTTCATGCTGCTGG No data
1140573964_1140573965 -6 Left 1140573964 16:76141407-76141429 CCTCTAGAAAAGAGATGGTGTAG No data
Right 1140573965 16:76141424-76141446 GTGTAGTTTTTTCATGCTGCTGG No data
1140573958_1140573965 27 Left 1140573958 16:76141374-76141396 CCCCAGGTTTCAGACAATGGCTT No data
Right 1140573965 16:76141424-76141446 GTGTAGTTTTTTCATGCTGCTGG No data
1140573960_1140573965 25 Left 1140573960 16:76141376-76141398 CCAGGTTTCAGACAATGGCTTGC No data
Right 1140573965 16:76141424-76141446 GTGTAGTTTTTTCATGCTGCTGG No data
1140573956_1140573965 30 Left 1140573956 16:76141371-76141393 CCTCCCCAGGTTTCAGACAATGG No data
Right 1140573965 16:76141424-76141446 GTGTAGTTTTTTCATGCTGCTGG No data
1140573961_1140573965 3 Left 1140573961 16:76141398-76141420 CCTTTTGTCCCTCTAGAAAAGAG No data
Right 1140573965 16:76141424-76141446 GTGTAGTTTTTTCATGCTGCTGG No data
1140573959_1140573965 26 Left 1140573959 16:76141375-76141397 CCCAGGTTTCAGACAATGGCTTG No data
Right 1140573965 16:76141424-76141446 GTGTAGTTTTTTCATGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140573965 Original CRISPR GTGTAGTTTTTTCATGCTGC TGG Intergenic
No off target data available for this crispr