ID: 1140576741

View in Genome Browser
Species Human (GRCh38)
Location 16:76179609-76179631
Sequence TTGTCATATAACCATTGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140576736_1140576741 -10 Left 1140576736 16:76179596-76179618 CCACTTACCATCCTTGTCATATA No data
Right 1140576741 16:76179609-76179631 TTGTCATATAACCATTGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140576741 Original CRISPR TTGTCATATAACCATTGGGT TGG Intergenic
No off target data available for this crispr