ID: 1140578400

View in Genome Browser
Species Human (GRCh38)
Location 16:76199789-76199811
Sequence GACTCACTAGGGTCCTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140578393_1140578400 20 Left 1140578393 16:76199746-76199768 CCTGAGCTAGGGGAGGTCTGTGT No data
Right 1140578400 16:76199789-76199811 GACTCACTAGGGTCCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140578400 Original CRISPR GACTCACTAGGGTCCTTCAT GGG Intergenic
No off target data available for this crispr