ID: 1140579944

View in Genome Browser
Species Human (GRCh38)
Location 16:76218182-76218204
Sequence CCACCATCCCAGTTTAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140579944_1140579953 24 Left 1140579944 16:76218182-76218204 CCACCTCTAAACTGGGATGGTGG No data
Right 1140579953 16:76218229-76218251 CCCAGTAATTCATTTGCCAGGGG No data
1140579944_1140579950 22 Left 1140579944 16:76218182-76218204 CCACCTCTAAACTGGGATGGTGG No data
Right 1140579950 16:76218227-76218249 ATCCCAGTAATTCATTTGCCAGG No data
1140579944_1140579951 23 Left 1140579944 16:76218182-76218204 CCACCTCTAAACTGGGATGGTGG No data
Right 1140579951 16:76218228-76218250 TCCCAGTAATTCATTTGCCAGGG No data
1140579944_1140579949 -2 Left 1140579944 16:76218182-76218204 CCACCTCTAAACTGGGATGGTGG No data
Right 1140579949 16:76218203-76218225 GGAAAGATCATGGGTTGCATTGG No data
1140579944_1140579955 27 Left 1140579944 16:76218182-76218204 CCACCTCTAAACTGGGATGGTGG No data
Right 1140579955 16:76218232-76218254 AGTAATTCATTTGCCAGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140579944 Original CRISPR CCACCATCCCAGTTTAGAGG TGG (reversed) Intergenic
No off target data available for this crispr