ID: 1140581857

View in Genome Browser
Species Human (GRCh38)
Location 16:76240326-76240348
Sequence TACAGATTATTTCATCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 10119
Summary {0: 1444, 1: 2298, 2: 2506, 3: 2111, 4: 1760}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140581857_1140581860 8 Left 1140581857 16:76240326-76240348 CCTGGGTGATGAAATAATCTGTA 0: 1444
1: 2298
2: 2506
3: 2111
4: 1760
Right 1140581860 16:76240357-76240379 CCCCATGACAAAGTTTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140581857 Original CRISPR TACAGATTATTTCATCACCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr