ID: 1140581860

View in Genome Browser
Species Human (GRCh38)
Location 16:76240357-76240379
Sequence CCCCATGACAAAGTTTACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140581857_1140581860 8 Left 1140581857 16:76240326-76240348 CCTGGGTGATGAAATAATCTGTA 0: 1444
1: 2298
2: 2506
3: 2111
4: 1760
Right 1140581860 16:76240357-76240379 CCCCATGACAAAGTTTACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140581860 Original CRISPR CCCCATGACAAAGTTTACCT AGG Intergenic
No off target data available for this crispr