ID: 1140581985

View in Genome Browser
Species Human (GRCh38)
Location 16:76241360-76241382
Sequence AAATCCTCCTTCACAAAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140581985_1140581988 23 Left 1140581985 16:76241360-76241382 CCTATCTTTGTGAAGGAGGATTT No data
Right 1140581988 16:76241406-76241428 GGAAAAAAAAAAGTGCTAAATGG No data
1140581985_1140581987 2 Left 1140581985 16:76241360-76241382 CCTATCTTTGTGAAGGAGGATTT No data
Right 1140581987 16:76241385-76241407 AGTGGTTGATGTGATTTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140581985 Original CRISPR AAATCCTCCTTCACAAAGAT AGG (reversed) Intergenic
No off target data available for this crispr