ID: 1140584499

View in Genome Browser
Species Human (GRCh38)
Location 16:76273913-76273935
Sequence ACTATAGGTTACACCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140584499_1140584509 24 Left 1140584499 16:76273913-76273935 CCAGGCAGGGTGTAACCTATAGT No data
Right 1140584509 16:76273960-76273982 CAGGGTCTTTTCTTAATTGGTGG No data
1140584499_1140584504 5 Left 1140584499 16:76273913-76273935 CCAGGCAGGGTGTAACCTATAGT No data
Right 1140584504 16:76273941-76273963 CGTGGGAGACCTTAAACACCAGG No data
1140584499_1140584505 6 Left 1140584499 16:76273913-76273935 CCAGGCAGGGTGTAACCTATAGT No data
Right 1140584505 16:76273942-76273964 GTGGGAGACCTTAAACACCAGGG No data
1140584499_1140584507 21 Left 1140584499 16:76273913-76273935 CCAGGCAGGGTGTAACCTATAGT No data
Right 1140584507 16:76273957-76273979 CACCAGGGTCTTTTCTTAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140584499 Original CRISPR ACTATAGGTTACACCCTGCC TGG (reversed) Intergenic