ID: 1140587417

View in Genome Browser
Species Human (GRCh38)
Location 16:76309625-76309647
Sequence CCTATCAGCCCCAAATAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140587417 Original CRISPR CCTATCAGCCCCAAATAGCC AGG (reversed) Intronic
902612230 1:17603888-17603910 CCCAACAGCCCCAGAAAGCCTGG - Intronic
907304401 1:53505757-53505779 CCAAACAGCCTCAAAAAGCCAGG - Intergenic
912544171 1:110439006-110439028 ACAATCAGCCCCAAATGGCCAGG - Intergenic
915311598 1:155008206-155008228 CATGCCAGCCCCCAATAGCCAGG - Intronic
917278279 1:173354353-173354375 CCTACCAACCCAAAAAAGCCTGG + Intergenic
920115387 1:203617166-203617188 GCTCTCTGCCCCAAGTAGCCTGG + Intergenic
921601949 1:217115365-217115387 CCTGTCTGCCCCAACCAGCCTGG + Intronic
924272054 1:242344108-242344130 ACAATCGGCCCCAAATGGCCGGG + Intronic
1062901746 10:1151876-1151898 CAGATGAGACCCAAATAGCCAGG - Intergenic
1065248011 10:23778666-23778688 GCAATTGGCCCCAAATAGCCAGG - Intronic
1072279768 10:93855221-93855243 ACAATCGGCCCCAAATGGCCAGG + Intergenic
1072633236 10:97161253-97161275 CAAATCAGCCCCTCATAGCCAGG + Intronic
1073506988 10:104004258-104004280 CCTATCTGCCCCAAATTCCTAGG + Intronic
1076262325 10:129077564-129077586 CCTCTCAGCCCACAAAAGCCAGG - Intergenic
1078082294 11:8212927-8212949 TCAATGAGCCCCAAATACCCTGG + Intergenic
1079047323 11:17117350-17117372 TTTATCTGCCCCAAATAGCATGG + Intronic
1083651285 11:64206320-64206342 CCTGTGAGTCCCAAATAACCTGG + Intergenic
1087137157 11:94732383-94732405 CTTATCACCCCCAAACATCCTGG - Intronic
1090683968 11:129095108-129095130 CCCATTAGCCCAAAAAAGCCAGG + Intronic
1092312778 12:7375980-7376002 CATATCAGCTCCAACCAGCCTGG + Exonic
1094001965 12:25705420-25705442 ACCATCAGCCCCAAATGGCCAGG + Intergenic
1102797390 12:115700637-115700659 CCTTTTCACCCCAAATAGCCCGG - Intergenic
1103982078 12:124743049-124743071 GAAATCAGCCCCAAATTGCCTGG + Intergenic
1106928462 13:34637567-34637589 ACAATCAGCCCCAAACAGCCAGG - Intergenic
1108440535 13:50448661-50448683 ACAATCAGCCCCGAATGGCCAGG + Intronic
1108641391 13:52385614-52385636 CCTATCAACCCAGAAAAGCCAGG - Intronic
1108854702 13:54778336-54778358 CCTACCAGCCAAAAAAAGCCTGG + Intergenic
1114287025 14:21254421-21254443 TATATAAGCCCCAAAAAGCCTGG + Intronic
1122851471 14:104534837-104534859 ACAATCAGCCCCAAATGGCCAGG + Intronic
1124608680 15:31192931-31192953 CCTAGGAGCCCCAAAAAGCTGGG + Intergenic
1125433788 15:39625108-39625130 CCCATCTTCCCCAAACAGCCGGG + Intronic
1127962828 15:63902575-63902597 CCAATCAGATCCAAAAAGCCTGG - Intergenic
1128210524 15:65897709-65897731 CCACTCAGCCCCAAATGCCCTGG - Exonic
1129102057 15:73274235-73274257 TTGATCTGCCCCAAATAGCCTGG - Intronic
1129511256 15:76124546-76124568 CCTAAGACTCCCAAATAGCCTGG - Intronic
1129608539 15:77036564-77036586 CCAAGCACCCCCACATAGCCAGG + Intronic
1133676907 16:8081932-8081954 CCTATCAACTCCAAATAGTGGGG + Intergenic
1140587417 16:76309625-76309647 CCTATCAGCCCCAAATAGCCAGG - Intronic
1143407168 17:6685326-6685348 CCTGCCATCCCCAAATAGCTAGG - Exonic
1148357151 17:46983073-46983095 GCAATCAGCCCCAAATGGCCAGG - Intronic
1152039671 17:77894666-77894688 CCCATCAGCCCCAACGGGCCAGG + Intergenic
1152643763 17:81459659-81459681 CATATCTGCCCCCAACAGCCTGG + Intronic
1158081984 18:53603236-53603258 ACAATCAGCCCAAAATGGCCAGG + Intergenic
1158789137 18:60754547-60754569 ACAATCAGCCCCAAAGAGTCAGG + Intergenic
1159826524 18:73219504-73219526 CCTGTCAGTCTCAAATGGCCTGG + Intronic
1168025305 19:53639513-53639535 GCAATCAGCCCCAAATGCCCAGG + Intergenic
924983376 2:244810-244832 CCTAGCAGCCACAAATAGTAAGG - Intronic
927283360 2:21331187-21331209 GCAATCAGCCCCAAACAGTCAGG + Intergenic
928627748 2:33158284-33158306 ACTATCAAACCCAAATATCCAGG + Intronic
929208775 2:39329487-39329509 CCAATGAGCCTCAAATACCCTGG + Intronic
929803299 2:45122692-45122714 CCAATAATACCCAAATAGCCTGG + Intergenic
932865340 2:75335573-75335595 GCAATCAGCCCAAAATGGCCAGG - Intergenic
934729662 2:96648597-96648619 ACAATCAGCTCCAAATGGCCAGG - Intergenic
935199658 2:100845230-100845252 ATGATCAGCCCCAAATGGCCAGG - Intronic
935794553 2:106628700-106628722 CCTGTCAGCCTCAAACAGGCAGG + Intergenic
935930405 2:108118002-108118024 AAGATCAGCCCCAAATGGCCAGG - Intergenic
937647112 2:124277764-124277786 CCTATCAGCCTTGAATTGCCTGG - Intronic
938047845 2:128139332-128139354 CATGTCAGTCCCAAATAGCTGGG + Intronic
938058952 2:128237499-128237521 ACAATCAGCCCCAAATGGCCAGG + Intronic
938729472 2:134135276-134135298 CCTATCAGTCCCAAAGCCCCTGG - Intronic
939143232 2:138379748-138379770 CCAAACAGCCCCAGATAGGCGGG + Intergenic
939918140 2:148073962-148073984 CCTATAAGCCCAAAATAACCAGG - Intronic
940303025 2:152195781-152195803 CCTACCAGCCAAAAAAAGCCCGG + Intergenic
942168733 2:173268353-173268375 CCTATCTGACCCAGATAGGCTGG - Intergenic
946024998 2:216666304-216666326 GTTATCAGCCTCAAATAGCAGGG + Intergenic
947992522 2:234497825-234497847 CCTACCTGCCCCAAGTAGCTCGG + Intergenic
1170864511 20:20141697-20141719 CCTCTCAACCCCAAATATCTGGG - Intronic
1171391398 20:24803722-24803744 CCTGTGAGCCCCAAATCCCCAGG + Intergenic
1173839333 20:46147039-46147061 TCTGTCTCCCCCAAATAGCCCGG - Intergenic
1176073205 20:63237311-63237333 TCTACCAGCCCCAAAGACCCCGG - Intronic
1177714036 21:24815998-24816020 ACTATCAGCCCCAAAATACCTGG + Intergenic
1180697011 22:17757980-17758002 GCTGTCAGCCCCACATGGCCAGG - Intronic
1184658533 22:45954553-45954575 TCTGTCAGCCCCACATACCCCGG - Intronic
952657857 3:35807915-35807937 ACTATGAGCCCAAATTAGCCGGG + Intergenic
953578223 3:44130028-44130050 CCTATCTGCCCCACAGAGCCTGG - Intergenic
953951536 3:47194359-47194381 ACAATCAGCCCCAAACAGCCAGG - Intergenic
956697913 3:71934320-71934342 GCAATCAGCCCCAAGTGGCCAGG + Intergenic
957003016 3:74908784-74908806 CTTTTCAACCCCAAATAGCACGG - Intergenic
957411604 3:79848662-79848684 CATATCTGCCACAAATATCCAGG + Intergenic
957502775 3:81078195-81078217 GCAATCAGCCCCAAACAGCAGGG - Intergenic
960476015 3:118129744-118129766 GCAATCAGCCCCAAATGACCAGG + Intergenic
960964571 3:123095933-123095955 GCTCTCATCCCTAAATAGCCTGG + Intronic
961166412 3:124766755-124766777 GCTCTCAGCCCCAAGTGGCCTGG - Intronic
962715784 3:138124894-138124916 CAAATCAGCCCCAAGTAGCCAGG + Intronic
963667002 3:148200618-148200640 CATATCAGCACCAAATTCCCAGG + Intergenic
964494061 3:157269523-157269545 TCTCACAGCTCCAAATAGCCTGG - Intronic
966853830 3:184180703-184180725 CCTATAAGCCCCAAAGGGCAGGG - Intronic
972401928 4:38712871-38712893 ACAATCAGTCCAAAATAGCCAGG - Intergenic
977672786 4:99715401-99715423 GCAATAGGCCCCAAATAGCCAGG - Intergenic
977788616 4:101070791-101070813 ATTATCAGCCCCAAATTCCCTGG - Intronic
981666814 4:147237401-147237423 CCTACCAGCCCCAAGCAGCAAGG + Intergenic
987149882 5:15028080-15028102 ACAATCAGCCCTAAATATCCAGG + Intergenic
987292159 5:16519589-16519611 CCTTTCAGCCCAAAATAACCAGG + Intronic
992226499 5:74624148-74624170 ACAGTCAGCCCCAAATGGCCAGG - Intergenic
993613783 5:90085277-90085299 CCTAGCACCCGCATATAGCCTGG + Intergenic
995176538 5:109184183-109184205 TATATCAGCCCCAAATACCCAGG - Intronic
997156334 5:131563616-131563638 CATATCAGTCCCAAGTAGCTGGG + Intronic
997574669 5:134965408-134965430 CATCTCAGCCACAGATAGCCGGG - Exonic
999536125 5:152519213-152519235 TCTATAAACCCCAAATAACCTGG - Intergenic
1004057547 6:12155407-12155429 CCTATCACCCCCCAACAGACAGG + Intronic
1006564923 6:34947538-34947560 CCTATCACCTCCTAATGGCCTGG - Intronic
1006699252 6:35958382-35958404 TCTAACAGCCCCAAGTAGCTGGG - Intronic
1008876503 6:56335434-56335456 ACAATCGGCCCGAAATAGCCAGG + Intronic
1009906484 6:69875293-69875315 CCTAGAAGTCCCAAATAACCAGG - Intronic
1016797937 6:148137797-148137819 ACAATCTGCCCCAAATGGCCAGG - Intergenic
1019906131 7:4066601-4066623 CCTATCTCCTCCAGATAGCCAGG + Intronic
1034747825 7:153538804-153538826 CCTATCAGCACGAAATTCCCGGG - Intergenic
1034998006 7:155590624-155590646 ACTATTGGCCCCAAATGGCCCGG + Intergenic
1034998200 7:155591596-155591618 ACCATCGGCCCCAAATGGCCCGG - Intergenic
1036610615 8:10346799-10346821 GCAATCAGCCCCAAATGGCAAGG - Intronic
1036801622 8:11796722-11796744 GCAATCAGCCCCAAATGGTCAGG - Intronic
1039130795 8:34261975-34261997 CCTATGAGCCCCAAGAAGGCAGG + Intergenic
1039751254 8:40481061-40481083 CCCATGACCCCCAAAGAGCCAGG - Intergenic
1040640111 8:49323383-49323405 GCTATCAGCTCCAAATGGTCAGG + Intergenic
1041183352 8:55271790-55271812 ACAATCAGCCCCAAATGGCTGGG - Intronic
1041487083 8:58391537-58391559 CGCATCATCCCCAAATAGACAGG + Intergenic
1041777225 8:61536679-61536701 CAGAATAGCCCCAAATAGCCAGG - Intronic
1046949428 8:120005692-120005714 CGTATCCTCCCCAAGTAGCCAGG - Intronic
1048053308 8:130839744-130839766 CCTATGAGCCCCTTATACCCAGG - Intronic
1048280786 8:133104127-133104149 CCTGTGACCCCCAAACAGCCAGG - Intronic
1048373236 8:133798783-133798805 CCTCCCAACCCCAAAAAGCCCGG - Intergenic
1049996854 9:1042799-1042821 CCTATGGGGCCCAAAGAGCCTGG + Intergenic
1056224863 9:84484755-84484777 GTTCTCAGCCCCAAAGAGCCAGG - Intergenic
1057868502 9:98700435-98700457 CCTATCAGACCCAATGAGCCAGG - Intronic
1059176056 9:112171072-112171094 GCAATCAGCCCCAAATGGTCAGG + Intronic
1059314433 9:113411790-113411812 CACCTCAGCCCCAAATAGCTGGG + Intronic
1059968154 9:119636791-119636813 GCAATCAGCCCCAAATGGTCAGG - Intergenic
1186863478 X:13695972-13695994 TCTATCAGGTCCAAACAGCCTGG - Intronic
1189674632 X:43449032-43449054 GCAATCAGCTCCAAATGGCCAGG - Intergenic
1192988165 X:76422797-76422819 ACAATCAGCCCAAAATGGCCAGG - Intergenic
1193448891 X:81642209-81642231 CCTATCAACCAAAAAAAGCCTGG - Intergenic
1193565205 X:83067300-83067322 CAAATCAGCCACAAATTGCCAGG + Intergenic
1193606487 X:83575051-83575073 CCTATAAGCCCCAAATGGAAAGG + Intergenic
1194001705 X:88437784-88437806 GCAATCAGCCCCAAATGACCAGG + Intergenic