ID: 1140587491

View in Genome Browser
Species Human (GRCh38)
Location 16:76310129-76310151
Sequence CTGAATACACAAATGGCAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 479
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 423}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140587491_1140587498 17 Left 1140587491 16:76310129-76310151 CCATTTGCCATTTGTGTATTCAG 0: 1
1: 0
2: 3
3: 52
4: 423
Right 1140587498 16:76310169-76310191 AACAGAGGTACATCAGGTACTGG 0: 1
1: 0
2: 0
3: 4
4: 122
1140587491_1140587495 -7 Left 1140587491 16:76310129-76310151 CCATTTGCCATTTGTGTATTCAG 0: 1
1: 0
2: 3
3: 52
4: 423
Right 1140587495 16:76310145-76310167 TATTCAGTCTCTCGTTGGGCAGG 0: 1
1: 0
2: 1
3: 2
4: 109
1140587491_1140587499 18 Left 1140587491 16:76310129-76310151 CCATTTGCCATTTGTGTATTCAG 0: 1
1: 0
2: 3
3: 52
4: 423
Right 1140587499 16:76310170-76310192 ACAGAGGTACATCAGGTACTGGG 0: 1
1: 0
2: 0
3: 5
4: 136
1140587491_1140587496 2 Left 1140587491 16:76310129-76310151 CCATTTGCCATTTGTGTATTCAG 0: 1
1: 0
2: 3
3: 52
4: 423
Right 1140587496 16:76310154-76310176 TCTCGTTGGGCAGGAAACAGAGG 0: 1
1: 0
2: 0
3: 11
4: 148
1140587491_1140587497 11 Left 1140587491 16:76310129-76310151 CCATTTGCCATTTGTGTATTCAG 0: 1
1: 0
2: 3
3: 52
4: 423
Right 1140587497 16:76310163-76310185 GCAGGAAACAGAGGTACATCAGG 0: 1
1: 1
2: 0
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140587491 Original CRISPR CTGAATACACAAATGGCAAA TGG (reversed) Intronic
902066224 1:13690420-13690442 CTGAGTACACAAATGTCTAAAGG + Intergenic
902752214 1:18524682-18524704 ATGAATACACAAGTGCCAAAAGG - Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903073404 1:20741414-20741436 ATGAAAAAACAAATGTCAAAAGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
904791474 1:33025311-33025333 CTGAATAAACATTTGCCAAAGGG + Intronic
904819968 1:33235642-33235664 CTGAATACAGAACAGGCAAGTGG + Intergenic
906769766 1:48473163-48473185 ATGCATACATGAATGGCAAAAGG - Intergenic
907166015 1:52411986-52412008 CTGATTTCAAAAATGCCAAATGG - Intronic
907885121 1:58585718-58585740 AAGAATACACAAATAGTAAATGG + Intergenic
908022077 1:59908409-59908431 CTGATAACAGAAAAGGCAAATGG + Intronic
909258771 1:73459644-73459666 ATGAAAACAGAAATGGCACATGG + Intergenic
909419059 1:75442670-75442692 CTGAATACAAGAAGGACAAATGG - Intronic
909587363 1:77305113-77305135 GACAATATACAAATGGCAAACGG - Intronic
910244918 1:85128298-85128320 CTGAACACAGAAAGGGCTAAAGG - Intronic
910610544 1:89136947-89136969 CACAATAAAAAAATGGCAAAAGG + Intronic
910683981 1:89897370-89897392 CAGAAGACAAAAATGGCAACAGG - Intronic
911096338 1:94058128-94058150 CAGATAAAACAAATGGCAAAGGG + Intronic
911337117 1:96594550-96594572 CTGAATACAGCAAAGACAAATGG + Intergenic
912247299 1:107973185-107973207 TTGCACACACAAATGGAAAAAGG + Intergenic
912647945 1:111412938-111412960 GTGCATACACACACGGCAAAAGG + Intergenic
912740191 1:112187332-112187354 CTATATACATACATGGCAAATGG - Intergenic
916180585 1:162080159-162080181 CTGAATATAAAAATTGTAAAGGG - Intronic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918732080 1:188011830-188011852 CTGAATACAACATTGGCAAGTGG + Intergenic
918779574 1:188681378-188681400 CTGAATAGACATTTCGCAAAAGG - Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922771453 1:228186020-228186042 CAGAATGCACAAATGACAATGGG + Intergenic
923327939 1:232897373-232897395 CTCAATACACCAAAGGGAAAAGG + Intergenic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1063897508 10:10697641-10697663 CTGCATCCTCACATGGCAAAAGG + Intergenic
1065632746 10:27697724-27697746 CTCAAAATACAAATTGCAAATGG + Intronic
1065769773 10:29067060-29067082 CTTTAAAGACAAATGGCAAATGG + Intergenic
1065800992 10:29352204-29352226 CTGACTGCAGAAATGGGAAAGGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067690844 10:48501073-48501095 GTGAAAAGACAAATGGCAAAAGG + Intronic
1067812795 10:49443168-49443190 TTTACAACACAAATGGCAAAAGG - Intergenic
1068438948 10:57026789-57026811 CATAATTTACAAATGGCAAAGGG + Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1070620540 10:78006536-78006558 TAGAATAAAGAAATGGCAAATGG + Intronic
1071026942 10:81126226-81126248 CTGAACACACAATCTGCAAATGG - Intergenic
1071032286 10:81198692-81198714 ATTAATACAAAAATGACAAATGG + Intergenic
1071700549 10:87928599-87928621 AAAGATACACAAATGGCAAATGG - Intronic
1072088652 10:92105426-92105448 ATGAACACAAAAATGGGAAATGG - Intronic
1072529800 10:96308190-96308212 CTGAACACACAAATTAGAAATGG + Intronic
1073253302 10:102134831-102134853 CTGAATTCCCAAATAGCACAGGG + Intronic
1073657780 10:105435796-105435818 TTGGATAAACAAATGGCAGAAGG - Intergenic
1074079423 10:110156098-110156120 ATGAATACAAAAATTGCAGAGGG + Intergenic
1074273142 10:111974857-111974879 CTGAATAAATTAATGGCAATGGG + Intergenic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074564111 10:114561341-114561363 CTTAATACACACATGGCTGAAGG + Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1077204315 11:1334929-1334951 CTCAATTAAAAAATGGCAAAGGG - Intergenic
1079502498 11:21117130-21117152 CTCAATACACAAATATCAAGAGG - Intronic
1080319953 11:30996578-30996600 CAGAATACAGAAAGGGCAAAAGG - Intronic
1080369012 11:31612395-31612417 CTGACTACAGAAATCTCAAATGG + Intronic
1080607573 11:33876348-33876370 CTGAAGACACAACTGGGAACAGG - Intronic
1081280895 11:41208530-41208552 CTGAAGACAGAAATAGCAATGGG + Intronic
1082201498 11:49376160-49376182 ATGAATGCAAAAATAGCAAAAGG - Intergenic
1082312829 11:50674852-50674874 ATGAATGCACATATGTCAAACGG + Intergenic
1082312918 11:50676055-50676077 ATGAATGCACACATGCCAAATGG + Intergenic
1082859617 11:57842294-57842316 CTGAATACAACAAGGACAAATGG + Intergenic
1083775533 11:64892870-64892892 CTGTATGCACCACTGGCAAAGGG - Intergenic
1083868478 11:65471792-65471814 CTCGATGCACCAATGGCAAATGG - Intergenic
1085021151 11:73209309-73209331 CTTAATAGAAAAATGGCTAAAGG + Intergenic
1086236060 11:84632115-84632137 CTGAATACCAAACTGCCAAATGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086922357 11:92601911-92601933 CCAAATACACAAAAGGCACACGG - Intronic
1087416822 11:97867074-97867096 CTGATTAAAAAATTGGCAAAAGG - Intergenic
1090096186 11:123743696-123743718 CTGAATACAGAATGGGCAAGTGG + Intergenic
1090834465 11:130444016-130444038 ATGAACACACAATTAGCAAAGGG + Intergenic
1091128502 11:133123684-133123706 CTGAATAACCATATGCCAAAAGG + Intronic
1091971618 12:4792298-4792320 CTGAAGACACAAGTGTAAAAGGG + Intronic
1092116338 12:6011291-6011313 CTGAATACACAGATTCCTAAAGG + Intronic
1093254815 12:16853990-16854012 CTGAAAACATAAAAGACAAAAGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1093922902 12:24879731-24879753 CTGAAGTCACAAAGAGCAAAAGG - Intronic
1094767956 12:33619259-33619281 GTAAATACACACATTGCAAATGG - Intergenic
1095034680 12:37346771-37346793 CTGAATACACACAACACAAAAGG + Intergenic
1095270639 12:40214651-40214673 CTGCATCCACACATGGCAAAAGG - Intronic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096088216 12:48880626-48880648 CTGAAAACTCAAATCACAAAAGG - Intergenic
1096588987 12:52644709-52644731 CAGAATACACATCTGGAAAATGG + Exonic
1096892602 12:54786991-54787013 CTGCATAGACCAATGGCACATGG + Intergenic
1096930805 12:55207534-55207556 CTGAATAGACACATCTCAAAAGG + Intergenic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098087398 12:66861566-66861588 CTGAATACAGAAATCCCACATGG + Intergenic
1099064282 12:77954308-77954330 CTTACTACACAACTGGCAGATGG - Intronic
1101608072 12:106265104-106265126 CTGAATAGACATTTTGCAAAAGG + Intronic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1104005702 12:124890713-124890735 CTGTAGACACAAATTGCAGATGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1106166229 13:27249058-27249080 CTAAAAACACAAATGCCAACAGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107966280 13:45601174-45601196 CTGAATACAGCATGGGCAAATGG - Intronic
1107984986 13:45767781-45767803 CTGAATACAACCATGGCAAGTGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109227960 13:59719720-59719742 CTGAATAAAGAAATGACAGATGG + Intronic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109853558 13:68100753-68100775 ATGAACACACAAATGATAAAGGG - Intergenic
1110357964 13:74590312-74590334 CTGAATGCATAAATGAAAAAAGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112188791 13:97154772-97154794 CTGAATAAATAAATGGTATAAGG + Intergenic
1114305734 14:21421080-21421102 CTGAAAAATCAAATGGCAAATGG + Intronic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114690070 14:24573332-24573354 CTGTGTCCACATATGGCAAAAGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115738348 14:36359889-36359911 CTGAAAAATCACATGGCAAAGGG - Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116296572 14:43119202-43119224 GTAAATACACACATTGCAAATGG + Intergenic
1116344886 14:43780227-43780249 GAGAATACAGAAAGGGCAAAGGG + Intergenic
1116713974 14:48405400-48405422 CAAGATACACAAATGGCCAATGG - Intergenic
1118897897 14:69962075-69962097 CTGAATTAAGAAATGGGAAAAGG - Intronic
1119584411 14:75819344-75819366 TAGTATCCACAAATGGCAAAGGG - Intronic
1120040773 14:79750462-79750484 CTAAATTCACAAATGGGACAAGG - Intronic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120800877 14:88686819-88686841 ATCAACAAACAAATGGCAAAGGG + Intronic
1121180341 14:91924218-91924240 CTCAACACATAAATGGTAAATGG + Intronic
1121669793 14:95699747-95699769 CTGAATAAACAAATACCAGAAGG + Intergenic
1122172023 14:99884549-99884571 CGGAATAGAAAAATGGTAAAGGG + Intronic
1122758653 14:104003333-104003355 CTTAATAAACAAAAGACAAAGGG + Intronic
1122926877 14:104907335-104907357 CTGAAGAAACAACTTGCAAATGG + Intergenic
1123896292 15:24833496-24833518 CTGAAAAATCAACTGGCAAAAGG + Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1125366503 15:38921942-38921964 CTGAATATAATAATTGCAAAGGG + Intergenic
1126084476 15:44998962-44998984 CTGAACACACAATTTGAAAAAGG - Intergenic
1126243760 15:46477450-46477472 CTGAATACAACATTGACAAATGG - Intergenic
1126424820 15:48515941-48515963 CTGAAAACACCAATAACAAAAGG + Intronic
1127379931 15:58422153-58422175 ATGAAGGTACAAATGGCAAATGG - Intronic
1127896665 15:63306248-63306270 CTGAAGTCACAAAAGGCTAAAGG + Exonic
1129075377 15:72990910-72990932 CTAAAAGCACAAATGACAAAAGG + Intergenic
1131423916 15:92329916-92329938 CTGTATCCTCATATGGCAAAAGG - Intergenic
1131932032 15:97453495-97453517 CTGAGTAAACAATTGGCAAGGGG - Intergenic
1132200389 15:99949785-99949807 CTGAATACACATTTCTCAAAAGG - Intergenic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1134336373 16:13303289-13303311 CTGTATTCACAATGGGCAAAAGG + Intergenic
1136071872 16:27792174-27792196 CTGAACACATATAAGGCAAATGG - Intronic
1136385769 16:29925261-29925283 CTGTATACACACATTGCAGAAGG - Intronic
1137916667 16:52439206-52439228 CTGAAGACGCATATGGCAGACGG - Exonic
1138786835 16:59856477-59856499 CTGAAAAGTCAATTGGCAAAAGG - Intergenic
1138934665 16:61704332-61704354 CTCAATAAACATATGACAAATGG - Intronic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1141268462 16:82518186-82518208 CTAGATCCACAAATGGCTAAAGG - Intergenic
1142221706 16:88858082-88858104 CTGAACACACACAGGGTAAATGG + Intronic
1144597181 17:16580523-16580545 CTGATTTCACAAATGGCGGAGGG + Intergenic
1146445498 17:32929508-32929530 CAGAAAACACAAAGGCCAAAAGG + Intronic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148500856 17:48089827-48089849 ATAAATAAATAAATGGCAAAAGG + Intronic
1148526741 17:48345815-48345837 CTAGATACAAAAATGACAAAAGG + Intronic
1148592827 17:48829610-48829632 CTGAATACAATAATGACAAGTGG + Intergenic
1150099825 17:62412971-62412993 CTTCATATACAAATTGCAAATGG + Intronic
1152435040 17:80271350-80271372 CTGAGTACTCAAAGGGAAAAAGG + Intronic
1153166810 18:2270958-2270980 CTGTGTTCTCAAATGGCAAAAGG - Intergenic
1154255942 18:12780894-12780916 TTGAACCCACAAATGTCAAATGG + Intergenic
1155257112 18:24008415-24008437 CTGCATAAACAGAAGGCAAATGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155700490 18:28737107-28737129 CTGTGTACACACATGGCAGAAGG - Intergenic
1155735527 18:29218095-29218117 CTGAATACAGGAATAGCAAGAGG + Intergenic
1156230393 18:35148565-35148587 CTCAATAAAATAATGGCAAATGG - Intergenic
1156821606 18:41379726-41379748 CTGAATACACAAATCTGAGATGG + Intergenic
1156879332 18:42057954-42057976 CTGAATAAAGAAATGGTAGAAGG + Exonic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157254821 18:46129497-46129519 GCTAATACACAAATGGCAAAAGG - Intergenic
1157902204 18:51529450-51529472 GAGGAAACACAAATGGCAAATGG + Intergenic
1158038854 18:53068828-53068850 CTGATTGCAAAAATGGGAAATGG + Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158903969 18:61993007-61993029 CTGAAACCACAAATTGCATAAGG - Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159420551 18:68213403-68213425 CTGAATAGAGGAATGGCAATGGG + Intergenic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1166352996 19:42209437-42209459 CTGAATACACAAATGAAACTAGG + Intronic
1168351452 19:55678484-55678506 CTGGAAACACAAATGGGACATGG - Intronic
1168456663 19:56516791-56516813 CTGAAGACACAAACTGAAAATGG + Intronic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927260334 2:21081903-21081925 CTCAATATATAAATGGCAGAGGG - Intergenic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930500702 2:52213918-52213940 CTGAATCCATAAATGGCAGGTGG + Intergenic
931219429 2:60276030-60276052 ATGAATAAATAAATGGCACAGGG - Intergenic
931258306 2:60594602-60594624 CTGAACTAAGAAATGGCAAAAGG - Intergenic
931345741 2:61444403-61444425 ATGAAGACACAAAAGCCAAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933262633 2:80147423-80147445 CTGAACATAAAAATGGCGAATGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935254470 2:101297213-101297235 CAAAATACAAAAAGGGCAAATGG + Intronic
935514191 2:104015435-104015457 CAAAATCCACAAATGACAAAAGG - Intergenic
935730588 2:106062109-106062131 CTGAATGCACACAGGGGAAAGGG - Intergenic
935826845 2:106960757-106960779 CTGAAAAGACAAAAGACAAAAGG + Intergenic
936644374 2:114351675-114351697 CTGCAAAGACACATGGCAAAGGG - Intergenic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938737811 2:134202362-134202384 CTGTGTACTCAAATGGCAGAAGG - Intronic
938839440 2:135144726-135144748 CACAAAACACAAATGGCAAATGG - Intronic
938917364 2:135956268-135956290 TTGAATACACGATTGGCAAGTGG + Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939090524 2:137775382-137775404 CTGAAAAATCAAATTGCAAAAGG + Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939142051 2:138366060-138366082 TTAAATACACAAATGAAAAAAGG + Intergenic
939331982 2:140775582-140775604 CACACTACCCAAATGGCAAATGG - Intronic
940075974 2:149742806-149742828 ATGAAAGGACAAATGGCAAAAGG + Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940334848 2:152515247-152515269 ATGAATACACAAATATAAAACGG - Intronic
940735289 2:157444335-157444357 CTAAAGAAAAAAATGGCAAATGG - Intronic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
944035781 2:195293076-195293098 CAGAATACAAAAATGATAAAGGG + Intergenic
944865960 2:203862052-203862074 CTGAATATTCAAATGTCTAAGGG - Intergenic
945158922 2:206868494-206868516 GTGAATTCTGAAATGGCAAAAGG - Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
947082582 2:226415224-226415246 CTGAATCCTCATATGGCAGAAGG - Intergenic
947108086 2:226688900-226688922 ATGAATAGACAATTTGCAAAAGG + Intergenic
1169500061 20:6150964-6150986 CTGCATTCACTCATGGCAAAAGG + Intergenic
1170724633 20:18915537-18915559 CTGAATACAGCAAGGGCAAGTGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1173231356 20:41201320-41201342 ATGAGAACACAAATGTCAAAGGG + Intronic
1173761298 20:45562820-45562842 ATGAAGACACATATGGGAAATGG - Intronic
1173898058 20:46565899-46565921 CTGAGTAAACAAATGGCCATAGG - Intronic
1174127742 20:48319741-48319763 AAGATTACAAAAATGGCAAAGGG + Intergenic
1174591966 20:51653150-51653172 CTGAAGACACCAAAGGCCAAAGG + Intronic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176153355 20:63604947-63604969 CTGAATTCAGAAATGGCAGAGGG + Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177731565 21:25033909-25033931 CTGAATTATCATATGGCAAAAGG - Intergenic
1178037665 21:28602916-28602938 CAAAGTACAGAAATGGCAAAAGG - Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178604655 21:34025298-34025320 CAGAAGACACTAATGGCAGAAGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1178698460 21:34814293-34814315 CTCAAAACACAGAAGGCAAAAGG - Intronic
1178751758 21:35311328-35311350 ACAAATACACAAATGGGAAACGG - Intronic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179730940 21:43367057-43367079 CAGAGGACACAAAGGGCAAATGG + Intergenic
1179984298 21:44912492-44912514 CAGAATACAAAAATGTCAAAAGG + Intronic
1180239704 21:46493427-46493449 CTGAAAACACTCATGGAAAAAGG - Intronic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181106710 22:20579947-20579969 CTGAAGACACAACTGGCATTAGG - Intronic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1181758240 22:25040233-25040255 CCCAATACTCAAAAGGCAAAGGG + Exonic
1182016799 22:27047179-27047201 CTGAAAAGACACATTGCAAATGG + Intergenic
1182831826 22:33310411-33310433 CAGAAGACACCAATGGCAAAGGG - Intronic
1185082991 22:48720065-48720087 TTAAATACATAAATGGCAAATGG + Intronic
1185419438 22:50727318-50727340 CTGGATCCAGAAATGGCAAGGGG + Intergenic
949142250 3:648857-648879 CTGAATTCAAAAGTGGAAAAAGG + Intergenic
949603271 3:5624955-5624977 CTATATCCTCAAATGGCAAAAGG - Intergenic
949731645 3:7120674-7120696 TTGGTTTCACAAATGGCAAATGG - Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
949915905 3:8964330-8964352 CTGAATACAACATGGGCAAATGG - Intergenic
951787916 3:26443287-26443309 GTAAATACACAAATGAGAAAAGG - Intergenic
951944491 3:28119522-28119544 CTAAAGACACATAAGGCAAAGGG - Intergenic
952163783 3:30723649-30723671 CTGAAGAGAAATATGGCAAATGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953317021 3:41938265-41938287 CTAAATATACAATTGGTAAATGG + Intronic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956466725 3:69527067-69527089 CGGAGGACACAAATAGCAAAGGG - Intronic
957673588 3:83338485-83338507 TAGAGTACACATATGGCAAATGG - Intergenic
957782216 3:84834365-84834387 CTGAATATAGTATTGGCAAATGG + Intergenic
957849765 3:85792072-85792094 GTGAAAACACAAATGCTAAATGG - Intronic
957862053 3:85966078-85966100 CTCAAAATACAAATGGGAAATGG + Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959921030 3:111868452-111868474 ATGAATAAGCAAATGGCAAGGGG - Intronic
960344342 3:116513958-116513980 CTGAAAAATCAAATGGCTAAAGG + Intronic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960837815 3:121925599-121925621 CTCAATGAACAAATGACAAAGGG - Intronic
961938153 3:130608004-130608026 CTGCATCCACACATGGCAGAAGG + Intronic
963347741 3:144116017-144116039 CTGCATCCACACATGGTAAAAGG - Intergenic
963380407 3:144522853-144522875 CTGAAAACAAAAATGGTGAAAGG + Intergenic
964659783 3:159107302-159107324 CTGTGTCCACAAATGGCAAAAGG - Intronic
965370173 3:167852334-167852356 CTGAGTACACAAAGGGAAATAGG + Intergenic
965980141 3:174680516-174680538 CTGAAAACAAAAATTCCAAAAGG + Intronic
966477892 3:180371108-180371130 CTCAATAAACTACTGGCAAACGG + Intergenic
967960338 3:194916265-194916287 CTTAATACAGTAATAGCAAATGG - Intergenic
968217058 3:196901528-196901550 CTGAGTACACAAATGCCTGATGG + Intronic
970302289 4:14693923-14693945 CTGAATAAGCAAAATGCAAATGG + Intergenic
970943870 4:21667256-21667278 CTCCATAGACAAATGGGAAAAGG - Intronic
971218130 4:24680867-24680889 CTTAATACCCAAAGGGCAGAGGG - Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971596159 4:28531628-28531650 ATAAATATACTAATGGCAAAAGG + Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
972722012 4:41709116-41709138 CTGAAGTCACAAATGGTAAGTGG - Intergenic
973982643 4:56319065-56319087 CACAATAGACAAATGGCATATGG - Intronic
974361645 4:60888497-60888519 ATGAATACATGAATGACAAATGG - Intergenic
974900061 4:67985516-67985538 GTGACTATACAAAAGGCAAAGGG + Intergenic
975299331 4:72771444-72771466 CTTAATAAATAAATGCCAAATGG + Intergenic
975846884 4:78534485-78534507 GTGAATACACAACTGGCACAGGG - Intronic
976142371 4:82005765-82005787 CTGAATATACACATGCCAGAGGG + Intronic
977189581 4:93982920-93982942 CTGAATGCACAGTTGGCCAATGG - Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982387787 4:154831099-154831121 CTGAATAGGCAGATGACAAATGG + Intergenic
984013925 4:174403768-174403790 CTGAATATCCAAATCGCAAAAGG - Intergenic
984172137 4:176372325-176372347 CTAAAGACACAAATAGTAAAGGG - Intergenic
984447270 4:179852563-179852585 ATGAATACACATTTGTCAAATGG + Intergenic
986481166 5:8189639-8189661 CAGAATCCACAAATAGCAAAAGG + Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986900462 5:12424814-12424836 CTGAATACACCATGGGCAGATGG - Intergenic
987904488 5:24058369-24058391 CTGAATACACAGTTGAGAAAAGG + Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988012001 5:25500854-25500876 CTGAATATTCACATGGCAGAAGG - Intergenic
988417656 5:30966443-30966465 CTGAAAACTCAACTTGCAAAAGG + Intergenic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
989084325 5:37658824-37658846 CAGAAACCACAACTGGCAAATGG - Intronic
989844320 5:46121456-46121478 ATGAATACACACATCACAAAAGG + Intergenic
990311714 5:54546342-54546364 ATGAAGACATAAATGGAAAATGG - Intronic
991274500 5:64828539-64828561 CTGCATCCTCAAATGGCAGAGGG + Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
992368549 5:76118457-76118479 CTCAATACAAAAATGGGAAAAGG + Intronic
993121192 5:83776268-83776290 GTGAAGTCAGAAATGGCAAAGGG + Intergenic
993147437 5:84113172-84113194 CTGAATACAAAAATAGAATACGG + Intronic
993574091 5:89580112-89580134 TTGACTACACAGATGGCAATAGG - Intergenic
994488359 5:100408728-100408750 CTAAATCCACACATTGCAAAAGG - Intergenic
994582931 5:101670625-101670647 TTGAATACAGATATGGCAACAGG - Intergenic
994813488 5:104554405-104554427 CAAGACACACAAATGGCAAACGG + Intergenic
995394182 5:111670118-111670140 CTGCATCCTCACATGGCAAAAGG + Intronic
995692294 5:114841019-114841041 CTGAATAAACCAATTACAAATGG + Intergenic
995751316 5:115455991-115456013 CTGAATACACAGAGAGGAAAGGG - Intergenic
995920084 5:117301531-117301553 CTGAAGACCCAAATAGCCAAAGG + Intergenic
996186719 5:120486658-120486680 CAAAAGACAAAAATGGCAAATGG - Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997354539 5:133253878-133253900 CTGAAGACACAAATGCCATGGGG - Intronic
997832895 5:137166812-137166834 ATGAATACACAAAAAACAAAAGG + Intronic
998979210 5:147682240-147682262 GTGAATAGAAAAATGGCAAGAGG + Intronic
999475973 5:151899371-151899393 CTGAATACACAATTTGAAAATGG - Intronic
999501715 5:152153300-152153322 ATAAATACATAAATGACAAATGG + Intergenic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999895444 5:156027934-156027956 CTGTATACTCATATGGCAGAAGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1002556870 5:180048746-180048768 CTGAAGCTACAGATGGCAAAGGG - Intronic
1003478466 6:6507669-6507691 GTGAAAACACAAAAGGAAAAAGG - Intergenic
1003941831 6:11036422-11036444 CTGAACACAGAAAAGGCCAAAGG + Intronic
1003944912 6:11065939-11065961 CTGAGTTCTCACATGGCAAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005788016 6:29266069-29266091 CTGAATAGATAAATCTCAAAGGG + Intergenic
1005862818 6:29914390-29914412 CTGAAGACACAAAGACCAAATGG + Intergenic
1005914904 6:30343395-30343417 CTGAAAAGGGAAATGGCAAAGGG - Exonic
1008747323 6:54688091-54688113 CTGAATACACAACTTGAAAGGGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009483115 6:64185471-64185493 CTGATTACAGAAAAGGCAGATGG - Intronic
1009961339 6:70525841-70525863 CTGAAAAAACAAATTGTAAAGGG - Exonic
1010314105 6:74425111-74425133 CTGAATCCAAAATTAGCAAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1012148945 6:95721245-95721267 CAGAAGCCACAATTGGCAAATGG + Intergenic
1012293245 6:97485243-97485265 GAAAATACACAAATGGCCAAGGG - Intergenic
1012842122 6:104342574-104342596 AAGAAGACACAAATGACAAATGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014117392 6:117681003-117681025 CTAAATACAGACATAGCAAAAGG - Intronic
1014174908 6:118321666-118321688 CTCAACACACAAATGTCAGAGGG + Intergenic
1014179987 6:118374040-118374062 CTGAGTACCCACATTGCAAATGG + Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015349405 6:132199363-132199385 CTGAATAAACCTTTGGCAAATGG + Intergenic
1016459167 6:144263948-144263970 CTGATGTCACAACTGGCAAATGG + Intergenic
1016710881 6:147170708-147170730 CTGAAGACACAAGAGGGAAAAGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018150852 6:160936961-160936983 CTGAATAGACCAATAACAAAAGG - Intergenic
1018177355 6:161188874-161188896 CTCATTTCACCAATGGCAAATGG + Intronic
1020372132 7:7443726-7443748 CTGAATCCACTAATGATAAAAGG - Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020919733 7:14247646-14247668 CTGAATAGACATTTTGCAAAAGG - Intronic
1021598112 7:22338531-22338553 GAGAATACACAAATGACTAAAGG - Intronic
1023372622 7:39527316-39527338 CTGCATCCACTCATGGCAAAAGG + Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025583138 7:62745115-62745137 ATGAATACACACATCACAAATGG - Intergenic
1025586208 7:62791249-62791271 ATGAATACACACATCACAAAGGG - Intergenic
1025593016 7:62887245-62887267 CTGAATGCACACATCACAAAGGG - Intergenic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1028136983 7:87232356-87232378 CTGAATACAGAATAGGCAAGTGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1028938653 7:96494041-96494063 AGGAAGACACAAATTGCAAAAGG + Intronic
1029749882 7:102537282-102537304 TAGAGTACACAAAAGGCAAAAGG - Intergenic
1029767832 7:102636388-102636410 TAGAGTACACAAAAGGCAAAAGG - Intronic
1030845920 7:114411046-114411068 ATGCATACATAAATGGCAATGGG + Intronic
1032028957 7:128465810-128465832 CTTCATATACAAATTGCAAATGG + Intergenic
1032349419 7:131146530-131146552 CAGTATACCCAAGTGGCAAATGG - Intronic
1032395549 7:131586736-131586758 CTGAATGAATAAATGGTAAAAGG - Intergenic
1032621831 7:133542111-133542133 CTGAAAATTCAACTGGCAAAAGG + Intronic
1033031851 7:137834454-137834476 ATGAATTCACAAATGGTGAATGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035854886 8:2964196-2964218 CTGAACACACAAAATGCAAGCGG - Intronic
1036507714 8:9370513-9370535 GGGAATAGACAAATGGCGAAGGG + Intergenic
1038619948 8:29132616-29132638 ATGAATGCTCAGATGGCAAAAGG + Intronic
1038813694 8:30879054-30879076 GAGAATACACTGATGGCAAATGG - Intronic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040347322 8:46518381-46518403 CTGAATCTACAAATCACAAATGG - Intergenic
1040347585 8:46522495-46522517 CTGAATCCACACATCACAAAGGG - Intergenic
1040678449 8:49780649-49780671 CTGTGTACACATATGGCAAAAGG + Intergenic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1042035834 8:64533028-64533050 CGAAACACACAGATGGCAAATGG + Intergenic
1042445882 8:68884682-68884704 CTGCCCACACAAAAGGCAAAGGG - Intergenic
1042568163 8:70133559-70133581 CTGAATACTAAAAGGGAAAATGG + Intronic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043723580 8:83579538-83579560 CATAATACATAAATGCCAAAAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044868759 8:96598117-96598139 CTGCATCCTCACATGGCAAAGGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045586489 8:103543728-103543750 AAGAATACACAATGGGCAAAGGG + Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1047588043 8:126295765-126295787 CTGAAAACACTAATGGCCATGGG + Intergenic
1047757684 8:127931266-127931288 CTGGAAACATAAATGGAAAAGGG - Intergenic
1047932440 8:129743541-129743563 CAGAATACAGAAATGACAGATGG - Intergenic
1047941114 8:129828069-129828091 CTTGATACACAAAGGGCAAGAGG + Intergenic
1048707769 8:137173295-137173317 CTGGAGACACATATGGAAAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048982352 8:139709589-139709611 ATGAATCCAAAAATGGCAAGAGG + Intergenic
1050278784 9:4028732-4028754 CTGCACATACAAGTGGCAAATGG + Intronic
1050494372 9:6225348-6225370 CTGAATAAAGAAATGGCAGCAGG + Intronic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051224943 9:14889418-14889440 GAGAACACACAAATGGCTAAGGG - Intronic
1053244414 9:36522877-36522899 GTGTATACACACATGGAAAATGG + Intergenic
1053306001 9:36985384-36985406 CTGAAAACAGAACTGGAAAAGGG + Intronic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1055231251 9:74068618-74068640 ATGCATACACATATGGCATATGG + Intergenic
1055235539 9:74118248-74118270 CTGAAAAGACAAATGGCACTAGG - Intergenic
1058133739 9:101283835-101283857 CTAAATAGACAAAAGACAAATGG + Intronic
1058209229 9:102146887-102146909 CTTAATACAAGAATGACAAATGG + Intergenic
1058816281 9:108685455-108685477 CTGACTCCAGAAATGGCATAGGG - Intergenic
1059078389 9:111220187-111220209 CTGAATACATTAAGAGCAAAAGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059922443 9:119174095-119174117 CTGAAGACAAAATTGACAAATGG + Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060382778 9:123192307-123192329 ATGAATACAAAAAAAGCAAAAGG + Intronic
1060566807 9:124599904-124599926 TTGAATAAACATATGGGAAATGG - Intronic
1186071061 X:5821215-5821237 CTGGAAACACAAATGGCACACGG + Intergenic
1186429179 X:9489767-9489789 CTGAAAAGTCACATGGCAAAGGG + Intronic
1186709466 X:12178146-12178168 CTGTATCCTCAAATGGCAGAAGG - Intronic
1187241721 X:17520089-17520111 ATAAATTCACAAATGTCAAATGG - Intronic
1187802784 X:23082660-23082682 CTGCATGCTCACATGGCAAAAGG + Intergenic
1188191850 X:27181220-27181242 CTGAAAAATCAAATTGCAAAAGG - Intergenic
1190975301 X:55394134-55394156 CATAAAACAAAAATGGCAAAAGG - Intergenic
1191263406 X:58354931-58354953 CTGAATGCACACATCACAAACGG - Intergenic
1191672856 X:63765119-63765141 CTTAATACACAAATGACTCATGG - Intronic
1193750553 X:85337780-85337802 CTTAACTCACAAATGGGAAATGG - Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194019340 X:88667750-88667772 CTGAATACACAATTGTCATTTGG - Intergenic
1194362800 X:92975580-92975602 CTGAATTCACAAAAGGTAAGTGG - Intergenic
1194574240 X:95592396-95592418 CTGAAAAATCAACTGGCAAAAGG + Intergenic
1194681074 X:96853563-96853585 TTGAATACATTAATGGAAAATGG - Intronic
1195092766 X:101478341-101478363 AGCAATACACAAATGGAAAATGG + Intronic
1195581946 X:106514865-106514887 GGGAAGACACAAATTGCAAAGGG + Intergenic
1197303551 X:124811334-124811356 CTGATTAAAAAATTGGCAAAAGG + Intronic
1197953472 X:131922242-131922264 CTGAATAGACAATTCTCAAAAGG + Intergenic
1198285844 X:135191034-135191056 CTGAATAGACATATTTCAAAAGG + Intergenic
1198585249 X:138113537-138113559 ATGAATACACAAATGAAAGAAGG + Intergenic
1198597180 X:138249409-138249431 ATGAGTACAGAGATGGCAAATGG - Intergenic
1200342394 X:155411141-155411163 CTGATTAAACAATGGGCAAAGGG + Intergenic
1200671048 Y:6091809-6091831 CTGAATACACAAAAGGTAAGTGG - Intergenic
1200873157 Y:8124891-8124913 CTAAATCAACAGATGGCAAAGGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201339847 Y:12922859-12922881 CAGAATACACAGACGGCAACAGG - Intergenic
1201746889 Y:17385952-17385974 CTGAATCCTCAAATGGTAGAAGG - Intergenic