ID: 1140592534

View in Genome Browser
Species Human (GRCh38)
Location 16:76370781-76370803
Sequence ATGCAATTTCAAAACTGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 649
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 597}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140592534_1140592540 27 Left 1140592534 16:76370781-76370803 CCCTTTCAGTTTTGAAATTGCAT 0: 1
1: 0
2: 5
3: 46
4: 597
Right 1140592540 16:76370831-76370853 AGATCAATATTTTGATACTGAGG 0: 1
1: 0
2: 1
3: 11
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140592534 Original CRISPR ATGCAATTTCAAAACTGAAA GGG (reversed) Intronic
901542263 1:9926381-9926403 ATGCAACTCCACCACTGAAATGG - Intronic
901954323 1:12772989-12773011 ATTGAATTCAAAAACTGAAAAGG - Intergenic
902730019 1:18363166-18363188 ATAAAATGTCAAAATTGAAAGGG - Intronic
903098178 1:21000864-21000886 ATTCAATTATAAAATTGAAAGGG + Intronic
903975398 1:27146473-27146495 ATTGAATTTCTAAACTGAAAAGG + Intronic
905851082 1:41275425-41275447 ACCCCATTTCAAAACTGCAATGG - Intergenic
905980255 1:42219164-42219186 ATGCAATTTAAAACATGAATTGG - Intronic
906764044 1:48410093-48410115 ATTCAATTTCAAAAGGGAAATGG - Intronic
907126253 1:52053758-52053780 ATGCAGTTTCATCACTGAGATGG + Intronic
907674321 1:56504530-56504552 ATCCAATTTTGAAGCTGAAAGGG + Intronic
907726823 1:57027788-57027810 ATTCAATCTGAAAGCTGAAAGGG - Intronic
908481901 1:64548829-64548851 GTGTAATTTCAAAATTCAAAAGG - Intronic
908531857 1:65041318-65041340 TTTCATTTTCAAAGCTGAAAGGG + Intergenic
909967898 1:81940738-81940760 ATGCATTTTAACAACAGAAAAGG + Intronic
910009729 1:82446540-82446562 CTGGAAAGTCAAAACTGAAAAGG - Intergenic
910272168 1:85408562-85408584 TAGCAATTTTAAAAATGAAATGG - Intronic
910956128 1:92707337-92707359 ATACTATTTTAAAAATGAAAAGG + Intronic
911023208 1:93409025-93409047 ATGCAAGTTCAAAACCCAACAGG - Intergenic
913267946 1:117063295-117063317 ATGCATTCTCAAAACTCAACTGG - Intronic
913355377 1:117915517-117915539 ATGTAATTTCAGAAATTAAAAGG + Intronic
913586819 1:120283138-120283160 ATGAAATTGAAAAACTGACAAGG + Intergenic
913621367 1:120615232-120615254 ATGAAATTGAAAAACTGACAAGG - Intergenic
913656026 1:120960658-120960680 CTCAAATTTCAAGACTGAAAGGG - Intergenic
914520583 1:148411890-148411912 CTCAAATTTCAAGACTGAAAGGG - Intergenic
914568834 1:148895023-148895045 ATGAAATTGAAAAACTGACAAGG + Intronic
914603994 1:149235233-149235255 ATGAAATTGAAAAACTGACAAGG - Intergenic
915381783 1:155448286-155448308 AAGCTATTTCTAAGCTGAAAGGG - Intronic
915403379 1:155640678-155640700 CTTCAATTTCATAGCTGAAAGGG - Intergenic
915906261 1:159879814-159879836 ATGGAATTTCAAAACTAGCAGGG + Intronic
917067685 1:171114456-171114478 ATAAATTTTCAAAACTGAAGGGG - Intronic
917533035 1:175854167-175854189 ATGCACTTTGTAAACTCAAAAGG + Intergenic
917988048 1:180341374-180341396 ATACAATTTTAAAACAAAAATGG - Intronic
918438031 1:184536648-184536670 ATTTATTTTTAAAACTGAAAAGG - Intronic
918672012 1:187229236-187229258 ATTCACTTTCAAAACATAAATGG + Intergenic
918725941 1:187924083-187924105 ATGCAAGTCTAAAAATGAAAAGG - Intergenic
918759392 1:188382605-188382627 ATTCAATTTCAGAATTGTAATGG - Intergenic
918790406 1:188818769-188818791 ATGAAACTTCAAAATTGATAAGG + Intergenic
919075882 1:192812088-192812110 ATGTAATGCTAAAACTGAAATGG + Exonic
919434730 1:197543809-197543831 ATGGAATTTTTAAACAGAAAGGG + Intronic
920402914 1:205687978-205688000 ATTGGATTTCAGAACTGAAAAGG - Intergenic
922700408 1:227756363-227756385 TAGGAATCTCAAAACTGAAAGGG - Intronic
922947267 1:229527461-229527483 ATGAAATTTCAGAGCTAAAAGGG + Intronic
923535555 1:234848572-234848594 TTGTAATATCAAAACTAAAATGG + Intergenic
923764399 1:236879765-236879787 AGGCAATTTTAAGAATGAAAGGG + Intronic
923807240 1:237270884-237270906 ATATAATTTGAAAACTGATAAGG + Intronic
923890260 1:238207298-238207320 ATGAATTTTCAGAACTAAAATGG - Intergenic
1063083840 10:2795424-2795446 ATACAAATTAAAAAATGAAAAGG + Intergenic
1063953047 10:11242220-11242242 ATGCCATTTTTAACCTGAAATGG - Intronic
1064148819 10:12846259-12846281 ATGCAAATTGGAAACTGACAAGG + Intergenic
1064798837 10:19045366-19045388 TTGCAGTTTCAAAACCTAAAGGG + Intergenic
1065543060 10:26789521-26789543 GCGTAATTTCAAAACTGAAAAGG - Intronic
1065976229 10:30845264-30845286 ATGCATGTCCAAGACTGAAAAGG - Exonic
1066324473 10:34343357-34343379 AAGCAATATGAACACTGAAAGGG + Intronic
1067252982 10:44604185-44604207 AAGCAGTTTCAAAAAGGAAAAGG - Intergenic
1067329573 10:45302641-45302663 ATGCTATTACAAAACTGCACTGG - Exonic
1067529882 10:47062547-47062569 ATGTAGTTTTAAAACTTAAATGG + Intergenic
1067907936 10:50313514-50313536 ATGCAATTTGAAAACTAAAATGG - Intronic
1068020102 10:51570855-51570877 ATTCAATTTCAAAACTATATTGG - Intronic
1068363890 10:56018456-56018478 ATACAATTTTAAATCTGGAAGGG - Intergenic
1068607386 10:59020967-59020989 ATGCAAGTTTAACACTGGAATGG - Intergenic
1068744211 10:60511357-60511379 ATGCGACTACAAAACTGAAAAGG + Intronic
1068787784 10:60995756-60995778 ATGCAATTTCAACTTGGAAAAGG + Intronic
1068998240 10:63233158-63233180 ATGGAATCTCAAGGCTGAAAAGG + Intronic
1068998695 10:63239106-63239128 TTGGAACTTCAAAACTGCAAGGG + Intronic
1069047662 10:63760261-63760283 TGGAAATTTCAAAACTGGAATGG - Intergenic
1069292755 10:66803112-66803134 TTTCAATTTCAAAAATGCAAAGG + Intronic
1069309202 10:67012226-67012248 ACGGAATTTCAGAGCTGAAAGGG + Intronic
1069950306 10:72014144-72014166 ATTCAATTTCTTAGCTGAAAGGG - Intergenic
1070360623 10:75685024-75685046 ATCCAATCTGAAAACTGAAAAGG - Intronic
1071739265 10:88338436-88338458 ATGCAATTCACATACTGAAACGG + Intronic
1072095122 10:92170792-92170814 AAGCAATTTCAGACCTGAATTGG - Intronic
1072274370 10:93808191-93808213 CAGAAATTTCAGAACTGAAAGGG - Intergenic
1072875584 10:99169558-99169580 ATGCAATTTTACAAGTTAAATGG - Intronic
1073191846 10:101656937-101656959 ATGCAAATTGAAAACATAAATGG - Intronic
1073404846 10:103288201-103288223 ATTTAATTTCAAAGCTCAAAGGG - Intronic
1073831414 10:107387896-107387918 GTGCAATTTCAAAATACAAAAGG - Intergenic
1074196137 10:111187140-111187162 ATGAAATTTCAAAACTAGAAGGG + Intergenic
1074381383 10:112983514-112983536 CTGCCATTTGAGAACTGAAAAGG - Intronic
1074530435 10:114294383-114294405 ATGAAATAGCAGAACTGAAATGG - Intergenic
1075011525 10:118874467-118874489 ATGGAATGACAAAACTGGAAGGG - Intergenic
1075159967 10:120014901-120014923 AAGCAAGTTCAAAGCTGAATGGG - Intergenic
1075169337 10:120098541-120098563 ATGTAATTGTAAACCTGAAAGGG - Intergenic
1075378933 10:122002736-122002758 ATGCAAATAAAAAAATGAAATGG - Intronic
1075795993 10:125120010-125120032 ATGCAAGTTCGATACAGAAAAGG + Intronic
1076398768 10:130162919-130162941 ATACAATATCTACACTGAAAAGG - Intronic
1076417922 10:130305083-130305105 CTGCAATTTCAAAAATGAGTCGG + Intergenic
1078225296 11:9385693-9385715 ATGCAATATCTGAACTGATAAGG - Intronic
1078703148 11:13709645-13709667 ATGAGATTTGAAAAATGAAAGGG - Intronic
1080110950 11:28567121-28567143 ATGCAATTTCCAAAGTGCAGAGG - Intergenic
1080627188 11:34041134-34041156 CTAAAATTTAAAAACTGAAATGG - Intergenic
1080776330 11:35390381-35390403 ATCAAATTTTAAAAATGAAATGG - Intronic
1081129839 11:39365289-39365311 ACAAAATTTCAAAACTAAAATGG + Intergenic
1082634016 11:55574889-55574911 AAGCATTTTCAAATATGAAATGG - Intergenic
1082663324 11:55942567-55942589 ATGCTATTTTAAAACAGAATTGG + Intergenic
1085105908 11:73842817-73842839 ATCCTGTTTCAAAACAGAAAAGG - Intronic
1085733649 11:79020377-79020399 ATTCTATTTCAATAATGAAAAGG + Intronic
1086283228 11:85215246-85215268 ATGCCATTAAAAAACTGAACTGG - Intronic
1087258666 11:95985683-95985705 ATGTATTTTCACAAGTGAAAAGG - Intronic
1087303201 11:96459206-96459228 ATGGAATTAGAAAACTGAAGAGG - Intronic
1087908204 11:103724108-103724130 ATGCAAGTTCAAAATTCAATAGG + Intergenic
1088075545 11:105844092-105844114 AGACAATTTCAAGAGTGAAAGGG - Intronic
1088329629 11:108637455-108637477 AGGCAAGTTCAAAACTGCACTGG + Intergenic
1090159397 11:124476404-124476426 ATTAAATTTCAAAACAAAAAAGG + Intergenic
1090400954 11:126447871-126447893 AAGCAAGTTTAAAACTGTAAGGG + Intronic
1090455678 11:126847178-126847200 AAGCATTGTCAAAAATGAAATGG + Intronic
1090507209 11:127329392-127329414 ATGCAATGTCATAATTGCAATGG + Intergenic
1090650777 11:128804049-128804071 CTGTAATTTTAAAACTGAACGGG + Intronic
1091082478 11:132683891-132683913 ATAGAATATTAAAACTGAAAGGG - Intronic
1091159497 11:133406998-133407020 GTACTATTTCAAAACTGAATAGG - Intronic
1091472780 12:744308-744330 ATGATATTACAAAAATGAAAGGG - Intergenic
1091951344 12:4595747-4595769 ATAAAATGTCCAAACTGAAAGGG + Intronic
1093276095 12:17129464-17129486 ATGCACTTTCAAAAATGAAAAGG - Intergenic
1093425209 12:19021003-19021025 ATCCAATATCAAAACTGCATAGG + Intergenic
1093984277 12:25511581-25511603 AAGCAATGTGAAAAATGAAATGG - Intronic
1094488850 12:30946081-30946103 CTGAACTTTCAGAACTGAAAGGG + Intronic
1094772524 12:33681375-33681397 ATGGTAATTCAAAACTGAATTGG + Intergenic
1095377735 12:41550886-41550908 ATTCAAATACAAAATTGAAAAGG + Intronic
1095836879 12:46648661-46648683 ATGGAACTTTAAACCTGAAAGGG - Intergenic
1095882977 12:47158369-47158391 ATGCAAATCGAAAACTGGAAAGG - Intronic
1096420199 12:51450607-51450629 ATGTGATTTCCAAACTGTAAAGG - Intronic
1097205713 12:57319043-57319065 ATGGAATCTCATAACTGTAAGGG + Intronic
1097415737 12:59314085-59314107 ATGCATTTTCAAAATTTTAATGG + Intergenic
1097513161 12:60568421-60568443 ATGCAAATCCAAAACCTAAAAGG - Intergenic
1097888330 12:64752437-64752459 ATCCATTTTCAAACCTCAAATGG + Intronic
1098283753 12:68887166-68887188 AGACAATTTTAAAATTGAAAGGG - Intronic
1098836449 12:75429317-75429339 ATGCAAGTTCAAAACCCAACAGG - Intronic
1099018510 12:77374412-77374434 ATGCTCTTTCAAAACTCACATGG + Intergenic
1099110202 12:78549993-78550015 ATGCAATCTTAAAGCTGAAATGG - Intergenic
1099509747 12:83519043-83519065 ATACCAGTTCTAAACTGAAAGGG + Intergenic
1100040848 12:90314962-90314984 AAGGAATTTAAAAGCTGAAATGG - Intergenic
1100080453 12:90842721-90842743 TTGCATTTACACAACTGAAAGGG + Intergenic
1101281111 12:103256670-103256692 GTGAAATCTCAAAACTGAAATGG + Intronic
1101688863 12:107055706-107055728 AAGCAATATCAAAAATGAAAAGG + Intronic
1101988793 12:109467878-109467900 ATGCCATATCAAAAAAGAAACGG - Intronic
1104064078 12:125292270-125292292 CTGCAATTTTAAAAATAAAATGG - Intronic
1105379230 13:19871557-19871579 ATGCAGTTTCTAAACTGAGCTGG - Intergenic
1106150764 13:27099471-27099493 ATGAACTTTAAAAATTGAAAGGG - Intronic
1106741797 13:32652283-32652305 ATGGATTTTCAAAAGTGAAAAGG - Intronic
1106928693 13:34640437-34640459 AAGCATTTTCAAAACTCCAAAGG + Intergenic
1107186995 13:37535036-37535058 ATACATTTTCAAAACTGATTTGG - Intergenic
1107249059 13:38335449-38335471 AAGCATTTTAAAAACTGCAAAGG + Intergenic
1107353757 13:39543814-39543836 ATGCAATTTTATAACTGAACAGG - Intronic
1108134121 13:47337088-47337110 ATGGCATTTCAATATTGAAAGGG + Intergenic
1108725729 13:53178895-53178917 AAACAACTTCAAAAGTGAAAAGG + Intergenic
1109047211 13:57428324-57428346 AAGCAATTTTAAAATTGATATGG + Intergenic
1109391207 13:61696024-61696046 ATTGAATTTCAAAATTGCAATGG - Intergenic
1109436047 13:62304199-62304221 ATGAGATTTCTAAACTGTAAAGG - Intergenic
1109565207 13:64105006-64105028 ATTCAATTTTAAATCTTAAATGG + Intergenic
1109743080 13:66581973-66581995 ATTTAAGTTCTAAACTGAAAAGG - Intronic
1109862306 13:68216270-68216292 CTGCAATTGGAAAACAGAAATGG + Intergenic
1109952653 13:69519605-69519627 CTGCAATCACAAATCTGAAATGG - Intergenic
1109953993 13:69541469-69541491 AAGCAATTACAAAATTTAAAGGG + Intergenic
1111185084 13:84724248-84724270 ATGCAATTTCTATACAGAACAGG - Intergenic
1112550702 13:100417917-100417939 ATGTGATTTCAAAAAAGAAAGGG - Intronic
1112665294 13:101564808-101564830 CTGCAATTTCAATACAAAAATGG + Intronic
1112951496 13:105002852-105002874 ATGCAACACCAAAAATGAAAAGG - Intergenic
1113345620 13:109475200-109475222 ATACAATTCCAAGAGTGAAAGGG - Intergenic
1113501612 13:110780311-110780333 ATTCAACATCAAAAATGAAAAGG - Intergenic
1114743608 14:25123108-25123130 ATGCAAATTCAAAACTATAAAGG - Intergenic
1115092980 14:29601105-29601127 ATGAAATTTAAAACCTCAAATGG + Intronic
1115191370 14:30750712-30750734 GTTCAATTTAAAAAGTGAAAAGG + Intergenic
1115306786 14:31941895-31941917 ATGGAATTTCAATACTTGAAGGG - Intergenic
1116434237 14:44878449-44878471 ATGCAATTGACATACTGAAAAGG + Intergenic
1116701504 14:48249739-48249761 ATGCAAGTTAAAAAGTGACAAGG - Intergenic
1116748445 14:48850873-48850895 CTGGAATTTCAGAACAGAAAAGG - Intergenic
1117166767 14:53042347-53042369 ATGGAATTTTAAAGCTGGAAGGG - Intronic
1118622443 14:67625951-67625973 ATGCAAATTTAAAACTACAATGG + Intronic
1118671302 14:68130717-68130739 ATAAAATTTCAAAGGTGAAATGG + Intronic
1120080793 14:80213858-80213880 ATGCAAATTCAAAACTCATTAGG - Intronic
1120111466 14:80562511-80562533 ATGCATTTTGAAAACTTAAGTGG + Intronic
1123175477 14:106413344-106413366 AAGCAATGTCAAATTTGAAATGG - Intergenic
1124195048 15:27617994-27618016 ATGCAAAGTCCAAACTAAAAGGG - Intergenic
1125177587 15:36842412-36842434 CTGCAATTCCAAACCTGAAATGG - Intergenic
1126189457 15:45864652-45864674 ATGAAAGTGCAAAAATGAAAGGG - Intergenic
1126284273 15:46993605-46993627 ATGCAATTAAAAAACAAAAAGGG - Intergenic
1126662871 15:51049334-51049356 ACTCAGTTTCAAAGCTGAAAAGG + Intergenic
1126947436 15:53837757-53837779 ATGCCATGTAAAAAGTGAAATGG - Intergenic
1127164398 15:56229779-56229801 ATACAATTTTAAAGCTGAAAGGG + Intronic
1128412892 15:67416748-67416770 TTGAAATATGAAAACTGAAATGG + Intronic
1128508328 15:68296122-68296144 TTGCATTTTAAAAACTGAAAAGG - Intergenic
1128540179 15:68522682-68522704 AGCAAATTCCAAAACTGAAAAGG - Intergenic
1128844687 15:70880848-70880870 AGGCTATTTCAAAGCTCAAAGGG + Intronic
1128852718 15:70976438-70976460 ATGAAATTTTAAAAATCAAATGG - Intronic
1129083657 15:73065992-73066014 AAGAAATTACAGAACTGAAAAGG - Intronic
1129544136 15:76376493-76376515 ATGCAATGTTTAACCTGAAAAGG + Intronic
1129791723 15:78345226-78345248 ATGTAATTTCAAGGCTGAGAGGG - Intronic
1130404139 15:83583109-83583131 ATTCTCTTTCACAACTGAAAAGG - Intronic
1130430207 15:83840239-83840261 AAGTAATTTCAAAAATGAGATGG + Intronic
1131845691 15:96488388-96488410 ATGCAATGTCAAAAGTGGAGTGG + Intergenic
1132758563 16:1497697-1497719 ATGCTATTTCATAAGAGAAAGGG - Intronic
1133183531 16:4077622-4077644 ATGAGATATAAAAACTGAAAAGG + Intronic
1134355878 16:13481834-13481856 ATTGAATTTCAAAATTGAAGTGG + Intergenic
1135511113 16:23084092-23084114 ATGCAATTTCAGGATTGAAGGGG - Intronic
1136908148 16:34121245-34121267 ATGGAATTGCAAAACTAGAATGG + Intergenic
1136986818 16:35113934-35113956 AAGCAAATTAAAAACTGTAAAGG + Intergenic
1139360406 16:66395787-66395809 ATGCACTTTCAGAGCTGAACAGG - Intronic
1140016050 16:71186575-71186597 ATGCAATTTCAAAACTTCTCAGG + Intronic
1140028519 16:71313995-71314017 CTGCAATATCACAACTAAAAAGG - Intergenic
1140171188 16:72606644-72606666 TTCCAATTTCAAAACTTACAAGG + Intergenic
1140592534 16:76370781-76370803 ATGCAATTTCAAAACTGAAAGGG - Intronic
1141191697 16:81829799-81829821 CTGCAATTTCAAAGGAGAAAGGG - Intronic
1141215682 16:82021089-82021111 CTGCAATTCCAAAAATGTAATGG - Intergenic
1141310262 16:82907135-82907157 ATAGAATTTCAGAACAGAAATGG + Intronic
1141522117 16:84587589-84587611 ATGTAATTTCATAAATGATATGG - Intronic
1142058069 16:88013024-88013046 ATGCCTTTTCTACACTGAAATGG - Intronic
1144350642 17:14392359-14392381 CTGCAATTACAAAACTGCTAAGG + Intergenic
1145289661 17:21533253-21533275 TTGCAACTTCAGAAGTGAAAAGG + Exonic
1147955617 17:44132503-44132525 ATGAAGTGTCAGAACTGAAAGGG - Intergenic
1148951999 17:51321397-51321419 ATTCTATTGCCAAACTGAAATGG - Intergenic
1149050072 17:52293784-52293806 ATGGAATTTCCAGAATGAAAGGG + Intergenic
1151353831 17:73546744-73546766 TTGCCATGTCAGAACTGAAAGGG - Intronic
1152668209 17:81584429-81584451 AGCCAATTTCCAATCTGAAAAGG + Intronic
1152979749 18:265844-265866 ATGAAGCTTCAAAACTAAAACGG - Intronic
1153000375 18:449988-450010 ATGAAATTATATAACTGAAAAGG - Intronic
1154291687 18:13113740-13113762 ATGTATTTTAAAAACAGAAAGGG + Intronic
1156005530 18:32436731-32436753 ACGCAGTTTCAAACCTAAAATGG + Intronic
1156082048 18:33347876-33347898 ATGAAACTGCAAAACTGAGATGG - Intronic
1156744920 18:40378367-40378389 CTTCAATATCACAACTGAAAGGG + Intergenic
1156805051 18:41168235-41168257 ATGCTATCTCAAAATGGAAAGGG - Intergenic
1156911852 18:42420318-42420340 GTCCAAATTCAAAACTCAAAAGG + Intergenic
1157039876 18:44025690-44025712 AGGAAATATCAAAACTGAAAAGG + Intergenic
1157803443 18:50639611-50639633 ATACAATTTTAAAACATAAAAGG + Intronic
1158672018 18:59484695-59484717 ATGCAATTAAAAAACGCAAAGGG - Intronic
1158761525 18:60394292-60394314 ATGAATTTTTAAAAATGAAAAGG + Intergenic
1158979495 18:62745683-62745705 TTATAATTTCAATACTGAAATGG - Intronic
1159695700 18:71553697-71553719 ATGCAAGTTCAAAACCCAATGGG - Intergenic
1160321044 18:77896126-77896148 ATGCATTTTAAATACTGAAATGG - Intergenic
1160456099 18:79001813-79001835 ATGGAATTTTACAACTGAAAAGG - Intronic
1161515983 19:4696870-4696892 ATGCAATTAGAAAAGTGAACAGG + Intronic
1164533349 19:29064702-29064724 ATTCAAGTTCAGGACTGAAATGG + Intergenic
1164882956 19:31751291-31751313 ATATAATTTTAAAAATGAAAAGG + Intergenic
1165132289 19:33640630-33640652 ATGTTATTACAAAATTGAAATGG + Intronic
1165187557 19:34035118-34035140 ATGGCATTTCTAAACTGACATGG + Intergenic
1165260660 19:34614405-34614427 ATGAAATTTAAAAAATAAAATGG - Intronic
1165297393 19:34938574-34938596 TTGCAATTGCACAACTTAAATGG - Intronic
1166197359 19:41215899-41215921 ATGCATTTTAAAAAATGAGACGG - Intergenic
925131669 2:1498143-1498165 TTGGACTTTCAAAATTGAAATGG - Intronic
925179326 2:1806764-1806786 AGGCCAGTTCAAAACAGAAAAGG - Intronic
925469651 2:4145379-4145401 ATGCAAATTTAAAAATTAAAAGG - Intergenic
925775134 2:7328013-7328035 TAGCAATTTCAATACTGAGAAGG - Intergenic
927055540 2:19362486-19362508 TTACAGTATCAAAACTGAAAGGG + Intergenic
927340277 2:21975765-21975787 ATGCATTTTCAAGATTGACAGGG + Intergenic
928375703 2:30771412-30771434 ATGCAATTTCAGAGCAGAGATGG + Intronic
928581341 2:32710737-32710759 ATGCAGGTTTAGAACTGAAAAGG - Intronic
928982257 2:37148145-37148167 AAACAATTTCAAAATTGAGATGG - Intronic
930524043 2:52503969-52503991 AGGCAATTACAAAAATAAAATGG + Intergenic
931937889 2:67218588-67218610 ATGTAAATTAACAACTGAAAAGG + Intergenic
932229290 2:70069272-70069294 GTTTCATTTCAAAACTGAAAGGG + Intergenic
932658508 2:73631238-73631260 ATTTACTTTCAAAGCTGAAAGGG + Intergenic
932665122 2:73691245-73691267 ATTTACTTTCAAAGCTGAAAGGG + Intergenic
933278759 2:80309455-80309477 ATAGTATTTTAAAACTGAAAGGG + Intronic
933380763 2:81541040-81541062 TTGCTATATCAAAACTGAAAAGG + Intergenic
933414000 2:81961601-81961623 CTGCAATATTAAAACTAAAATGG - Intergenic
933588413 2:84204816-84204838 ATGTAATTTCAAAACTAAACAGG + Intergenic
935439117 2:103071043-103071065 ATGAAATTTCAAAATTAAAAAGG + Intergenic
937006243 2:118519167-118519189 ATGCCATTTAAAAAGTGAAAGGG + Intergenic
937639057 2:124191339-124191361 GTGGAAGTTCAAAACTAAAAGGG - Intronic
937859928 2:126699654-126699676 ATGTAATTTCAACACTTACATGG - Intergenic
940359909 2:152786363-152786385 ATGCAAGTCCAAAATTGAACAGG + Intergenic
940375342 2:152951868-152951890 TTTCAATTTCCAAACTGAGATGG + Intergenic
940748198 2:157594959-157594981 GTGCAATTTAAAAACTTAACAGG + Intronic
941157171 2:161993509-161993531 AGGCAGTTTATAAACTGAAACGG + Intronic
941698680 2:168580329-168580351 CTATAATTTCAAAACTAAAAGGG - Intronic
942124936 2:172814454-172814476 ATGCAGTTTCAGAAAAGAAAGGG + Intronic
942565580 2:177263278-177263300 AGGCAAATTCTCAACTGAAAAGG + Intronic
942871929 2:180745199-180745221 AGACATTTTCAAAAGTGAAAAGG - Intergenic
943249908 2:185505746-185505768 TTACAATTTCAAAACTACAAGGG + Intergenic
944296797 2:198074405-198074427 AAGCATATTTAAAACTGAAAAGG - Intronic
944582307 2:201142399-201142421 ATGCAATTTCAGAGCTAAAATGG + Intronic
945157274 2:206852814-206852836 ATACAAGTTCATAACTGAGATGG + Intergenic
945328313 2:208509517-208509539 AGGAAACTTTAAAACTGAAAAGG - Intronic
945740594 2:213655848-213655870 TTCCAATTTCATAAGTGAAAAGG + Intronic
946116561 2:217467766-217467788 AGGCAATTTCAAAAGTGGAGAGG - Intronic
946543914 2:220715899-220715921 ATGCAATTCCAAAACCCAACAGG + Intergenic
947900285 2:233716113-233716135 ATGGAATTCCAAAACTAAGATGG - Intronic
948261704 2:236608924-236608946 ATGGAATTTCAAAACTGTGGTGG + Intergenic
948303293 2:236925377-236925399 CTGTAATTTAAAAACTTAAATGG - Intergenic
948326275 2:237124325-237124347 ATGCACTTTGAAGACAGAAAAGG + Intergenic
948361872 2:237427631-237427653 TAACAATTTCAAAACAGAAATGG + Intergenic
1169310317 20:4532695-4532717 ATGAAATTTGGAAACAGAAAAGG + Intergenic
1169642031 20:7763296-7763318 ATGCAATTTTGAAATTAAAATGG - Intergenic
1169642112 20:7764365-7764387 ATGCAATTTTGAAATTAAAATGG - Intergenic
1169866528 20:10206242-10206264 ATACAATTTTACAAATGAAAAGG - Intergenic
1170357213 20:15505776-15505798 CTGCATTTTCAAAACCCAAATGG + Intronic
1170810816 20:19672821-19672843 ATGGAATTTGAAAAGAGAAAAGG + Intronic
1170924587 20:20711995-20712017 ATAAAATTTTAAAAATGAAAGGG + Intronic
1171473289 20:25389629-25389651 AGCCACTTTCAAAACTGAGATGG - Intronic
1171814855 20:29776913-29776935 ATGGAATTGCAAAACTAGAATGG - Intergenic
1171903580 20:30879808-30879830 ATGGAATTGCAAAACTAGAATGG + Intergenic
1172323526 20:34016707-34016729 ATGAAATTTTAGAACTGAAAGGG - Intronic
1173675545 20:44832026-44832048 ATGCATTTTTAAAATTAAAATGG - Intergenic
1174316389 20:49705708-49705730 ATGAAACTTCAGATCTGAAAGGG + Intronic
1174866447 20:54141056-54141078 AAACAATTTCAACACTGGAATGG + Intergenic
1175718673 20:61272487-61272509 ATATTATTTCAAAACTGATAAGG - Intronic
1176900429 21:14435090-14435112 AGGCAATTTTCAAACTTAAAAGG - Intergenic
1177016225 21:15791276-15791298 ATGAAATTTCAAACATAAAATGG - Intronic
1177053839 21:16274549-16274571 ATGCATATTCAAAAAAGAAAAGG + Intergenic
1177402377 21:20623000-20623022 ATGCAAGTCCAAAACTCAAAAGG + Intergenic
1177422601 21:20879985-20880007 ATGAAATTTATAATCTGAAAGGG - Intergenic
1177732088 21:25040631-25040653 ATGAAAATTAAAAACTCAAAGGG + Intergenic
1177752811 21:25307140-25307162 TTGCATCTTCAAAACTCAAAAGG + Intergenic
1177835664 21:26184141-26184163 ATGCAATTTCAAAACCCAGCAGG + Intergenic
1177918363 21:27119955-27119977 TTTCAAAATCAAAACTGAAAAGG + Intergenic
1179154668 21:38839342-38839364 AAGCAATTTTAAGAGTGAAAGGG - Intergenic
1179212578 21:39337815-39337837 CTACAAATACAAAACTGAAAAGG - Intergenic
1180089372 21:45525945-45525967 ATGCAATCTGAAAGCTGAACGGG + Exonic
1180242160 21:46516847-46516869 ATGAAAATTCTAAACTGAAAAGG - Intronic
1180336978 22:11585768-11585790 ATGGAATTGCAAAACTAGAATGG + Intergenic
1185407668 22:50664033-50664055 AGGCTATTACAAAAATGAAACGG + Intergenic
949246348 3:1929333-1929355 ACCCACTTTCAAAAATGAAATGG + Intergenic
949326882 3:2876016-2876038 CTGCATTTTCAATATTGAAAAGG + Intronic
949477249 3:4459911-4459933 ATGCAATTTTCCAACTGAAAAGG + Intronic
949760075 3:7460519-7460541 ATGCCATTTACAAACTCAAATGG - Intronic
949803649 3:7931187-7931209 ATGCAAATACCAAACTGAAAGGG - Intergenic
951378126 3:21948678-21948700 ATGCAATTGGAAAACAGAGAAGG - Intronic
952775524 3:37042344-37042366 TTGAAATTTCAGAAGTGAAAAGG - Intronic
953100279 3:39818992-39819014 ATGCAATATTCAAAATGAAAAGG - Intronic
953519868 3:43631655-43631677 ATGGAATTTCCAAGCTGAAGGGG - Intronic
953524116 3:43673347-43673369 ATGCATTTTCAAAACGGGATGGG + Intronic
953725720 3:45396428-45396450 ATGCATTTTACAAACTGAAGTGG + Intronic
955560887 3:60189331-60189353 ATGCAATTTATTCACTGAAAAGG - Intronic
955713805 3:61807767-61807789 ATACAATTTGACATCTGAAAGGG - Intronic
956525240 3:70152343-70152365 ATGAAAATTCAAAAATGCAAGGG - Intergenic
957215969 3:77319802-77319824 GTGCATTTTCAAATATGAAAGGG - Intronic
957370611 3:79289912-79289934 ATGCAGTTTCAATAGTTAAATGG + Intronic
957680701 3:83429914-83429936 AGCCAATTTGAAAACTGACATGG - Intergenic
957735308 3:84195090-84195112 AGAAACTTTCAAAACTGAAAAGG + Intergenic
957888414 3:86322356-86322378 ATGGAATTTTAAAACTGAAAAGG - Intergenic
958680124 3:97319295-97319317 ATGCCATGTCAATGCTGAAAAGG - Intronic
958902974 3:99909808-99909830 ATGCAATTTCAGAATTCAATAGG - Intronic
959188336 3:103076377-103076399 ATATAATTTAAAAGCTGAAAGGG - Intergenic
959366345 3:105463194-105463216 CTGAAATTTCAATACTGGAATGG - Intronic
959498403 3:107077213-107077235 ATGCAGTTTCAATATTTAAAAGG - Intergenic
960360838 3:116709199-116709221 ATGGATTTTGAAAACAGAAATGG + Intronic
960514854 3:118592327-118592349 ATGCATTGTCAAATATGAAATGG + Intergenic
961933640 3:130560325-130560347 CTTCAACTTCAAATCTGAAAAGG - Exonic
962510929 3:136099989-136100011 ATTCAGTTTCCAAACTGAATAGG + Intronic
962994401 3:140611247-140611269 ATGCAATTCCAAAGCAAAAATGG + Intergenic
963353136 3:144176769-144176791 ATGCAATTGTAACAATGAAATGG - Intergenic
963996512 3:151716494-151716516 ATGCAAGTTCAAAACCCAATGGG + Intergenic
964644623 3:158945688-158945710 GTGTAATTTCAAAGCTAAAATGG + Intergenic
964685363 3:159389842-159389864 AAGCTATTTTATAACTGAAATGG + Intronic
964804792 3:160597052-160597074 ATTCAAATTCAAAAATGAAGTGG + Intergenic
964918344 3:161863895-161863917 CTGCCATTCCAGAACTGAAAAGG + Intergenic
965243579 3:166234904-166234926 ATGGATATTCAAGACTGAAAAGG + Intergenic
965417155 3:168410697-168410719 TTCTAATTTCAAAACTGTAAAGG + Intergenic
965464396 3:169009710-169009732 ATGCAAATACAAAAATCAAAAGG + Intergenic
965734535 3:171806998-171807020 ATGCACTTTTAAAAGAGAAAAGG - Intronic
966246287 3:177811479-177811501 ATGCCATCTCAAAAAAGAAAAGG - Intergenic
966461593 3:180182277-180182299 ATGAACTTTAAAACCTGAAAGGG + Intergenic
966949622 3:184804397-184804419 ATGCAGTTTCAGAAATTAAAGGG + Intergenic
967813216 3:193777778-193777800 ATGGAATGTCAAAACCGGAAGGG - Intergenic
969974652 4:11086081-11086103 ATGAAACTTCAAAACTTAATTGG + Intergenic
970366274 4:15361712-15361734 ATTGAATTTCAAAACCCAAATGG + Intronic
970956712 4:21820629-21820651 ATGTAATTTTAGAACTGGAAGGG + Intronic
971013881 4:22467500-22467522 ATGCTGTTTAAAATCTGAAAAGG - Intronic
971032612 4:22657386-22657408 ATAGAATTTAAAAAATGAAAAGG - Intergenic
971205094 4:24558742-24558764 ATGAAATTTCAAAATTTCAAAGG + Intronic
971593406 4:28497552-28497574 ATGCAAATTCAAAACCCAGAAGG + Intergenic
971932488 4:33102877-33102899 ATGCAAGTCCAAAAGTAAAATGG - Intergenic
971956997 4:33433579-33433601 TTGCAATTTCAAGACAAAAATGG - Intergenic
971992966 4:33925062-33925084 TTGGAATTTAAAAAGTGAAATGG + Intergenic
972150714 4:36086469-36086491 ATTCAGTTTCAAAACTGAAATGG - Intronic
972596843 4:40536984-40537006 ACCTATTTTCAAAACTGAAAAGG - Intronic
972839534 4:42914408-42914430 ATGCAAGTTCAAAATTCAATAGG - Intronic
973084537 4:46039885-46039907 ATGTAGTTGCAAAACTGACAGGG + Exonic
973092970 4:46161031-46161053 ATGCGATTTCTAAACTCTAAGGG - Intergenic
973190827 4:47383394-47383416 ATCCAATTTAAAAATTGAATTGG + Intronic
973868984 4:55145677-55145699 CTTGAATTTCAAAACTGAACAGG + Intergenic
973880024 4:55261407-55261429 AAGCACTTTCAAAGTTGAAAAGG + Intergenic
973894386 4:55396781-55396803 AAGCTATTTCAACAATGAAATGG - Intronic
974148513 4:57975594-57975616 ATGCAAATTCAAATCAGAGAAGG - Intergenic
974399962 4:61391129-61391151 AGGCAATTTATAAACAGAAAAGG + Intronic
974437536 4:61875587-61875609 AACTAATTTCAAAAGTGAAAGGG + Intronic
975604648 4:76142084-76142106 GTGCTATTTTAAAATTGAAAGGG - Intronic
975950713 4:79767571-79767593 ACACAATTTAAAAAGTGAAAAGG + Intergenic
975954358 4:79820368-79820390 AAGCAAGTTCAAAACTCAACAGG + Intergenic
976010473 4:80481584-80481606 ATAAAATTTTAAAACTGGAAGGG + Intronic
976385423 4:84451867-84451889 AAGCAATATCAAAAAAGAAACGG + Intergenic
976453594 4:85219877-85219899 ATGCAAGTTCAAAACTCAGCAGG - Intergenic
976886060 4:89985710-89985732 ATACAATTTTAAAGCTGGAAGGG - Intergenic
976948050 4:90794665-90794687 ATGCTATTTTAAAATTCAAATGG - Intronic
977324357 4:95555992-95556014 ATTCAATTTCACTACTTAAAGGG + Intergenic
977326797 4:95584242-95584264 ATGAAATGTCTGAACTGAAAAGG - Intergenic
977562513 4:98546889-98546911 GTGGTAATTCAAAACTGAAAAGG + Intronic
977667698 4:99659786-99659808 ATGCAATATCAAGAATTAAAAGG - Intergenic
978095348 4:104769389-104769411 ATGGCATTTCAAGACTGACACGG + Intergenic
978475995 4:109130820-109130842 ATGCAGGTTCGAAAATGAAAGGG - Intronic
979000515 4:115211811-115211833 ATGCAATTTGACTGCTGAAAAGG + Intergenic
979369962 4:119873248-119873270 ATGCAATTACAAAGCAGAGAAGG + Intergenic
979716353 4:123843575-123843597 AAGAACTTTCCAAACTGAAAGGG + Intergenic
979933736 4:126665834-126665856 AAGGAATTTGAAAGCTGAAATGG - Intergenic
980345962 4:131620036-131620058 ATGACATTTCCAAACTGTAATGG - Intergenic
980823407 4:138045017-138045039 ATGCAATTTATTAAGTGAAAAGG + Intergenic
981160591 4:141494154-141494176 ATCCTATTTCAAGACTGTAATGG + Intergenic
981275468 4:142893882-142893904 ATGCAAGTCCAAAACTCAACAGG - Intergenic
981280071 4:142946838-142946860 CAGCAATTTCAAAAATAAAAAGG + Intergenic
981535211 4:145792788-145792810 TTTCAATTTGAAAATTGAAATGG - Intronic
981569833 4:146139687-146139709 ATGCATTTTCAAATCCGAAAGGG - Intergenic
982480814 4:155907954-155907976 ATGTAATTTCAAAATAGCAATGG - Intronic
982593575 4:157348544-157348566 ATGAAATTTTAAAAATAAAATGG + Intronic
982641926 4:157972510-157972532 ATGGAATTAAAAAACAGAAAAGG - Intergenic
982903996 4:161045303-161045325 TTCCAATTTAAAAACTGAATGGG + Intergenic
983071113 4:163269147-163269169 ATAAAATTTTAGAACTGAAAAGG - Intergenic
983163751 4:164449324-164449346 ATCTAATTTCAAAACTACAAGGG - Intergenic
983284253 4:165719386-165719408 ATCCAATTTCCAAAATAAAAAGG + Intergenic
983357290 4:166680137-166680159 ATGCCATTGCAAGACTGAAAAGG + Intergenic
983410842 4:167395643-167395665 ATGCAATTTCAAATCACAGATGG - Intergenic
983625707 4:169799908-169799930 ATGCAATTTCAACTGTGAGAAGG + Intergenic
983800708 4:171926239-171926261 ATGTCATTTGAAAATTGAAATGG - Intronic
984066235 4:175051321-175051343 AAGCATTTTCAAACATGAAATGG - Intergenic
984272411 4:177563663-177563685 ATGCAATTTCATAATTCCAAAGG - Intergenic
984294286 4:177834202-177834224 ACACAATTTCATAACAGAAAAGG + Intronic
984663153 4:182396019-182396041 ATGAAATATGACAACTGAAATGG - Intronic
984748456 4:183247005-183247027 ATGTAATTTAGTAACTGAAAAGG - Intronic
984751988 4:183286912-183286934 ATACAATTTCAAAAAGAAAATGG + Intronic
985017763 4:185654972-185654994 GAGTATTTTCAAAACTGAAAAGG - Intronic
985072106 4:186176448-186176470 ATGGTATTTAAGAACTGAAATGG + Intergenic
985160628 4:187040764-187040786 ATGGGATTTCAAAAATCAAAGGG + Intergenic
985945557 5:3179609-3179631 ATGCTGTTTCAAAACAGAGAAGG + Intergenic
986601624 5:9478599-9478621 ATGCAAGTCCAAAACTGAGAAGG - Intronic
986904942 5:12485125-12485147 ATGCAAGTTCAAAACCCAACAGG + Intergenic
987265496 5:16249566-16249588 TTGCCCTTTCAAAACTGAAATGG - Intergenic
987494671 5:18628685-18628707 ATGCATTTTCAAATCTGAATTGG - Intergenic
987625359 5:20392016-20392038 TTGCAATTTCAAAAAATAAATGG - Intronic
987663228 5:20904607-20904629 ATGCAAGTTCAAAACCCAGAAGG + Intergenic
987843590 5:23253462-23253484 AGGGATATTCAAAACTGAAAGGG - Intergenic
988028278 5:25727762-25727784 ATTCAGTTTCAAAAAGGAAACGG - Intergenic
988308199 5:29521842-29521864 ATGAAATTTGAAATTTGAAATGG + Intergenic
988759463 5:34297578-34297600 ATGCAAGTTCAAAACCCAGAAGG - Intergenic
989532873 5:42527845-42527867 ATACAATTTCAAAAATCAGAGGG + Intronic
990269724 5:54123505-54123527 TGGCAATTTCAAAACACAAAGGG - Intronic
990270642 5:54134499-54134521 ATGTAATTATAAAACTGTAATGG - Intronic
990629827 5:57656039-57656061 AGGCATTTTAAAAGCTGAAATGG + Intergenic
991398788 5:66232629-66232651 ATGTAATTTCAAATGGGAAAAGG - Intergenic
991678267 5:69110796-69110818 AAGCATTTTTTAAACTGAAATGG - Intronic
991978450 5:72206430-72206452 CTGCAAGTTCAAGACTGAAATGG + Exonic
992223372 5:74594501-74594523 ATATAATTTCAGAAATGAAATGG + Intergenic
992372617 5:76160205-76160227 ATAGAATTTCAAAACTAATATGG + Intronic
992467853 5:77024798-77024820 ATGCAATTTCCAAAGTGTGATGG + Intergenic
992515316 5:77486006-77486028 ATAAAATTTTAAAACTGGAAAGG + Intronic
992516503 5:77499273-77499295 ATGCAACCTCAAATCTGGAAAGG + Intronic
993033835 5:82735158-82735180 ATGCAATTCAAAACCTTAAAAGG - Intergenic
993237237 5:85328124-85328146 ATAGAATTTCAAAAATAAAATGG - Intergenic
993721858 5:91329262-91329284 ATGAAATTCCAACACTGAAGAGG - Intergenic
994057767 5:95438382-95438404 ATGGGATTTATAAACTGAAATGG + Intronic
994479909 5:100321414-100321436 ATGCAATTTTAGAGCTGGAAGGG - Intergenic
994516580 5:100780018-100780040 ATGCACTTTCAATAAGGAAATGG - Intergenic
994562308 5:101390731-101390753 ATTCTATTTCACAACTGCAACGG - Intergenic
994583579 5:101678221-101678243 ATGAAAACTCAAACCTGAAAGGG + Intergenic
995232952 5:109791462-109791484 TTCCAATTTAAAAACTGAAAAGG - Intronic
995429177 5:112055237-112055259 ATGCAAGTCCAAAATTGAATAGG - Intergenic
996226131 5:120998981-120999003 ATGCAATGTAAGAACTGAAAAGG + Intergenic
996284325 5:121770534-121770556 ATGCAGTTTCAAAACTCAGCAGG - Intergenic
996562371 5:124844618-124844640 ATGGAATTTTAGAACTGGAATGG + Intergenic
996686761 5:126291066-126291088 TTGTAATTTCAAAATTTAAAGGG + Intergenic
997202749 5:132022456-132022478 ATGAAATTTATAAACTGGAATGG + Intergenic
997776742 5:136615790-136615812 ATGCAATTTGAAACAAGAAAAGG + Intergenic
997780849 5:136656726-136656748 ATGAAATGTCAAAATTTAAATGG - Intergenic
998995097 5:147862739-147862761 ATTTACTTTCAAAACTAAAAGGG + Intergenic
999528553 5:152435995-152436017 ATGCCCTTTCAACACTGAACGGG - Intergenic
999604486 5:153299438-153299460 ATAGAATGTCAGAACTGAAAAGG - Intergenic
999807539 5:155097093-155097115 ATGGAATTTCATAACTTTAACGG + Intergenic
999910221 5:156189419-156189441 ATGGAATTTTAGAACTGGAAGGG + Intronic
1000645439 5:163755603-163755625 ATCCAATCTCAAAACTGATTAGG - Intergenic
1001002601 5:168021862-168021884 ATCCAATTTCAAAAAAGAAAGGG + Intronic
1001780554 5:174365290-174365312 ATTCAAGTTCAATACTGAAAGGG + Intergenic
1003240592 6:4342357-4342379 ATGCAATTTTAAATGGGAAAAGG + Intergenic
1004337836 6:14780869-14780891 CTGCAATGTGAAAACTGACAAGG + Intergenic
1005733908 6:28727021-28727043 ATGAAATTTTAAGACTGCAAAGG + Intergenic
1005878195 6:30031659-30031681 AGGAAAATTCAGAACTGAAATGG - Intergenic
1006618246 6:35343995-35344017 AATCTATTTCAAAACTCAAACGG - Intronic
1006852302 6:37107625-37107647 AAGCACTTTGAAAAGTGAAAAGG + Intergenic
1006994362 6:38244557-38244579 AATCAATTTCTGAACTGAAAGGG + Intronic
1007451821 6:41945916-41945938 ATGCATGTTCATAACAGAAAGGG - Intronic
1008245362 6:49164652-49164674 ATGCAAATTCACAGATGAAAAGG - Intergenic
1008264687 6:49410576-49410598 ATGGAATTTCAGATGTGAAAGGG - Intergenic
1008918269 6:56813729-56813751 ATGAAAATTCAAAAATGAGATGG + Intronic
1009550405 6:65085420-65085442 ATGAATTTTCTAATCTGAAAGGG + Intronic
1009743389 6:67778411-67778433 ATGCAAAATTAAAAGTGAAATGG - Intergenic
1009818743 6:68772180-68772202 TTGCAGATGCAAAACTGAAAAGG + Intronic
1009848616 6:69166177-69166199 ATGCAATCTCAATACAGAAGAGG + Intronic
1010320267 6:74499212-74499234 ACCCATTTTCAAAAATGAAAAGG - Intergenic
1010563389 6:77379043-77379065 AAGCATTTTAAAAATTGAAAGGG - Intergenic
1010636160 6:78261152-78261174 ATTCAATTTTAAAATGGAAATGG - Intergenic
1010899100 6:81403700-81403722 ATGAAATTTCAAAATGCAAACGG - Intergenic
1011461383 6:87608673-87608695 GTGAAATTTCAAGCCTGAAATGG - Intronic
1011526319 6:88269070-88269092 AGGCCCTTTGAAAACTGAAAGGG + Intergenic
1012459052 6:99440269-99440291 ATTGAATTTTAGAACTGAAAAGG - Intronic
1012751463 6:103168548-103168570 ATGCAACTTCAAAACTCAGCAGG - Intergenic
1012771487 6:103440910-103440932 ATCCAATTTTAAAATTGAATGGG + Intergenic
1012779497 6:103539607-103539629 CTGAAATTTCAAAAGTGAAGAGG + Intergenic
1012808226 6:103923023-103923045 ATGCAATTTCAACAGAGATATGG + Intergenic
1013100872 6:106985711-106985733 AAAAAATTTCAAAACTGAAGAGG - Intergenic
1013385972 6:109631230-109631252 ATGCCATTAGAAAAGTGAAATGG + Intronic
1013453706 6:110310617-110310639 ACCTCATTTCAAAACTGAAAAGG + Intronic
1014136417 6:117895022-117895044 ATACAAATTTAAAACTGAATGGG + Intergenic
1014356939 6:120423972-120423994 ATGGAATTAACAAACTGAAAGGG + Intergenic
1014410676 6:121115879-121115901 ATGCTATTTCTATTCTGAAATGG - Intronic
1014621756 6:123675402-123675424 ATGGAGTTTTAAAACGGAAATGG - Intergenic
1014839314 6:126199308-126199330 ATTTAAATTCAAAATTGAAATGG - Intergenic
1014909069 6:127067636-127067658 CTGCAATTTCAAAGCTAGAAGGG - Intergenic
1015005486 6:128275788-128275810 ATGAAATATTAATACTGAAAGGG - Intronic
1015614401 6:135059928-135059950 AAACAATTGCAAAACTGCAAAGG - Intronic
1015629810 6:135220766-135220788 ATACAATATTAGAACTGAAAGGG + Intergenic
1015669310 6:135670437-135670459 AAACAATTTCAAAACTCATATGG + Intergenic
1015783680 6:136898827-136898849 TTACAATTTCTAAAATGAAAAGG - Intronic
1016635961 6:146290583-146290605 AAGCAATTTCAAAACCCAAATGG - Intronic
1017538588 6:155375699-155375721 ATGCCATTTTAAAACTTACAGGG - Intergenic
1018122452 6:160649100-160649122 AAACAATAGCAAAACTGAAAAGG - Intronic
1018237367 6:161739490-161739512 TTGCAATATAAAAACTGAAGAGG + Intronic
1018336371 6:162794400-162794422 ATGCCATTTAAAAAATTAAAAGG - Intronic
1018477646 6:164159137-164159159 ATGCAAGTCCAAAATCGAAAAGG + Intergenic
1019834705 7:3371201-3371223 TTACAAGTTCAAATCTGAAAGGG + Intronic
1020453482 7:8346301-8346323 ATTCAGTTTCAAAAGGGAAATGG + Intergenic
1020668709 7:11078530-11078552 ATGAAATTTGAAAATTAAAAGGG - Intronic
1021178756 7:17481577-17481599 ATGAAATTTCAAAACTCATTTGG + Intergenic
1021704807 7:23356249-23356271 ATGAAATTTTAGAGCTGAAAGGG - Intronic
1022344273 7:29499149-29499171 ATGAAAATCCAAAGCTGAAAAGG - Intronic
1022433481 7:30353530-30353552 ATGCTATTTTAAAATTGACAGGG - Intronic
1022512652 7:30950541-30950563 ATGCAAGTTCAAAACTCAGCAGG - Intronic
1023610082 7:41964108-41964130 ATACTGATTCAAAACTGAAATGG + Exonic
1024321963 7:48079610-48079632 ATGCAATTTAAAAAATGCAGGGG + Intergenic
1024423294 7:49195343-49195365 ATGCAAATTCAAAATTTATAAGG - Intergenic
1024622392 7:51173094-51173116 ATGCAATTTTAAAACAGTAGTGG + Intronic
1027473793 7:78605110-78605132 ATGCAATGTGAAAACTGGAGTGG + Intronic
1027508094 7:79043903-79043925 ATTCAATTTCACAACTCTAATGG - Intronic
1028102818 7:86842480-86842502 ATGAAAGTTCATAAGTGAAAGGG - Intronic
1028174951 7:87644536-87644558 ATCACATTTCAAAACTTAAAAGG - Intronic
1028315881 7:89402265-89402287 GTGAAATTTCATAGCTGAAAAGG - Intergenic
1028405678 7:90471232-90471254 TTTCACTTCCAAAACTGAAAAGG + Intronic
1030306444 7:108023843-108023865 ATGCCACTTCATAATTGAAAGGG - Exonic
1030978527 7:116157478-116157500 AAGGTATTCCAAAACTGAAATGG + Intronic
1031058038 7:117015538-117015560 ATGCAATTTAAAAAAGGAAAAGG - Intronic
1031069985 7:117151580-117151602 AAGTAATTTCAAAAGTGAAGGGG - Intronic
1031227346 7:119056655-119056677 AAGCAATGTCAAATATGAAATGG - Intergenic
1031770482 7:125834883-125834905 GTGCAATATTAAAACTAAAACGG - Intergenic
1032176190 7:129628780-129628802 TTGCAATGTGAAATCTGAAATGG + Intronic
1032393782 7:131574534-131574556 AAGCAATGTAAAAAATGAAATGG + Intergenic
1032431119 7:131862528-131862550 TTGGAATTTCAGACCTGAAATGG + Intergenic
1033105909 7:138523242-138523264 ATGCATTTTCAAAGATAAAAAGG + Intronic
1033594584 7:142848440-142848462 TTGCTATTTGAAAAGTGAAATGG + Intergenic
1033594811 7:142850822-142850844 TTGCATTTCCTAAACTGAAAGGG - Intergenic
1033690785 7:143734793-143734815 ATTGAATTTTAAAACAGAAATGG - Intergenic
1033818491 7:145104611-145104633 TTTCAATTTCACAACTGAAATGG + Intergenic
1034445771 7:151113530-151113552 ATGGAATTCTAAAGCTGAAAGGG + Intronic
1034710310 7:153185424-153185446 ATGCAAGTTCAAAACCCAACAGG + Intergenic
1035773029 8:2164776-2164798 ATTCAATTTAAAAACTGGTAGGG - Intronic
1035892343 8:3358928-3358950 ATAAAATTTCAGAGCTGAAAGGG + Intronic
1036138763 8:6186834-6186856 TTGCAATTTCATAGCTGTAACGG - Intergenic
1036175858 8:6538055-6538077 ATCCTATTTCGAAATTGAAATGG - Intronic
1037223863 8:16559892-16559914 ATGCAATTTTATAACTAAATAGG + Intronic
1037332414 8:17756522-17756544 ATGCTATTTCCAAATTGAAGGGG + Intronic
1037795199 8:21987576-21987598 TTGCAATTTCAGGATTGAAAGGG + Intronic
1037984929 8:23284388-23284410 ATTCAATTTTAAAAGTAAAATGG - Intronic
1038065385 8:23958283-23958305 AAGCAATTTTAAAGGTGAAATGG - Intergenic
1039994755 8:42522358-42522380 ATACAATTTCAAAGCAAAAAGGG + Intronic
1040877056 8:52164798-52164820 TTGCAATGTCAAAACAGCAATGG + Intronic
1041158106 8:55008829-55008851 AGGGAATTTCAAAACAGGAAAGG + Intergenic
1041263676 8:56043790-56043812 CTGGAATTTCAAAGCTGAGAGGG + Intergenic
1041456290 8:58064352-58064374 ATGATATTTCCAAAATGAAATGG + Intronic
1041960400 8:63608950-63608972 AAGCTATTTCAAAACTCAATGGG - Intergenic
1042423620 8:68620597-68620619 ATGAAACTTGAAAACAGAAAAGG + Intronic
1042675439 8:71315900-71315922 ATGCAAAATCAAATATGAAAAGG + Intronic
1043056007 8:75440098-75440120 ATGGATTTGTAAAACTGAAAAGG - Intronic
1044022677 8:87126359-87126381 ATGCAAATTCAAACCACAAAGGG - Intronic
1044115045 8:88325721-88325743 ACCCAATTTGAAAACTAAAAAGG - Intronic
1044161030 8:88915292-88915314 AGGCAATTTCAAACATGAGACGG - Intergenic
1044504612 8:93003816-93003838 ATGCAAATTCAAAACTCAGCAGG + Intronic
1044561012 8:93612375-93612397 AGGCAATTATAAAACAGAAAGGG + Intergenic
1045169249 8:99645553-99645575 ATGAAACTTCAGAACTGGAATGG - Intronic
1045624627 8:104029093-104029115 ATGCCATTTGTAAACTGAAATGG + Intronic
1045978472 8:108156278-108156300 ATGCATTTTCAAATCAGAGAAGG - Intergenic
1046474601 8:114725468-114725490 ATGAAATTTAAAAACTTCAATGG + Intergenic
1046677329 8:117124600-117124622 ATCCAATTTCCAATCTCAAAAGG + Intronic
1046877979 8:119277368-119277390 ATGCAAGTTCAAAACTCAGCAGG + Intergenic
1050933909 9:11368033-11368055 ATCCAATTGAAAGACTGAAAAGG + Intergenic
1051550819 9:18327203-18327225 ATGCAATATCAGAACAGCAAAGG - Intergenic
1052521557 9:29554307-29554329 ATGGCATTTCTAAACTGTAATGG - Intergenic
1052622273 9:30929074-30929096 AACAAATTTCAAAATTGAAATGG + Intergenic
1054738605 9:68781134-68781156 AGGGAATTTCAAAAAAGAAAAGG - Exonic
1055356271 9:75440468-75440490 ATGTAATTTCAACTCTCAAATGG + Intergenic
1055686116 9:78776760-78776782 ATGCATTTACATCACTGAAAGGG - Intergenic
1056308363 9:85314079-85314101 ATGCAAATTAAAAACTAATAAGG + Intergenic
1056337621 9:85590045-85590067 TCACAATTTCAAAACTCAAAAGG - Intronic
1056669864 9:88617730-88617752 ATGCAATGACTGAACTGAAAAGG - Intergenic
1058054998 9:100440432-100440454 ATGTAATTTCAGATGTGAAAGGG - Intronic
1058309803 9:103485943-103485965 ATGCAATTCCAAAACCCAACAGG - Intergenic
1059364614 9:113776518-113776540 TTCCAAATTCAAAACTCAAAAGG - Intergenic
1059575829 9:115487182-115487204 AGCCAATTTGAAAACAGAAATGG - Intergenic
1060237838 9:121878631-121878653 ATGCTATTTCAGAGCTGGAAAGG + Intronic
1061806495 9:133140243-133140265 ATGTAAGTTCAAAACTGGGAGGG - Intronic
1203366527 Un_KI270442v1:263227-263249 ATGGAATTGCAAAACTAGAATGG - Intergenic
1185815083 X:3147050-3147072 AGGCAGTTTCAAAAATTAAAAGG - Intergenic
1186017978 X:5220323-5220345 ATGAAATGTGAAAAATGAAATGG + Intergenic
1186044171 X:5516330-5516352 ATGGATTTTAAAAACTTAAATGG + Intergenic
1186445888 X:9628466-9628488 ATGTCATTTCCAAACTGACAAGG + Intronic
1186584329 X:10856183-10856205 ATGCAATTTGAAGACTTATAAGG + Intergenic
1186782083 X:12923012-12923034 ATGCCATTTAAGAACTGAGATGG + Exonic
1187028018 X:15456219-15456241 AAGCATTTGCAAAACTGGAAAGG - Intronic
1187572596 X:20519922-20519944 ATTCAAATTCAAAATTCAAATGG - Intergenic
1187740416 X:22349536-22349558 AAGCAATTTCAGAAGTGACAAGG + Intergenic
1188072610 X:25735691-25735713 CTGCAATATCACAACTAAAAAGG + Intergenic
1188306201 X:28562212-28562234 ATGCAATTTCCAAAGTGGGAGGG + Intergenic
1188456786 X:30375548-30375570 ATGAAATTTCAGAACTGGAAAGG - Intergenic
1188554992 X:31401125-31401147 ATGCAATCTCAGAATTTAAAGGG - Intronic
1188719610 X:33506367-33506389 ATGCAAGTCCAAAATTGAATAGG - Intergenic
1189039205 X:37524664-37524686 ATGTAATTTCTAAACTGGCAGGG + Intronic
1189214231 X:39309603-39309625 ATGTAATTTGAAAACTCATAAGG - Intergenic
1190094151 X:47465385-47465407 ATGTTATTTCAAAATTGCAAAGG + Intronic
1190424812 X:50324594-50324616 ATGAATTTTTAAAACAGAAAAGG - Intronic
1191118423 X:56875704-56875726 AAGCATTTTCAAACATGAAATGG - Intergenic
1191997830 X:67115458-67115480 ATCAAATTTGAAGACTGAAAGGG + Intergenic
1192091521 X:68162707-68162729 TTGAAATTTCAAAGCTGAAAAGG + Intronic
1192142029 X:68654078-68654100 ATGCAATATCAGAGATGAAAAGG + Intronic
1192225115 X:69222398-69222420 ATGAAATTCCACAAGTGAAAAGG - Intergenic
1193175514 X:78388220-78388242 ATGCAAGTCCAAAACTCATAAGG + Intergenic
1193236559 X:79114151-79114173 ATGCAATTTGAAAACTCAGTGGG + Intergenic
1193534566 X:82697264-82697286 ATAAAATTTCAAAACAGAAAGGG - Intergenic
1193688673 X:84611655-84611677 ATACATTGTCAAAAATGAAAAGG + Intergenic
1193963511 X:87954272-87954294 ATGAAAATGGAAAACTGAAAAGG + Intergenic
1194060387 X:89189426-89189448 GGCCAATTTCAAAACTGAGATGG + Intergenic
1195515839 X:105774794-105774816 ATGCAATTTTAGAAATGAATGGG + Intergenic
1195859153 X:109362560-109362582 ATAGAATTTCAAAGCTGGAAGGG - Intergenic
1196192572 X:112810329-112810351 ATGTAATGTCAAAGTTGAAAGGG + Intronic
1196728246 X:118916521-118916543 TAGGAATTTCAATACTGAAAAGG - Intergenic
1197056609 X:122128404-122128426 ATGCAAATCCAAAACTCAGAAGG + Intergenic
1197056635 X:122128617-122128639 ATGCAAATCCAAAACTCAGAAGG - Intergenic
1197610427 X:128632265-128632287 ATTGAATTTTAAAGCTGAAATGG - Intergenic
1197666703 X:129231855-129231877 ATGCAATTCCAAAATACAAAGGG + Intergenic
1198039972 X:132840918-132840940 AAGCAATTTTAAAACTGGAGTGG + Intronic
1198395427 X:136214506-136214528 GTGGAGTCTCAAAACTGAAAAGG + Intronic
1198631337 X:138642144-138642166 ATTCAATTTCAAAACTGGAAAGG + Intronic
1198693340 X:139307890-139307912 ATGCAAATTCAAAACTAGCAGGG - Intergenic
1199481143 X:148299434-148299456 ATGCATTTTGAAAGCTGTAAAGG - Intergenic
1199585609 X:149412992-149413014 ATGCAAGTTCAAAACTCAGCAGG - Intergenic
1199724311 X:150566450-150566472 AAGCACTTTGAAAACTGTAAAGG - Intergenic
1200353831 X:155526826-155526848 ATGCAAGTTCAAAACCCAACAGG - Intronic
1200885700 Y:8267035-8267057 TTGCTATTTCAAAATAGAAAAGG + Intergenic
1200907979 Y:8504666-8504688 TTGCTATTTCAAAATAGAAAAGG - Intergenic
1201016865 Y:9613168-9613190 TTGCTATTTCAAAATAGAAAAGG + Intergenic
1201058926 Y:10025120-10025142 TTGCTATTTCAAAATAGAAAAGG + Intergenic
1201072151 Y:10157000-10157022 ATGGAATTGCAAAACTAGAATGG + Intergenic
1201144198 Y:11053919-11053941 ATGCAAATTAAAAACAGAAATGG - Intergenic
1201266202 Y:12209656-12209678 AGGCAGTTTCAAAAATTAAAGGG + Intergenic
1201541696 Y:15111792-15111814 ATACAATTTCAAAAAAAAAAAGG - Intergenic
1202255785 Y:22918880-22918902 ACTCAAATTTAAAACTGAAAAGG + Intergenic
1202408776 Y:24552629-24552651 ACTCAAATTTAAAACTGAAAAGG + Intergenic
1202462007 Y:25117451-25117473 ACTCAAATTTAAAACTGAAAAGG - Intergenic