ID: 1140597347

View in Genome Browser
Species Human (GRCh38)
Location 16:76431912-76431934
Sequence GAACTCAATGTGTCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140597347_1140597351 4 Left 1140597347 16:76431912-76431934 CCTGTTTTTGACACATTGAGTTC 0: 1
1: 0
2: 2
3: 22
4: 161
Right 1140597351 16:76431939-76431961 GCCTTTGATATATGGAAGATTGG 0: 1
1: 0
2: 5
3: 10
4: 113
1140597347_1140597350 -4 Left 1140597347 16:76431912-76431934 CCTGTTTTTGACACATTGAGTTC 0: 1
1: 0
2: 2
3: 22
4: 161
Right 1140597350 16:76431931-76431953 GTTCAAGGGCCTTTGATATATGG 0: 1
1: 0
2: 0
3: 10
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140597347 Original CRISPR GAACTCAATGTGTCAAAAAC AGG (reversed) Intronic
901168620 1:7237497-7237519 GAAATCAATGCATCCAAAACAGG - Intronic
902765190 1:18609705-18609727 AAACTCAAAGTGGCAGAAACGGG + Intergenic
903743091 1:25569643-25569665 GAACTCAATATGTCTAAAAATGG + Intergenic
904708399 1:32409553-32409575 CAACTCAATGTATTCAAAACAGG - Intergenic
904853602 1:33478471-33478493 AAACTCAATGAGTCAAAAACTGG - Intronic
904853672 1:33478928-33478950 GCACTCACTGTGTCAGACACTGG + Intronic
906682414 1:47738260-47738282 GGACTGAATGCCTCAAAAACTGG - Intergenic
908067847 1:60426857-60426879 GATCTTAATGATTCAAAAACTGG + Intergenic
908267406 1:62393024-62393046 ATGCTCAATGTGTCAAAAACTGG - Intergenic
908267527 1:62394020-62394042 ATGCTCAATGTGTCAAAAACTGG + Intergenic
908688308 1:66748751-66748773 GAACACAATTTGTAAAATACTGG - Intergenic
909750227 1:79150329-79150351 GCATTCAATGTGCCAGAAACAGG + Intergenic
910243727 1:85116243-85116265 CAAGTCAATGTGTCCAGAACAGG + Intronic
911257124 1:95645806-95645828 GAACGTAATGTCTCAAGAACAGG + Intergenic
911789593 1:101996659-101996681 CAAATAAATATGTCAAAAACGGG - Intronic
912011685 1:104973594-104973616 CAAATCAAGGTGTCAAAAAGGGG + Intergenic
915923006 1:159992089-159992111 TAACTCAAGATGTCAAAAAGAGG + Intergenic
917230872 1:172836075-172836097 GAACTCACTGTGGTAAAAACTGG - Intergenic
918630465 1:186711048-186711070 GAAATCAATATGTTAAAAGCAGG - Intergenic
918654570 1:187008625-187008647 GAACACAATTTTTAAAAAACTGG + Intergenic
918856925 1:189768029-189768051 TGACTTAATGTGTCAAAAACAGG + Intergenic
922238323 1:223737790-223737812 GAAGGGAATGTGTCAAAACCGGG + Intronic
923713114 1:236402823-236402845 ATACTCAATGTGTGAAAAAGGGG + Intronic
924918118 1:248595555-248595577 GAAAGCAATTTGTTAAAAACTGG - Intergenic
1067011017 10:42713963-42713985 GAACTTGATGAGTCAAAAACAGG - Intergenic
1067312580 10:45127909-45127931 GAACTTGATGAGTCAAAAACAGG + Intergenic
1069462280 10:68606835-68606857 GAACTCATTTTGTCATAAACTGG + Intronic
1069759140 10:70796001-70796023 GAACTCAATTTGGCAATACCAGG - Intergenic
1072517833 10:96203485-96203507 CAACTCAATGTGGGAAAAAAAGG - Intronic
1072532620 10:96333481-96333503 GAACTCAGTATGTCAAAGAGAGG + Intronic
1072902842 10:99424784-99424806 GAACTCAACCTGGGAAAAACTGG - Intronic
1073206477 10:101772066-101772088 GAACCCAAAGTGGCAGAAACAGG - Intronic
1074090716 10:110251196-110251218 TGAGTCAAAGTGTCAAAAACTGG + Intronic
1074290296 10:112133237-112133259 GAGATTAATGTTTCAAAAACAGG + Intergenic
1076666762 10:132097561-132097583 GAAGTGAATGTGACAATAACAGG + Intergenic
1080060728 11:27954022-27954044 GAACTCAACATGTCAATAATTGG - Intergenic
1080300645 11:30781226-30781248 GCACTCAATGTTTCATAAAGTGG + Intergenic
1080785970 11:35475387-35475409 AAACTCAATGTATAAAAAAGGGG + Intronic
1081063996 11:38517182-38517204 GAAAGCAATGTGTTAAAAAATGG - Intergenic
1087447930 11:98278875-98278897 GAACTAAATGTGAAAAAAATTGG + Intergenic
1087477511 11:98655191-98655213 GAAATCAATGTGTCACCAAACGG + Intergenic
1088192640 11:107242490-107242512 CAACTCAATGTGACAATCACAGG - Intergenic
1088526322 11:110759987-110760009 AAATTCAATCTCTCAAAAACAGG - Intergenic
1090904732 11:131065367-131065389 CAACTCAGTGTGTGCAAAACTGG + Intergenic
1092729874 12:11520658-11520680 GAACTCAATGTTTGTAAAACTGG + Intergenic
1093811820 12:23501061-23501083 TAATACAATGTGTCCAAAACAGG - Intergenic
1095566899 12:43634818-43634840 AAACACAATGTGTTCAAAACTGG + Intergenic
1097147888 12:56954180-56954202 GCACTCACTGAGTCAGAAACAGG - Intronic
1098143772 12:67477575-67477597 CAAATCAATGTGGGAAAAACTGG - Intergenic
1098241481 12:68471861-68471883 GAACACAATGTGGCCAAAAGAGG + Intergenic
1098383672 12:69896283-69896305 GAGCTCAGTGTGTCATATACCGG - Intronic
1099408869 12:82299320-82299342 GAAATCTCTGTGTCAAAAATAGG - Intronic
1099718186 12:86325280-86325302 GAACTTAATGTGGAAAAATCTGG - Intronic
1100278210 12:93091918-93091940 TAACTCAATGTGTCAAGGACGGG - Intergenic
1104509636 12:129365722-129365744 TACCTCAATGTGTCAATCACTGG + Intronic
1106062971 13:26313037-26313059 GAAAATAATGTGTCAAAAACAGG - Intronic
1107224288 13:38028432-38028454 AAATTCAATATCTCAAAAACTGG - Intergenic
1107509110 13:41063792-41063814 AAACGCAATGTATGAAAAACAGG + Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109983658 13:69945586-69945608 GAACTAAATTTTTAAAAAACTGG + Intronic
1110085335 13:71372120-71372142 GATCTCATTGTGTAGAAAACAGG + Intergenic
1111010439 13:82306390-82306412 GAACTCAATGTACCAACAAGTGG + Intergenic
1111185936 13:84735850-84735872 GAAATCTTTGTGTCACAAACAGG - Intergenic
1111701129 13:91691235-91691257 AACCGCAATGTTTCAAAAACTGG + Intronic
1113005456 13:105696714-105696736 GAATTCAATGTGTTCAAAATTGG + Intergenic
1115080874 14:29449282-29449304 GTTCTCTATGTGTGAAAAACTGG + Intergenic
1116582092 14:46654645-46654667 TCACACAATGTGCCAAAAACAGG - Intergenic
1117318661 14:54599212-54599234 GAATTAAAGGTCTCAAAAACAGG - Intronic
1120158670 14:81121976-81121998 GAATTCATTGTGTGAAAAACTGG + Intronic
1122368180 14:101210112-101210134 AAATTCAATGGGACAAAAACAGG - Intergenic
1122585452 14:102803035-102803057 GAACTCACTGTCACAAGAACAGG + Intronic
1123797817 15:23791120-23791142 GAAGTCAGTGTGTCTGAAACTGG - Intergenic
1129376326 15:75135103-75135125 TAACAAAATGTGTCAAAAATTGG - Intergenic
1129529304 15:76249930-76249952 GAAAACAATTTGTCAAAATCTGG + Intronic
1131598126 15:93820006-93820028 GAACTCATGCTGTGAAAAACAGG + Intergenic
1132377614 15:101340587-101340609 TAACTCAAAGTGTTAAAAAGAGG - Intronic
1133845446 16:9449100-9449122 AAACTCAATCTGACAAAAGCTGG - Intergenic
1138938204 16:61756964-61756986 GAACTCAATGGATCTAAAAATGG - Intronic
1140597347 16:76431912-76431934 GAACTCAATGTGTCAAAAACAGG - Intronic
1146017580 17:29246406-29246428 GAACTCAATATGAGAAAAAATGG - Intergenic
1146238236 17:31187749-31187771 GAACATAATGTCTCAAGAACGGG - Intronic
1149962717 17:61129729-61129751 GAACTAAAGGTGTCAAACAATGG - Intronic
1150788457 17:68181108-68181130 GAACCCAGTGTGTCTAAAATCGG - Intergenic
1151778798 17:76228039-76228061 GAATTCCATTTGTAAAAAACAGG - Intronic
1153101588 18:1476749-1476771 GATCTCAATGTTACAAAATCTGG + Intergenic
1153599965 18:6770811-6770833 GAATTCAAGGTTTCAAACACTGG - Intronic
1157175380 18:45447009-45447031 CAAATCAATGAATCAAAAACAGG - Intronic
1159500108 18:69257845-69257867 GAAATCAATGACTCTAAAACTGG + Intergenic
1160243943 18:77142355-77142377 GATCTCATTGTTTTAAAAACGGG + Intergenic
1168576687 19:57517506-57517528 CAGCTCAATGTGTGAAAAATTGG + Intronic
926656467 2:15412731-15412753 GAAGTCACTGTGTCAAACCCTGG + Intronic
927480490 2:23450092-23450114 GTCCTCAATGTGACAAATACCGG + Intronic
930923546 2:56788234-56788256 GAATGAAATCTGTCAAAAACTGG - Intergenic
933228359 2:79777239-79777261 GAAAGCAATCTGTCAACAACTGG + Intronic
933542792 2:83669558-83669580 AAACTTACTGTGTCAAAAGCAGG + Intergenic
938479792 2:131651110-131651132 CAACTCAATGTGTCCAGATCAGG + Intergenic
939014730 2:136889180-136889202 GAACTCAATCTTTAAAAAACAGG + Intronic
939856900 2:147369218-147369240 TTACTAAATATGTCAAAAACAGG + Intergenic
941150795 2:161913018-161913040 GAAGTCAAAGTATCAAAAACAGG + Intronic
941721273 2:168815821-168815843 AAAGTCAATATGTCTAAAACAGG + Intronic
942479452 2:176368390-176368412 CAACTCAATATGTCCAAAACTGG - Intergenic
944598166 2:201281475-201281497 GAGCTCAATGTGGAAAAAAGTGG + Intronic
948112443 2:235467215-235467237 GAAAAAAATGTGTCAAGAACAGG + Intergenic
948717315 2:239873695-239873717 TAACTCACTGTGCTAAAAACTGG - Intergenic
1168885713 20:1252720-1252742 GACATCAGTGTGTCATAAACTGG - Intronic
1169673152 20:8126879-8126901 GAACTCACTGAGTCAGAAGCTGG + Intergenic
1170691512 20:18620280-18620302 AAACTTAATGTGTCCAATACGGG - Intronic
1176636307 21:9247598-9247620 GCTCTCACTGTGTCAAAAAAAGG - Intergenic
1177510424 21:22079872-22079894 GAAGGAATTGTGTCAAAAACTGG - Intergenic
1178045656 21:28691289-28691311 CAATTCATTGTTTCAAAAACTGG - Intergenic
949691159 3:6641134-6641156 GAACTCAAGTTGTCACAAGCAGG + Intergenic
950705494 3:14777403-14777425 AGACTAAATGTGTCTAAAACTGG + Intergenic
953477174 3:43215395-43215417 GAACTCAATGTATCACAAGGAGG + Intergenic
956872652 3:73433320-73433342 GAACTCAAAGGGTCAAAGAGTGG - Intronic
957272900 3:78054585-78054607 GAACTCTTTGTGTCTAACACAGG - Intergenic
958156665 3:89763207-89763229 GAACTTAAAATATCAAAAACTGG - Intergenic
962025313 3:131541337-131541359 GGACACAATGTATCAAAACCTGG + Intronic
965392442 3:168121270-168121292 GAATTCAAGGAGTTAAAAACAGG + Intergenic
965781896 3:172294903-172294925 GAACCCAATGGGTGGAAAACTGG - Intronic
966044121 3:175529378-175529400 GAACATAATGTGGCAAGAACAGG + Intronic
966306882 3:178546289-178546311 GAACTGAAAGTGAAAAAAACTGG + Intronic
973840608 4:54856534-54856556 GATCTCAATGTTTCTGAAACTGG + Intergenic
974491933 4:62575385-62575407 AAACTCAATTTCTCAAAAACAGG - Intergenic
978408274 4:108401942-108401964 GAACACAATCTGCCATAAACGGG - Intergenic
978949830 4:114544824-114544846 GGATTCAATGTGGCAAAAACAGG + Intergenic
979488803 4:121300451-121300473 CAATCCAATGTGGCAAAAACTGG - Intergenic
981031334 4:140128592-140128614 GCACTCTGTGTGTCAAAAAAGGG + Intronic
984743189 4:183187243-183187265 GAATTAAATCTGTAAAAAACGGG + Intronic
1202751203 4_GL000008v2_random:6083-6105 GCTCTCACTGTGTCAAAAAAAGG - Intergenic
986206410 5:5628868-5628890 GAATTCAAAGTGTTAAAAGCAGG - Intergenic
987899520 5:23993559-23993581 AAAAACAATATGTCAAAAACAGG + Intronic
990036596 5:51329103-51329125 CAACTCACTGTGTCAAAAACAGG - Intergenic
991013579 5:61909362-61909384 GAACGCAATGTCACAGAAACAGG + Intergenic
991186738 5:63817447-63817469 GAACTCAAATTGTTAAGAACTGG - Intergenic
991701942 5:69324532-69324554 TCACTCAATTTGTCAAAAATTGG + Intronic
992061467 5:73052262-73052284 AAAATAAATGTGTGAAAAACTGG + Intronic
995253073 5:110016595-110016617 GAACTCAACATGTCCTAAACTGG + Intergenic
995915011 5:117234665-117234687 AAAGTCAATCTGTCAAACACAGG - Intergenic
996286567 5:121800590-121800612 GAAGTAAAAGTGACAAAAACAGG - Intergenic
997290923 5:132734379-132734401 GAAATCAATGTGCTACAAACAGG - Exonic
997784570 5:136697667-136697689 GACCTATATGTGTCAGAAACAGG - Intergenic
1005196297 6:23288035-23288057 GAAGTCAGTCTGTCAAAACCAGG + Intergenic
1006958475 6:37900955-37900977 GAACTGAGTGTGTGAAAGACAGG + Intronic
1009618134 6:66037655-66037677 GAACTCACTGTTGCAAGAACAGG + Intergenic
1010702084 6:79062924-79062946 GAACACAAAGTGTCCAAAAAGGG - Intronic
1010813143 6:80323572-80323594 GAAATCACTGTATGAAAAACTGG - Intronic
1011874680 6:91943340-91943362 TAACTCACTGTCACAAAAACAGG - Intergenic
1012227465 6:96720552-96720574 AATCTCAATTTGTCAAAAAGGGG - Intergenic
1013191756 6:107809704-107809726 GAACTCAACGTTTCCAAAACTGG - Intronic
1014379058 6:120715651-120715673 GATCCCAATGTGTCAAGAGCAGG - Intergenic
1014594527 6:123317595-123317617 TAAGTGAATGTGTCAAAAAGGGG - Intronic
1017323976 6:153125958-153125980 GAACTTAAAAAGTCAAAAACAGG + Intronic
1018766239 6:166935277-166935299 AAACTCAATATATCAAAAATAGG - Intronic
1020417366 7:7961278-7961300 GAAGTGAATGTGTCTAAAATGGG - Intronic
1021312798 7:19113826-19113848 GAACTAGATGTGTCAAAGAAAGG - Intronic
1024421835 7:49176915-49176937 GAATTCAATGTGTCAAACCATGG + Intergenic
1025015910 7:55439032-55439054 GAACTCAATGTGCGTACAACCGG - Intronic
1025168943 7:56738645-56738667 GAACTCATTTTGTCATAAACTGG - Intergenic
1025703445 7:63841249-63841271 GAACTCATTTTGTCATAAACTGG + Intergenic
1030419951 7:109296539-109296561 GAATTCAATATATCTAAAACGGG - Intergenic
1031058435 7:117020816-117020838 GATGTCAATGTGTCAAAACCAGG + Intronic
1031690235 7:124779121-124779143 GCACTCAATCAGTTAAAAACTGG - Intronic
1035489143 7:159257147-159257169 GTGATCAATGTGTTAAAAACTGG + Intergenic
1038094953 8:24298303-24298325 GAACTCTTTGAGTCAAAAATGGG - Intronic
1040623215 8:49113243-49113265 GAAAACAATGTGGGAAAAACAGG + Intergenic
1041416270 8:57612434-57612456 GAACTCAATATGACAAAAGCTGG + Intergenic
1042159699 8:65880595-65880617 GAACTCAATGTTTCAATGGCTGG + Intergenic
1043207472 8:77464531-77464553 TAACCCAATGTATCAAAAGCTGG + Intergenic
1044864325 8:96555164-96555186 GAATACAATGGGTAAAAAACTGG - Intronic
1045670854 8:104551871-104551893 GATCTCACTGTGTCATAAATTGG - Intronic
1050019524 9:1268917-1268939 GAACTTAATGTGAGAAACACAGG + Intergenic
1050290196 9:4146102-4146124 GAACTGAATTTGACAAAATCAGG - Intronic
1053416948 9:37952840-37952862 AAACTTAATGTGTTCAAAACTGG - Intronic
1056507648 9:87272249-87272271 GAACTACATGTGACAAAAAGTGG - Intergenic
1061339647 9:129969453-129969475 TAAGTAAATGAGTCAAAAACTGG + Intronic
1062140237 9:134952668-134952690 GAACTCAATTTTTTAAAAAGGGG - Intergenic
1185556373 X:1024368-1024390 GAAATTAATGTTTTAAAAACCGG + Intergenic
1186603654 X:11065902-11065924 AATCTCCATGTGTCAAAAGCAGG + Intergenic
1188523250 X:31061428-31061450 GAACTCAATGATGCCAAAACTGG - Intergenic
1188697395 X:33212277-33212299 TAACTCAATGTCTAAAAAAATGG - Intronic
1189387146 X:40546356-40546378 TAACCCAATGTGTCCAAAATAGG + Intergenic
1189927478 X:45971994-45972016 GAACTCTATGTGCCAGACACAGG + Intergenic
1192200829 X:69065722-69065744 AAACTCAATGAGTCAGCAACCGG - Intergenic
1192661376 X:73046266-73046288 GAACATAATGTGACAGAAACAGG + Intergenic
1193134054 X:77949988-77950010 GAACACAATGAGACTAAAACAGG + Intronic
1197312420 X:124921490-124921512 TAACTCATTGTTTCAAAATCTGG + Intronic