ID: 1140598674

View in Genome Browser
Species Human (GRCh38)
Location 16:76447989-76448011
Sequence CTAGAAACAAAGATAGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 342}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140598674_1140598677 2 Left 1140598674 16:76447989-76448011 CCTTCTACTATCTTTGTTTCTAG 0: 1
1: 0
2: 2
3: 18
4: 342
Right 1140598677 16:76448014-76448036 TCAGAAGTGGTTGATCTTGATGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140598674 Original CRISPR CTAGAAACAAAGATAGTAGA AGG (reversed) Intronic
904173298 1:28607368-28607390 CTAGAAATAAAAATATTAGCTGG + Intronic
905998114 1:42399695-42399717 AAAGCAACAAAGATACTAGAAGG - Intronic
907205079 1:52762880-52762902 CTAGAAGAAAATATAGCAGAGGG - Intronic
907702751 1:56805257-56805279 CTAGGCACACAGAGAGTAGATGG + Intronic
907827904 1:58036608-58036630 CTCGAAAAAAAATTAGTAGAAGG - Intronic
908255345 1:62298996-62299018 ATAGTCACAAAGATAGTAAAAGG + Intronic
908320162 1:62971107-62971129 CTCGAAAGAAAGAAAGAAGAGGG + Intergenic
909183968 1:72461566-72461588 CTAAAAACACAAATATTAGAAGG + Intergenic
909716043 1:78707540-78707562 CTAAATACAAAGTTAGCAGAAGG + Intergenic
910021114 1:82590910-82590932 CTAAAAATAGAGATAGTACAGGG + Intergenic
911326758 1:96477542-96477564 CCTGAAACAAAGAAAGAAGAAGG - Intergenic
911372109 1:97006141-97006163 TTAGAAACAAGAAAAGTAGAGGG - Intergenic
912090044 1:106061110-106061132 CCAGACACAATGACAGTAGAAGG - Intergenic
912409440 1:109469928-109469950 CTAGAAAGCAAGAAAGCAGAGGG - Intronic
912684021 1:111747957-111747979 CCAGAAACAGCAATAGTAGAAGG - Intronic
914399060 1:147299234-147299256 CTAAACACAAAATTAGTAGAAGG + Intergenic
915769667 1:158407194-158407216 CTAGAAACAAAGTTAAGTGATGG + Intergenic
915830089 1:159120061-159120083 ATAGAAACAAAGAAATTAGGAGG - Intronic
916704091 1:167328946-167328968 ATAGAAACAAAGATTGCAGCTGG - Intronic
916851340 1:168707374-168707396 CTAGAATCTATTATAGTAGAGGG + Intronic
917097458 1:171413664-171413686 CTAAGACCAAAGTTAGTAGAAGG + Intergenic
917188034 1:172383561-172383583 CTAGAAACAAAGAGATTTTAAGG + Intronic
917338208 1:173947278-173947300 CTAAAAACACTGATAGTAAATGG + Intronic
917767577 1:178239128-178239150 CTAAAAACATAGATAGAATAGGG - Intronic
918683333 1:187383035-187383057 CTAGAAACAAAGATTAAATATGG + Intergenic
918746177 1:188203189-188203211 CTAGGAACAGAGATAGTTCAGGG - Intergenic
918896606 1:190356567-190356589 ATAGAAACAGAGATAAGAGAGGG - Intronic
918976150 1:191489178-191489200 TAAGAGACAAAGATAGTATATGG - Intergenic
919570202 1:199239162-199239184 CTAGAAACAAAAGCACTAGAGGG - Intergenic
921037032 1:211390248-211390270 CAATAAACAAAGAAAGTAAAAGG - Intergenic
921121495 1:212141425-212141447 CCAGAGCCAAAGATAGTAAATGG + Intergenic
921207828 1:212864092-212864114 CAAGAAGAAAAGTTAGTAGAGGG - Intronic
922253737 1:223873561-223873583 CCAAAAACAAAGAAAGTACAGGG + Intergenic
922541804 1:226426017-226426039 CTAGACACAAAGGTTGTCGAAGG + Intergenic
922609033 1:226910809-226910831 GTAGAATCCAAGATAATAGAAGG - Intronic
922812172 1:228423178-228423200 GTAGAAGCAATGATAGTAAAAGG - Intergenic
924748502 1:246861636-246861658 GTAAAAACAAAGATAAAAGAAGG + Intronic
924847502 1:247787948-247787970 CTAGAAACAAACATAGGTGTTGG + Intergenic
1063262757 10:4408796-4408818 CCAGGAACATAGATAGTAAACGG - Intergenic
1063745662 10:8877708-8877730 CTATATACAAAGATAGTTGTTGG + Intergenic
1064380963 10:14841322-14841344 CTAGAAAAAAGAATCGTAGATGG + Intronic
1065074991 10:22068967-22068989 CTAAACCCAAAGTTAGTAGAAGG - Intergenic
1068315417 10:55335742-55335764 CTAAAAACACAGTTAGAAGATGG + Intronic
1068979305 10:63044561-63044583 CAAAAAACAAAAAAAGTAGAAGG + Intergenic
1069016761 10:63438478-63438500 CTATCAACAAAGAAAGTAGAGGG + Intronic
1069366080 10:67694755-67694777 CTAGAAAAAAAAAGACTAGAAGG + Intronic
1069882275 10:71601173-71601195 CTAGAAACAATGCTTCTAGAAGG - Intronic
1070193542 10:74134165-74134187 CTAGAAACCAAAAAAGGAGAAGG + Intronic
1072007144 10:91263011-91263033 CTATAAACAAAGATGGAAGGGGG + Intronic
1072879359 10:99209587-99209609 CTAGGCCCAAAGTTAGTAGAAGG + Intronic
1072937919 10:99731282-99731304 TTAGAAACAAAGCTAGCAGAAGG - Intronic
1073001385 10:100288580-100288602 GTAGAAACCAAGAGAGTAGGCGG - Intronic
1074229696 10:111521711-111521733 CTAGAAAGTTAGAAAGTAGATGG - Intergenic
1074896150 10:117779234-117779256 CTCAAAACACAAATAGTAGAAGG - Intergenic
1076077506 10:127547106-127547128 CTAAAAACAAAGATTGAATAAGG - Intergenic
1076081335 10:127584146-127584168 ATGAAAACAAAGATTGTAGAAGG + Intergenic
1076102833 10:127796957-127796979 CTAGTCACAAAGCTAGTGGATGG - Intergenic
1078689708 11:13566890-13566912 CTAAACCCAAAGCTAGTAGAAGG - Intergenic
1079237883 11:18702537-18702559 CAAGTAACAAGGATAGAAGAGGG - Exonic
1079897495 11:26140033-26140055 TCATAAATAAAGATAGTAGAAGG + Intergenic
1080264532 11:30387700-30387722 CTATAAACAAAAAAAGAAGATGG - Intronic
1080716143 11:34802013-34802035 ACAAAAACAAAGATAATAGATGG - Intergenic
1081799179 11:45846180-45846202 TTAGAAACAAAGATGGAAGAGGG + Intergenic
1083520561 11:63307575-63307597 CTAAAACCAAAATTAGTAGAAGG - Intronic
1086611706 11:88764805-88764827 CTAAACCCAAAGATAGAAGAAGG + Intronic
1086974780 11:93119316-93119338 CTAGAAGCAACCATAATAGATGG + Intergenic
1087852997 11:103054870-103054892 CTAGAAAAAAACATAGTAGATGG + Intergenic
1089139599 11:116275275-116275297 ACAGAGAAAAAGATAGTAGACGG - Intergenic
1089739649 11:120573663-120573685 CTAGAAACAGAGAGAGCAGTGGG + Intronic
1092443459 12:8530351-8530373 CTAGAAATAATGATAGTTGTGGG - Intergenic
1093261627 12:16945112-16945134 CTATATACAAAAATAGTAGTTGG - Intergenic
1093758455 12:22878676-22878698 CTTGAAAAAAAAATAGTTGAGGG - Intergenic
1093914368 12:24784601-24784623 CTAGTAACAAAGATAAAAGGAGG + Intergenic
1094467343 12:30767328-30767350 CTAGAAACTAAAATAGTAGCTGG + Intergenic
1096437444 12:51606102-51606124 ATAAAAACAAAGATAATAGTTGG - Intronic
1097142335 12:56912487-56912509 ATAGAGACAAAGATTGTAGTGGG + Intergenic
1097322273 12:58239350-58239372 CTGGAAAAAAAGAGAGCAGAAGG - Intergenic
1097447916 12:59695817-59695839 ATTGAAACAAAGATATTGGATGG + Intronic
1097954654 12:65471070-65471092 CTGGAAACAGAGATGGTAGTTGG - Intronic
1099113748 12:78596634-78596656 CTATAACCAAAGATTGTTGAGGG - Intergenic
1102508083 12:113396634-113396656 CTAGAAACAAAGAAAAAGGAAGG - Intronic
1104281188 12:127379289-127379311 AGAGAAACAACGATAGCAGAAGG + Intergenic
1105969874 13:25418758-25418780 CTAGAATCAAATATCGCAGAAGG + Intronic
1106046552 13:26147301-26147323 CTAAAAACAAAGAGAGGTGATGG + Intronic
1106280679 13:28266177-28266199 CTAGAAGAAAATATAGCAGATGG - Intronic
1106527140 13:30551104-30551126 TTAGAAATCATGATAGTAGATGG - Intronic
1106757107 13:32832804-32832826 CTAGAAACAGAAATAAAAGAGGG - Intergenic
1107581748 13:41796679-41796701 CTAAACCCAAAGAAAGTAGATGG - Intronic
1107903178 13:45038554-45038576 CTAGAATCAAAGATGTTGGATGG + Intergenic
1108751827 13:53455628-53455650 AAAGAAACAAATATAATAGATGG - Intergenic
1109390720 13:61688428-61688450 CTAAACCCAAAGTTAGTAGAAGG + Intergenic
1109617393 13:64853215-64853237 CCAAAAACAAAAATAGTAGCTGG - Intergenic
1109786036 13:67176174-67176196 CAAGAAAGAAAGACAGAAGATGG + Intronic
1111752332 13:92349019-92349041 CTAAACACAAAGATAGGGGAAGG + Intronic
1112359903 13:98708068-98708090 ATATAAACAAAGATATTAAAAGG + Intronic
1112627645 13:101123838-101123860 CTAGTAATAAATCTAGTAGAAGG + Intronic
1113137311 13:107106829-107106851 CTAGGAACAAAATTAGTAGAAGG - Intergenic
1114944413 14:27661416-27661438 CTAGAAATAAAGCTAAAAGAGGG - Intergenic
1116737625 14:48713263-48713285 ATAGAAACAAAGATACTGTATGG + Intergenic
1116771905 14:49136075-49136097 ATGGGAACAAAGAGAGTAGAGGG + Intergenic
1118960720 14:70528320-70528342 CTAAAAAAGAAGATAGTAGATGG - Intronic
1119298881 14:73555046-73555068 CTAAAAAAAAAGAATGTAGAGGG + Intronic
1122167140 14:99835569-99835591 TTAGAAACGAAGAAAGGAGAAGG - Intronic
1123027780 14:105436315-105436337 CATGAAACAAAAATAGTAGAGGG - Intronic
1124608342 15:31189413-31189435 CTAAACTCAAAGGTAGTAGAAGG + Intergenic
1125340963 15:38674840-38674862 CTAGAAACAGACTTAGGAGAAGG - Intergenic
1126495447 15:49284985-49285007 GTAGAAATAGAAATAGTAGATGG - Intronic
1127160660 15:56181288-56181310 CAAGTAACAAAGAAAGTAAAGGG - Intronic
1127552452 15:60054201-60054223 CTAGAAACAAAGCAAGTGAAAGG + Intronic
1128124621 15:65183500-65183522 ACAGAAAGACAGATAGTAGATGG + Intronic
1128310694 15:66630334-66630356 CTAGACACAGAGATCCTAGAGGG - Intronic
1129009833 15:72405520-72405542 CTAGAGCCAAAGATGGAAGAAGG + Intronic
1134088744 16:11378033-11378055 CTAAACCCAAAGATAGGAGAAGG - Intronic
1134137567 16:11688480-11688502 CTAGATACAAAGAGAATAGCTGG + Intronic
1135718985 16:24798623-24798645 CTCCAAACCAAGACAGTAGATGG + Intronic
1135827632 16:25743665-25743687 CTAGAAATACAGAAATTAGATGG - Intronic
1137467747 16:48726313-48726335 CTAGAAACAGAGAGAGGAGGAGG - Intergenic
1138163794 16:54780827-54780849 ATAGAAACAAGCATACTAGAAGG + Intergenic
1138541806 16:57692448-57692470 CTAGACATAAAGATATTACAAGG + Intergenic
1140598674 16:76447989-76448011 CTAGAAACAAAGATAGTAGAAGG - Intronic
1141376568 16:83536273-83536295 ATAGTAAGAAAGATAGTACAAGG + Intronic
1143737737 17:8925043-8925065 ATAGATAGATAGATAGTAGATGG + Intronic
1143737746 17:8925204-8925226 ATAGATAGATAGATAGTAGATGG + Intronic
1143737751 17:8925291-8925313 ATAGATAGATAGATAGTAGATGG + Intronic
1143737755 17:8925375-8925397 ATAGATAGATAGATAGTAGATGG + Intronic
1144885544 17:18456355-18456377 CTAGCAACAAATATATGAGATGG + Intergenic
1145146675 17:20488016-20488038 CTAGCAACAAATATATGAGATGG - Intergenic
1146708092 17:35016826-35016848 CTAGATAGAAGTATAGTAGAAGG + Intronic
1150524628 17:65909154-65909176 CTAGAAACATAAATCATAGAAGG + Intronic
1153157263 18:2163684-2163706 ATATAATCAAAGATAGTGGAAGG - Intergenic
1153337416 18:3938856-3938878 CTGGAAACAAAGAAAGCAGGTGG + Intronic
1154322232 18:13363925-13363947 CAAGAAACAAGCATAGTACATGG - Intronic
1156314519 18:35955300-35955322 CTAAACACAAAGTAAGTAGAAGG + Intergenic
1156654696 18:39271440-39271462 CTAGAAACAGCAATAGGAGAAGG - Intergenic
1158819198 18:61139011-61139033 CTAGAAATAAATATGGGAGAGGG + Intergenic
1159588999 18:70311198-70311220 CTAGAATCTAAGATCCTAGAAGG + Intronic
1161023832 19:2025542-2025564 ATAGAAAGAAAGAGAGTGGAAGG - Intronic
1161433757 19:4249689-4249711 AAAGAAAGAAAGAAAGTAGAGGG - Intronic
926398196 2:12467455-12467477 AAAGAAAAAAAGAGAGTAGAAGG - Intergenic
926422264 2:12711681-12711703 CTAGAGAGAAAGAAAGTAGCTGG + Intergenic
926462806 2:13154045-13154067 CTAGAACCTAAGGTAGCAGATGG + Intergenic
927367277 2:22313053-22313075 CTGGAAACAAATATAGTCCAAGG - Intergenic
929755171 2:44758240-44758262 CCAGAAGCAAAGAAAGTAGATGG + Intronic
930438633 2:51378412-51378434 GTAGAAACAGAAAAAGTAGATGG + Intergenic
930549665 2:52816648-52816670 CTAGAAAAAAAGAGAGAAAAAGG - Intergenic
930661637 2:54060486-54060508 GAAGAAACAAAGACAGTAAAAGG - Intronic
931861230 2:66356569-66356591 CTTGAAACAAAGAAATTTGATGG - Intergenic
932022654 2:68103396-68103418 CTAGAAACAAAGATGAAAGGAGG - Intronic
932173068 2:69575128-69575150 ATAGAAAAAAAGATAATATATGG - Intronic
932638369 2:73413790-73413812 CTGGAAAAAAAGATAGCAAATGG - Intronic
932786103 2:74605209-74605231 CTAGAAATAAAGTTACTAGGAGG - Intronic
934509783 2:94928368-94928390 CTAGATAGAAAGTTAGTGGATGG - Intergenic
935033446 2:99344596-99344618 CTAGAAACACAAATATTAGCCGG - Intronic
935587662 2:104816311-104816333 CAAAAAACAAATACAGTAGATGG - Intergenic
936023657 2:109014819-109014841 CTACAAATAAAGATAGTAATAGG + Intergenic
936079066 2:109419823-109419845 CTAGAAACAACGACATCAGAAGG - Intronic
936289283 2:111207449-111207471 CTAGAAGCAAAGAGAATAAAGGG - Intergenic
936808710 2:116369758-116369780 CAAGAAACAAAGGAAGTAAATGG + Intergenic
937535744 2:122884589-122884611 TTAGAAACATAGACACTAGAAGG + Intergenic
937720618 2:125090953-125090975 CTAGAAAACAACATAGTGGAAGG + Intergenic
938049186 2:128151487-128151509 CAAAAGACAAAGATATTAGATGG - Intronic
938572129 2:132570416-132570438 CTAGAAGTAGATATAGTAGAGGG - Intronic
939239730 2:139542220-139542242 ATAAAAAAAAAGAAAGTAGAAGG - Intergenic
939633795 2:144557012-144557034 AAAGAAACAAAGAAAGTAAAGGG - Intergenic
940191823 2:151048885-151048907 CTAGAAAAAAAGATAGATAATGG + Intergenic
941223481 2:162814718-162814740 CTAGACACCATGATCGTAGAAGG - Intronic
942182919 2:173397412-173397434 TTAGAAACAAGTATAGTTGAGGG + Intergenic
945135334 2:206621489-206621511 CAAGCAACAAAGAAAGTAGAAGG + Intergenic
945499172 2:210547918-210547940 CTTGAAACAAAGATAGCTGTAGG - Intronic
946650573 2:221889140-221889162 CAAGAAACAAAGATGGGAGTGGG - Intergenic
946862018 2:224009246-224009268 CTAGCAACACAGAGACTAGAAGG - Intronic
946917040 2:224534033-224534055 CTAGAAACAAAAATATAAAAAGG + Intronic
1170894028 20:20398286-20398308 GTAGAAACCAAGAAAGCAGATGG + Intronic
1172547705 20:35774244-35774266 CTAAAAACAAAAAAATTAGACGG - Intronic
1172919010 20:38465767-38465789 CTAGAACCAAAGATAGTCCTTGG - Intergenic
1174288980 20:49493796-49493818 CTAGAAATAAAGCCATTAGAGGG + Intergenic
1174436019 20:50507589-50507611 CTAAAAACACAGAAAATAGATGG - Intergenic
1175614931 20:60389939-60389961 AAAGAAACAAAGAAAGGAGAAGG + Intergenic
1176900242 21:14432562-14432584 ATAGAAAGAAAAATAGTACATGG + Intergenic
1177853458 21:26376299-26376321 ATAGAAAAAAAAATACTAGAAGG - Intergenic
1185306938 22:50124158-50124180 CTAAACCCAAAGATAGCAGAAGG - Intronic
951430326 3:22598801-22598823 CTAAACCCAAAGCTAGTAGAAGG + Intergenic
951526239 3:23655737-23655759 CTAGAAACAGGGATGGAAGAAGG - Intergenic
951568132 3:24033273-24033295 CTAAGCACAAAGTTAGTAGAAGG - Intergenic
952431976 3:33232453-33232475 CAAGAAACAAAGAAAGCAGCAGG - Intergenic
953505291 3:43480260-43480282 CCAGAAATAAAGATAGAACATGG + Intronic
955324209 3:57997209-57997231 TTAGAAACAAAAATAGCAGTTGG - Intergenic
956475999 3:69621034-69621056 TTTGAAACTAGGATAGTAGAAGG - Intergenic
956885928 3:73559730-73559752 ATAAAAACATGGATAGTAGAAGG + Intronic
957441012 3:80247623-80247645 CTAGAAACAAACATAGAATACGG - Intergenic
957621636 3:82600902-82600924 GTTGAAACACAGATAGAAGAGGG - Intergenic
958001535 3:87756357-87756379 CTAAATCCAAAGAAAGTAGAAGG - Intergenic
958540134 3:95460637-95460659 ATAGAAACAAAGATAGAAACGGG + Intergenic
963023044 3:140890908-140890930 CTATAAACAAAGAAACAAGAGGG + Intergenic
965193716 3:165565937-165565959 GTAGAAACAGAAATAGCAGATGG + Intergenic
965297350 3:166966095-166966117 CTGAAATCAAAAATAGTAGAAGG - Intergenic
965688454 3:171330363-171330385 CTGCTAACAAAGATAGAAGAAGG + Intronic
966039148 3:175459480-175459502 CTAGAAACAATATTAGAAGAAGG + Intronic
966701703 3:182860902-182860924 CTACAAGCAAAGATAATAGAGGG - Intronic
968159304 3:196412344-196412366 CTAGAAACGCAAATAGTTGACGG + Intronic
968182891 3:196610245-196610267 CTAGATACCGAGATAGTATAAGG - Intergenic
971127719 4:23772588-23772610 AAAGAAACACAGCTAGTAGATGG + Intronic
971156461 4:24088359-24088381 CTAAAAAAAAAGAAAGAAGAAGG + Intergenic
971206770 4:24578266-24578288 GGAGAAGCAAAGATAGTTGATGG - Intronic
971573203 4:28240189-28240211 CTATAAACAAAACTATTAGAAGG + Intergenic
971867948 4:32196817-32196839 CTAGAGACAAGAATATTAGAAGG + Intergenic
972150793 4:36088100-36088122 CTAAAAACAAATATAGTAGTTGG - Intronic
972422289 4:38900013-38900035 ATAGAAACATAGATAACAGAAGG - Intronic
973261427 4:48168578-48168600 CCAGAAACAAAGAAGGTAGGTGG - Exonic
974131757 4:57765251-57765273 CCAGAATCTAAAATAGTAGAGGG + Intergenic
976855948 4:89605702-89605724 CTGAAAAAAAGGATAGTAGATGG + Intergenic
977080761 4:92524651-92524673 CAGGAAACTAAGAAAGTAGACGG - Intronic
977550911 4:98442469-98442491 CTAGAAACAAAGAATGCAGCAGG + Intronic
979752126 4:124291693-124291715 CTATAAACAAATATATTGGAAGG - Intergenic
981265954 4:142783548-142783570 CTAAAAACTAAGAGAGAAGAGGG - Intronic
981743069 4:148023381-148023403 CTCCAGACAAAGATTGTAGACGG - Exonic
982364871 4:154566466-154566488 CTAAAAACAAAGAAAATAGCAGG - Intronic
982512010 4:156294602-156294624 CTAGGGACAAAAATACTAGAAGG - Intergenic
982900424 4:160992875-160992897 ATAGAAATAAAGAAAGTACATGG + Intergenic
983622205 4:169773578-169773600 CTAAAAACAAAGAGAGTAAATGG - Intergenic
983666438 4:170189444-170189466 CTAGAAACAAAGAAGGAAAAGGG - Intergenic
984186433 4:176549119-176549141 CTATAAACAAAGAAACTAGTCGG - Intergenic
984680236 4:182599040-182599062 ATAGAAACAAAGAGAGAACAGGG - Intronic
984836339 4:184025507-184025529 CTTGAAGCATAGATAGAAGAAGG - Intergenic
985377620 4:189358303-189358325 ATAGTTACAAAGATAATAGATGG + Intergenic
986129726 5:4917724-4917746 CAAGAAACAGAGAAAGAAGAGGG + Intergenic
986976905 5:13405435-13405457 GTAGAAACTAAGATACAAGATGG + Intergenic
987689576 5:21249826-21249848 AAAGAAAGAAAGACAGTAGAAGG - Intergenic
987902138 5:24026329-24026351 CTAGAAAAAAATAGAGGAGATGG + Intronic
987947049 5:24623717-24623739 TCAGAAACAAAGCAAGTAGAAGG + Intronic
988268720 5:28986367-28986389 CTAGAAGCAAAGAAAGTTGGTGG + Intergenic
989700607 5:44259608-44259630 TTAGAATCAAATATAGGAGAGGG + Intergenic
990292795 5:54371286-54371308 CTAAACCCAAAGCTAGTAGAAGG - Intergenic
990816914 5:59795935-59795957 GAAGAAACAAAGAGAGAAGACGG + Intronic
991144586 5:63285543-63285565 CAAGAAAAAAAGAAAGTATATGG + Intergenic
991224201 5:64250380-64250402 CTAAACCCAAAGTTAGTAGAAGG + Intronic
991282057 5:64925896-64925918 CCATAAGCAAAAATAGTAGAAGG - Intronic
991617243 5:68509598-68509620 AGAGAAGCAAAGATAGGAGAAGG - Intergenic
992573416 5:78084202-78084224 CTAGAAAGACAGATATCAGATGG + Intronic
993204136 5:84858736-84858758 CCAAAAACAAAGCTAGCAGAAGG - Intergenic
993494536 5:88593079-88593101 ATAGAAAGAAAGATAGTACCTGG + Intergenic
993508205 5:88737321-88737343 CTATAAACAAATTTAGTAGGTGG - Intronic
993815919 5:92545640-92545662 CTGGAAACAAAGAGAGGAGATGG + Intergenic
994427373 5:99607672-99607694 AAAGAGACAATGATAGTAGAGGG + Intergenic
994450902 5:99941979-99942001 TGAGAAAAAAAGATAGAAGATGG + Intergenic
994966399 5:106678019-106678041 CTAGAAGAAAATCTAGTAGAAGG - Intergenic
995308026 5:110677330-110677352 ATTGAAACTAAGATAGCAGATGG - Intronic
995421350 5:111970662-111970684 CTAAAAACACAGAAAGTAGCTGG + Intronic
995500522 5:112800157-112800179 CAAGTAACTAACATAGTAGATGG + Intronic
996027320 5:118661260-118661282 CTAAGACCAAAGTTAGTAGAAGG - Intergenic
996276416 5:121672321-121672343 CTAGAAACATAGATGATAGCTGG + Intergenic
996870508 5:128187031-128187053 CTAGAAATAAAAACAGTTGAAGG - Exonic
996887161 5:128371080-128371102 TTAGAAAAAAAAATAGAAGAGGG - Intronic
997344562 5:133177851-133177873 GTAAAACCAAAGAAAGTAGAAGG - Intergenic
998058070 5:139096402-139096424 CTGGAACCAGAGACAGTAGACGG + Intronic
1000094248 5:157957224-157957246 GTAGAAACAGATTTAGTAGAGGG + Intergenic
1002908244 6:1468382-1468404 TTAGATACACAGAGAGTAGAGGG + Intergenic
1003735373 6:8872290-8872312 CTGGAAACAAAGATAAAACATGG - Intergenic
1003860076 6:10314924-10314946 CTAGAAATAAAGACAGTCTAGGG + Intergenic
1003993543 6:11513551-11513573 ACAAAAACAAAGAAAGTAGAAGG + Intergenic
1005067132 6:21829590-21829612 ATAGAAATAAAGAGATTAGAAGG - Intergenic
1005220274 6:23578791-23578813 CAAGAAAGAGAGATAGGAGATGG + Intergenic
1007848523 6:44781111-44781133 TTAGAAACAATGATAGGAAAGGG - Intergenic
1008016896 6:46530755-46530777 GTAGAAACAGAGCTAGTAAATGG + Intergenic
1009731152 6:67608876-67608898 CTAGTAAGAAAGATAGGACATGG + Intergenic
1010090235 6:71972146-71972168 CCAGAAGCCAAGGTAGTAGAGGG + Intronic
1010359218 6:74973245-74973267 CTGGAAACAAAGGAAGTAAATGG + Intergenic
1011161560 6:84396648-84396670 CTAGAACTACAGATAGAAGAGGG + Intergenic
1012464257 6:99500117-99500139 AAAGAAAAAAAGACAGTAGATGG - Intronic
1012827075 6:104160037-104160059 CTAGAAACACAGGTGGCAGAGGG + Intergenic
1013438351 6:110136686-110136708 TTTAAAACAAAGATAGGAGAAGG - Intronic
1013961297 6:115903742-115903764 CTAGAAACAACTATAATATAAGG + Intergenic
1014057571 6:117034054-117034076 CAAGAAACAAGGATAGAAGTAGG + Intergenic
1014170674 6:118275630-118275652 CAAGAAATATAGATAGTAGAGGG + Intronic
1015774793 6:136803075-136803097 CTAGAAGAAAACATAGCAGAGGG + Intergenic
1015956936 6:138608920-138608942 CTAGTAACCAACAGAGTAGATGG - Intronic
1016219890 6:141655169-141655191 CTAGAAACAAACATAGGTGTTGG - Intergenic
1016310977 6:142733283-142733305 TTAGAGATAAAGATAGTAAATGG + Intergenic
1016440348 6:144076837-144076859 ATAGAAATAAAAATAATAGAAGG - Intergenic
1016685213 6:146873496-146873518 CAACAAACAAAAATAGTAGAAGG - Intergenic
1017296425 6:152800655-152800677 TGAGAAAGAAAGCTAGTAGATGG + Intergenic
1017451920 6:154562293-154562315 CTAGAAGCAAAGAGAGGTGATGG - Intergenic
1017776178 6:157682557-157682579 ATGGAAACAAAAATAGTAAATGG + Intergenic
1017827075 6:158089566-158089588 ATTGAAAAAAAGATAGAAGATGG + Intronic
1018779140 6:167046293-167046315 CTAGAAAGAAAGAAAGAGGAAGG + Exonic
1021239885 7:18187372-18187394 CTAGAAAAGAAGATAGAATAGGG - Intronic
1021249113 7:18302728-18302750 CTAGAAACAAACCTTCTAGAAGG + Intronic
1022334673 7:29411378-29411400 ATAGACACAAAGATGGTAGCTGG - Intronic
1022777984 7:33547206-33547228 CTACTATCAAAGATAGCAGAAGG + Intronic
1023796025 7:43792956-43792978 CTGTAAACACAGATAGTGGAGGG + Intronic
1027157164 7:75776597-75776619 CAAGAAAGAAAGAAAGAAGAAGG + Intronic
1028004944 7:85553279-85553301 CTAGAAACACAGCTACTATATGG + Intergenic
1030501126 7:110360853-110360875 CTAAACCCAAAGTTAGTAGAAGG - Intergenic
1032983177 7:137308497-137308519 CGAAAAAGAAAGAAAGTAGATGG - Intronic
1036541986 8:9724121-9724143 CTAGAATCAAAGATTAAAGATGG - Intronic
1037709775 8:21346477-21346499 TTAGAAACCAAGACAATAGAGGG - Intergenic
1037939660 8:22942011-22942033 CTAGAAAGAAAGTAAGGAGATGG - Intronic
1038612287 8:29068263-29068285 CAAGAAAAGAAGATAGAAGACGG + Exonic
1038687107 8:29728697-29728719 CTAGAACCAGGGGTAGTAGAGGG + Intergenic
1039009864 8:33081548-33081570 TAAGAAGCAAAGTTAGTAGAAGG - Intergenic
1039031310 8:33312483-33312505 CTAGAAACAGAGATAGGAGAGGG - Intergenic
1039139412 8:34368788-34368810 CTAAAAACAAAGATTTTAGTGGG + Intergenic
1039339927 8:36636775-36636797 TTAGAAATAAAGTTTGTAGAGGG + Intergenic
1039407630 8:37326732-37326754 ATGGAAACAAAGAGAGGAGAGGG + Intergenic
1039852528 8:41382267-41382289 CTAGAAATAAAGATTATACAAGG + Intergenic
1040792111 8:51243629-51243651 AAAGAAAGAAAGAAAGTAGATGG + Intergenic
1040808243 8:51419807-51419829 CTAGAAAAAAAGAGAGAAGTGGG + Intronic
1041128011 8:54665389-54665411 CTAAAAACAAAGACAGTAGTTGG - Intergenic
1041178064 8:55217948-55217970 CAAACAACAATGATAGTAGAAGG + Intronic
1042520452 8:69706302-69706324 ATAAAAGCCAAGATAGTAGAGGG + Intronic
1043308483 8:78827732-78827754 CCAGAAACAAAGACACTACAAGG + Intergenic
1045006234 8:97919108-97919130 CTAGAAAAGAAGATAGTGGCAGG - Intronic
1048673985 8:136756062-136756084 CTAGAGACAGAAAGAGTAGAAGG - Intergenic
1049529046 8:143144460-143144482 ATAGAAAGATAGATAATAGATGG + Intergenic
1050846726 9:10230492-10230514 ATAGATACATAGATAATAGATGG - Intronic
1050901533 9:10954931-10954953 CAGAAAACAAAGAAAGTAGAAGG + Intergenic
1051723086 9:20059762-20059784 CTAAAACCAAAGCTAGCAGAGGG + Intergenic
1053655620 9:40215878-40215900 CTAGATAGAAAGTTAGTGGATGG + Intergenic
1053905983 9:42845099-42845121 CTAGATAGAAAGTTAGTGGATGG + Intergenic
1054351788 9:64023970-64023992 CTAGATAGAAAGTTAGTGGATGG + Intergenic
1054367738 9:64362108-64362130 CTAGATAGAAAGTTAGTGGATGG + Intergenic
1054528986 9:66160409-66160431 CTAGACAGAAAGTTAGTGGATGG - Intergenic
1054675355 9:67851848-67851870 CTAGATAGAAAGTTAGTGGATGG + Intergenic
1055009787 9:71552773-71552795 CTGGAAGCAAAGCTAGAAGACGG - Intergenic
1055497869 9:76873465-76873487 TTAGACACAAAGATTGAAGAGGG - Intronic
1055778204 9:79789685-79789707 CTAGAAAAAAAAAGACTAGAAGG - Intergenic
1055789494 9:79907833-79907855 CTAAAACCAAAGATAATAAAAGG + Intergenic
1056180908 9:84081311-84081333 TTAGAGAGAATGATAGTAGAAGG - Intergenic
1056185233 9:84128244-84128266 AAAGAAAGAAAGAAAGTAGATGG + Intergenic
1056504475 9:87245040-87245062 CTACCAACTAAGATATTAGAAGG - Intergenic
1056649061 9:88442303-88442325 CAAAAAAGGAAGATAGTAGAGGG - Intronic
1056663425 9:88561452-88561474 ATAGATAGATAGATAGTAGATGG - Intronic
1057634598 9:96752234-96752256 CTTAAACCAAAGATAGCAGAAGG - Intergenic
1057639590 9:96804958-96804980 CTAAAACCAAAGTTAGCAGAAGG + Intergenic
1058489668 9:105483493-105483515 CTTGAACCAAAGATAGTAAGGGG + Intronic
1059363613 9:113767969-113767991 CCACAAACAAGGATAGTACAGGG - Intergenic
1060674600 9:125501874-125501896 AGAGAAACACAGATAGTAGTAGG - Intronic
1060683937 9:125590933-125590955 CTAAAAACACAGAAAGTAGCTGG - Intronic
1203561554 Un_KI270744v1:62330-62352 CTAAAAATAAAAAAAGTAGATGG + Intergenic
1185695792 X:2193482-2193504 CTAGATACATAGATGATAGACGG - Intergenic
1187786339 X:22891504-22891526 GTAAAATCAAATATAGTAGATGG - Intergenic
1188321234 X:28739761-28739783 CTAGAAAGAGAGATAGCATATGG - Intronic
1188381780 X:29503380-29503402 CCAAAAACAAAATTAGTAGAAGG - Intronic
1189830434 X:44967321-44967343 CTAGATCCAAAGAGAGGAGAAGG - Intronic
1191097641 X:56690460-56690482 CTAAAAATAAAGATAATAAAAGG - Intergenic
1191100759 X:56724777-56724799 CTAAATACAAAGATAATAGGTGG + Intergenic
1191645275 X:63473280-63473302 CCAGAAACAAATATAATAAAAGG + Intergenic
1191874553 X:65782355-65782377 ATAAAACCAAAGATAGGAGAAGG - Intergenic
1192085065 X:68087833-68087855 CTAGAAACAAAGGTGGCAAAGGG + Intronic
1192099319 X:68247205-68247227 CTGCAAACAAAGATAGGATATGG - Intronic
1192793184 X:74404590-74404612 CTAAATACAAAGCTAGCAGAAGG + Intergenic
1193136836 X:77981123-77981145 ATAGAAAGAAAAATATTAGATGG - Intronic
1194827454 X:98580244-98580266 ACAAAAACAAAGATAATAGATGG - Intergenic
1196049773 X:111292658-111292680 GTGGAGACAAAGAAAGTAGATGG - Intergenic
1196163926 X:112517106-112517128 CTGAAAACAATAATAGTAGAGGG + Intergenic
1197013522 X:121595856-121595878 TTAGAAAGAAAGAAAGTAGAGGG + Intergenic
1197737999 X:129866936-129866958 ACAGAAACACAGAAAGTAGAGGG - Intergenic
1198539291 X:137619678-137619700 CTAGAGACATAGAAAGTGGATGG - Intergenic
1199255636 X:145715807-145715829 GTACAAACAATGATAGTTGAGGG - Intergenic
1199439488 X:147852417-147852439 TCAGAAACATAGAGAGTAGAAGG - Intergenic
1200311043 X:155077630-155077652 ATAGAGACCAAGATAGTAAATGG - Intronic
1201066450 Y:10100374-10100396 CTAGAAACAAAGAACTTAGCAGG + Intergenic
1201153680 Y:11110523-11110545 CTAGATAGAAAGTTAGCAGATGG + Intergenic