ID: 1140600799

View in Genome Browser
Species Human (GRCh38)
Location 16:76472780-76472802
Sequence CAACACTTACTGGGACTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 281}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140600799 Original CRISPR CAACACTTACTGGGACTTAC TGG Intronic
903284938 1:22270855-22270877 CAGCAATTACTGGTGCTTACAGG + Intergenic
904494175 1:30877490-30877512 CAAAACTTGCTGGGGCTTGCAGG + Intronic
905808112 1:40891590-40891612 TTATACTTACTGGGACCTACTGG + Intergenic
908094569 1:60723116-60723138 CAACACATACTGGGGCCTACTGG - Intergenic
908205415 1:61843071-61843093 CACCACTTCCTGGCACTCACTGG - Intronic
908981319 1:69962801-69962823 CAACACCCACTGGGGCCTACTGG + Intronic
909140856 1:71863424-71863446 CAACACACACTGGGACCTATTGG + Intronic
909178034 1:72384513-72384535 CAACACTTACTGGGGCCTATCGG - Intergenic
909230235 1:73079821-73079843 CAACACACACTGGGGCCTACTGG - Intergenic
912115334 1:106399928-106399950 CAACACTTCCTGTGAGTTATAGG - Intergenic
912404964 1:109429488-109429510 CAACACATACTGGGGCCTACTGG - Intergenic
913363682 1:118011549-118011571 CAACAGATACTGGGGCCTACTGG + Intronic
914401086 1:147320561-147320583 CAACACATACTGGGGCCTATGGG + Intergenic
915389517 1:155528864-155528886 CAACACACACTGGGGCTTATTGG - Intronic
915522021 1:156451955-156451977 CAACACTTCCTGGTACTTCCAGG - Intergenic
916054574 1:161059544-161059566 CAACTCTTACTGTGACCTTCTGG + Intronic
916195098 1:162215220-162215242 AGGCACTTCCTGGGACTTACGGG - Intronic
917589915 1:176465810-176465832 CAACACACACTGGGGCCTACCGG - Intronic
919302443 1:195788006-195788028 CAACACACACTGGGGCTTATTGG - Intergenic
919629667 1:199947988-199948010 CAACACATGCGGGGGCTTACCGG - Intergenic
920109003 1:203574021-203574043 CAACACACACTGGGGCCTACCGG - Intergenic
920632532 1:207666679-207666701 CAACACATACTGGGATCTATTGG + Intronic
920813764 1:209311585-209311607 CAACACACACTGGGACTTTTTGG + Intergenic
922384346 1:225067130-225067152 CAACACACACTGGGGCCTACTGG - Intronic
922396269 1:225204261-225204283 TAACACTTACTGTGATTTTCTGG - Intronic
922650847 1:227336995-227337017 CAACACACACTGGGGCCTACTGG + Intergenic
923031675 1:230253988-230254010 CAACAGTTACTGTGAATGACAGG - Intronic
923380961 1:233417359-233417381 CAAAACTTTCTGGGAATTAGAGG + Intergenic
923739821 1:236645096-236645118 CAACACACACTGGGGCCTACTGG + Intergenic
1063370703 10:5520767-5520789 CAACACACACTGGGGCTTACTGG - Intergenic
1063811609 10:9715702-9715724 CAACACACACTGGGGCCTACTGG + Intergenic
1064182656 10:13132406-13132428 CAACACTTAGTTTGTCTTACAGG + Intronic
1064906734 10:20355359-20355381 CAACACATACTGGGGCCTACTGG + Intergenic
1065169762 10:23014781-23014803 CAACACACACTGGGGCCTACTGG + Intronic
1065445696 10:25796020-25796042 CAACACATACTGGGGCCTATTGG + Intergenic
1065975483 10:30838224-30838246 CAACACACACTGGGGTTTACTGG + Intronic
1066197218 10:33112250-33112272 CAACACTTACTGGGACTTGTTGG - Intergenic
1066209708 10:33224732-33224754 CAACACACACTGGGACTTGTCGG - Intronic
1066307414 10:34159483-34159505 CAACATTTCTTGGGAGTTACAGG - Intronic
1067319344 10:45202989-45203011 CAACACATACTGGGGTCTACTGG - Intergenic
1068409508 10:56636583-56636605 CAACACTTACTGGGGCCTGTTGG - Intergenic
1068441589 10:57062384-57062406 CAACACACAGTGGGGCTTACTGG + Intergenic
1071063262 10:81599511-81599533 CAACACTCACTGGGGCCTATTGG + Intergenic
1072871885 10:99128658-99128680 CAACACATACTGGGGCCTGCTGG + Intronic
1073128432 10:101168080-101168102 CAACACATACTGGGGCTTGTTGG + Intergenic
1075385939 10:122055536-122055558 CAACACATACTGGGGCCTATTGG + Intronic
1077792803 11:5460217-5460239 CAACAGATACTGGGGCCTACTGG + Intronic
1078841771 11:15083285-15083307 CAACACACACTGGGGCTTATTGG + Intergenic
1080513149 11:32995192-32995214 CAACACTCACTGGGGCTTGTTGG - Intergenic
1080725056 11:34889648-34889670 CAATACACACTGGGACCTACTGG - Intronic
1082014291 11:47472802-47472824 CCCCAAGTACTGGGACTTACAGG + Intronic
1083015768 11:59452288-59452310 CAACACATACTGGGACCTTTTGG - Intergenic
1085599203 11:77839797-77839819 CAACACACACTGGGGCTTGCTGG + Intronic
1087376654 11:97351216-97351238 CAACACACACTGGGGCTTATTGG + Intergenic
1087378639 11:97376635-97376657 CAACACATACTGGGGCCTATTGG - Intergenic
1087552837 11:99673609-99673631 CAACACACACTGGGGCTTAGAGG - Intronic
1087848841 11:103004927-103004949 CAACACACACTGGGACCTATTGG + Intergenic
1088362651 11:109007294-109007316 CAACACATACTGGGGCCTATTGG + Intergenic
1090525750 11:127533542-127533564 CAACACACACTGGGGCTTATCGG + Intergenic
1093008107 12:14073102-14073124 CAAGTCTTACTGGCACATACTGG + Intergenic
1093281853 12:17204472-17204494 GAACACTCACTGGGACATCCTGG + Intergenic
1099603238 12:84768313-84768335 CAACACACACTGGGGCCTACTGG - Intergenic
1100591317 12:96032928-96032950 GAACACACACTGGGGCTTACTGG + Intronic
1101732930 12:107441438-107441460 CAACACATACTGGGGCCTATTGG + Intronic
1102840741 12:116117930-116117952 CCCCACTTTCTGGGAGTTACAGG + Intronic
1103748968 12:123146132-123146154 TAACACACACTGGGACTTATTGG + Intronic
1104051496 12:125197167-125197189 CAACACACACTGGGGCCTACAGG - Intronic
1104213180 12:126710279-126710301 CAACACACACTGGGGCCTACTGG - Intergenic
1105930560 13:25047984-25048006 CAAGACACACTGGGACCTACTGG - Intergenic
1105994058 13:25653428-25653450 CAACAGACACTGGGGCTTACTGG + Intronic
1106540460 13:30685629-30685651 AAACACTCAGTGGCACTTACTGG - Intergenic
1106732424 13:32555348-32555370 CAACACACACTGGGGCCTACCGG + Intergenic
1107262714 13:38514377-38514399 CAACACTCACTGGGGCCTATTGG - Intergenic
1107813019 13:44218312-44218334 CAACAGAAACTGGGACTGACAGG + Intergenic
1109191071 13:59324986-59325008 CAACACACACTGGGGCCTACAGG + Intergenic
1110041682 13:70767869-70767891 CAACACACACTGGGGCTTAGCGG + Intergenic
1110258794 13:73461683-73461705 CAACACATACTGGGGCCTATTGG + Intergenic
1110825740 13:79969621-79969643 CAACACACACTGGGGCCTACTGG - Intergenic
1110829747 13:80017495-80017517 CAACACACACTGGGGCTTGCTGG + Intergenic
1111082151 13:83324621-83324643 CAACACACACTGGGACTTTTTGG + Intergenic
1112274376 13:98002589-98002611 AAATATTTACTGGTACTTACAGG - Exonic
1113705786 13:112432235-112432257 CCACACTTTCTGGGGCTTGCTGG + Intronic
1115653667 14:35422567-35422589 CGCCACCTACTGGGACTTAGTGG + Intergenic
1115714128 14:36083800-36083822 CAATACATACTGGGAACTACTGG - Intergenic
1115940563 14:38603768-38603790 CAACAAATACTGGGGCTTATTGG - Intergenic
1116161839 14:41277089-41277111 CAACACACACTGGGACCTATTGG + Intergenic
1116355170 14:43919267-43919289 CAACACACACTGGGGCCTACTGG - Intergenic
1116809986 14:49530129-49530151 CAACACACACTGGGGCCTACTGG + Intergenic
1117831332 14:59754185-59754207 CAACACATATTGGGATTTAATGG - Intronic
1117851066 14:59970127-59970149 CAACAGATACTGGGGCCTACTGG - Intronic
1118085342 14:62408527-62408549 CTTCAGTTACTGGGAATTACTGG + Intergenic
1119308522 14:73627521-73627543 AAACACTTACTTCCACTTACTGG + Intergenic
1120840642 14:89082205-89082227 CAACACACACTGGGACCTACAGG - Intergenic
1122252536 14:100449939-100449961 GAAGAATCACTGGGACTTACAGG - Intronic
1123670095 15:22647866-22647888 CAAAACACACTGGGACCTACTGG + Intergenic
1124228835 15:27922977-27922999 CAACACACACTGGGGCCTACTGG - Intronic
1124526069 15:30454282-30454304 CAAAACACACTGGGACCTACTGG + Intergenic
1124681558 15:31736038-31736060 CAACACACACTGGGGCCTACTGG + Intronic
1124772585 15:32553403-32553425 CAAAACACACTGGGACCTACTGG - Intergenic
1125087083 15:35742715-35742737 CAACAGACACTGGGACCTACTGG - Intergenic
1126236888 15:46396073-46396095 CAACACATACTGGGGCTTCTTGG + Intergenic
1127375360 15:58379490-58379512 CAACACACACTGGGGCTTATTGG - Intronic
1127496159 15:59514054-59514076 CAACACATACTGGGGCTTGGGGG + Intronic
1127813971 15:62590322-62590344 CAACACACACTGGGGCCTACTGG - Intronic
1128064952 15:64758775-64758797 TATCACTTACTGGCACTTCCTGG + Intronic
1130424585 15:83782700-83782722 CAACATTCACTGGGACATATTGG + Intronic
1132290850 15:100702946-100702968 CCACTCTTGCTGGGCCTTACAGG - Intergenic
1133150925 16:3829431-3829453 CAACACCTCCTAGGGCTTACTGG + Intronic
1133905563 16:10019032-10019054 CAACACTTCCTTGGACTTATTGG - Intronic
1135658484 16:24273009-24273031 CAACACACACTGGGGCCTACTGG - Intronic
1137879412 16:52031111-52031133 CGACCCTTGCTGGGACTGACTGG - Intronic
1138700617 16:58858931-58858953 CAACACACACTGGGGCCTACTGG + Intergenic
1138882498 16:61032558-61032580 CAACACACACTGGGGCCTACTGG + Intergenic
1140269069 16:73446711-73446733 CAACATATACTGGGGCCTACCGG + Intergenic
1140600799 16:76472780-76472802 CAACACTTACTGGGACTTACTGG + Intronic
1141423751 16:83932682-83932704 GAACACGTGCTGGGACTTATCGG + Intronic
1144379888 17:14684222-14684244 CAACACACACTGGGACCTGCTGG - Intergenic
1147292591 17:39455962-39455984 CAACACTTACTATGGCTGACTGG + Intergenic
1147502465 17:40978820-40978842 CAACACGTACTGGGGCCTGCTGG - Exonic
1147903868 17:43810066-43810088 AAACACTCATTTGGACTTACAGG - Intronic
1148670074 17:49403764-49403786 CACTACTCACTGGGAGTTACAGG - Intronic
1149228090 17:54499059-54499081 GAACACTTACTGGGGCCTGCTGG + Intergenic
1149890776 17:60388871-60388893 TAACACTTACTGGGCCTGAGTGG - Intronic
1150074987 17:62184727-62184749 CAACACACACTGGGGCTTATTGG + Intergenic
1153193189 18:2565322-2565344 CAACAGATACTGGGGCCTACTGG + Intronic
1154254422 18:12770157-12770179 CAACACTGAGTGGGCCTCACTGG + Intergenic
1155562424 18:27093147-27093169 CAGCCCCTACTGGGACCTACTGG + Intronic
1158307721 18:56125047-56125069 CAACACTTACTGGGGCCTATTGG - Intergenic
1162343148 19:10104372-10104394 CAACACTACATGGAACTTACTGG - Intergenic
1164229020 19:23271599-23271621 CAACACATACTGGGGCCTATCGG - Intergenic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
1166433053 19:42742346-42742368 CCACACAGACTGGGACTCACGGG - Intronic
1166436154 19:42767572-42767594 CCACACAGACTGGGACTCACGGG - Intronic
1166465691 19:43028336-43028358 CCACACAGACTGGGACTCACGGG - Intronic
1166482964 19:43188356-43188378 CCACACAGACTGGGACTCACGGG - Intronic
1167790069 19:51670281-51670303 CAACACACACTGGGGCCTACTGG + Intergenic
929542258 2:42831375-42831397 CCACACTTACAGGTACTCACTGG + Intergenic
930536653 2:52652590-52652612 CAACACCTACTGGGCCTATCTGG - Intergenic
930580639 2:53207394-53207416 CAACACACACTGGGGCTTATTGG + Intergenic
930595048 2:53377362-53377384 CAACACACACTGGGGCCTACTGG + Intergenic
930951891 2:57152856-57152878 CAACACTTACTGGGGCCTGTTGG + Intergenic
932243348 2:70175358-70175380 CAACACACACTGGGGCTTATTGG - Intronic
933335122 2:80948330-80948352 CAACACATACTGGGGCCTACTGG + Intergenic
933415506 2:81982315-81982337 CAACAACTTCTGGGAGTTACAGG + Intergenic
935249915 2:101252546-101252568 CAGCACTTACTGGGACCGTCTGG + Intronic
935488972 2:103694045-103694067 CAACACTTACTGGGGCTGTTGGG - Intergenic
936792878 2:116170629-116170651 CAACACACACTGGGGCTTATTGG - Intergenic
938409098 2:131049069-131049091 CAGCACTCACTGGCACTCACAGG + Exonic
939883965 2:147660960-147660982 AAACACTTACTTGCATTTACTGG + Intergenic
940094411 2:149958107-149958129 CAACACACACTGGGACCTATCGG - Intergenic
941073001 2:160975734-160975756 CAACACTCACTGGGACCTGTCGG - Intergenic
941221972 2:162793274-162793296 CAACACACACTGGGACCTATTGG + Intronic
944167318 2:196736673-196736695 CAACACACACTGGGACCTATAGG - Intronic
944293082 2:198030178-198030200 CAACATATACTGTGACCTACTGG - Intronic
944360830 2:198854253-198854275 CAACACACACTGGGACCTACTGG + Intergenic
945139833 2:206673095-206673117 CAACACACACTGGGGCCTACTGG - Intronic
945639669 2:212408254-212408276 CAACACACACTGGGACCTATTGG - Intronic
945691317 2:213040347-213040369 CAACACATACTGGGGCCTATTGG - Intronic
946129258 2:217593172-217593194 CAACAATAACTATGACTTACTGG + Intronic
947106674 2:226675041-226675063 CAACATACACTGGGACTTAACGG + Intergenic
948827707 2:240581003-240581025 CTACTCTAACTGGGACTTATTGG + Exonic
1168744443 20:226235-226257 CAACACACACTGGAGCTTACTGG + Intergenic
1170131543 20:13025895-13025917 CAACACACACTGGGACCTAATGG - Intronic
1172869913 20:38129601-38129623 CCACACTTGCTGGGGCTCACGGG - Exonic
1177338294 21:19762339-19762361 CAACACACACTGGGACCTACCGG - Intergenic
1177550416 21:22613874-22613896 CAACACACACTGGGGCCTACTGG + Intergenic
1178475874 21:32936743-32936765 GGCCACTTACTGGGAGTTACTGG + Intergenic
1181999089 22:26905494-26905516 CAACACGCACTGGAACTTATCGG + Intergenic
949125251 3:439436-439458 CAACACACACTGGGACCTGCTGG + Intergenic
949249116 3:1961401-1961423 CAATAGTAACTGGAACTTACAGG + Intergenic
949316529 3:2762377-2762399 CAACAGATACTGGGACCTATCGG - Intronic
951750844 3:26034752-26034774 CAACACACACTGGGGCCTACTGG + Intergenic
953181979 3:40604335-40604357 CAACACACACTGGGACCTACTGG + Intergenic
955923558 3:63983515-63983537 CCCCACTAGCTGGGACTTACAGG - Intronic
956814555 3:72896246-72896268 TAACACTTGCTGGGAGTTTCTGG - Intronic
958069486 3:88591860-88591882 CAACACGCACTGGGGCTTATTGG + Intergenic
958587552 3:96109405-96109427 AAACAATTACTGGAAATTACAGG + Intergenic
959019914 3:101177696-101177718 CAACACACACTGGGGCCTACTGG - Intergenic
959326724 3:104946183-104946205 CAACACACACTGGCACCTACTGG - Intergenic
963019888 3:140863122-140863144 CAACACACACTGGGACCTATCGG + Intergenic
964266216 3:154898478-154898500 TAACACTGTCTGGCACTTACTGG + Intergenic
965033567 3:163405373-163405395 CAACACATACTGGGGCCTATTGG - Intergenic
966228624 3:177625980-177626002 CAACACACACTGGGGCCTACCGG - Intergenic
966647776 3:182266079-182266101 CAACACACACTGAGACCTACTGG + Intergenic
966700014 3:182839255-182839277 CAACACACACTGGGGCATACTGG + Intronic
969036495 4:4258043-4258065 CAACACACACTGGGGCCTACTGG + Intergenic
969835770 4:9839804-9839826 CAACACACACTGGGGCTTACTGG + Intronic
970047019 4:11866048-11866070 CAACACACACTGGGGCCTACCGG + Intergenic
970531866 4:16993082-16993104 GAACACTTTCTGGAACTTTCTGG + Intergenic
971624426 4:28899772-28899794 CAACACACACTGGGGCCTACTGG + Intergenic
971856069 4:32045147-32045169 CAACACACACTGGGGCTTATTGG - Intergenic
972168141 4:36312172-36312194 AAACACTTCCTGGCACTTTCTGG - Intronic
974872286 4:67658527-67658549 CAACACGCACTGGGGCCTACTGG + Intronic
975551432 4:75616932-75616954 CAACACACACTGGGGCCTACCGG + Intronic
977083804 4:92568736-92568758 CAACAGACACTGGGACCTACTGG - Intronic
977594204 4:98860277-98860299 CAATCCTAACTGGGACTTAGTGG - Intergenic
977980457 4:103314731-103314753 CAACACACACTGGGTCTTATTGG - Intergenic
977999780 4:103543342-103543364 CAACACATACTGGGACCTGTTGG + Intergenic
978036800 4:104004882-104004904 CAACACATACCGGGGCCTACTGG + Intergenic
978648150 4:110966731-110966753 CACCACTTACTGGGAGTTTGTGG + Intergenic
978900263 4:113940467-113940489 CAACACACACTGGGACCTATAGG + Intronic
978924075 4:114221289-114221311 CAACAGACACTGGGACCTACTGG + Intergenic
983441475 4:167791958-167791980 CAACACACACTGGGGCCTACTGG - Intergenic
983981940 4:174008506-174008528 CAACACACACTGGGGCCTACTGG - Intergenic
985932696 5:3071119-3071141 CAACACACACTGGGACCTATTGG - Intergenic
987010384 5:13756869-13756891 CAACACACACTGGGGCCTACTGG - Intronic
988871066 5:35390554-35390576 CAACACGTACTGGGACCTATGGG + Intergenic
989291081 5:39766852-39766874 CAACACACACTGGGACCCACTGG - Intergenic
989784464 5:45310991-45311013 CAACACATACTGGGGCCTATCGG + Intronic
989822070 5:45804992-45805014 CAACACACGCTGGGACTTATTGG - Intergenic
990291496 5:54356431-54356453 CAACACACACTGGGGCCTACTGG + Intergenic
990425625 5:55685795-55685817 CAACACACACTGGGGCTTACTGG - Intronic
990675581 5:58181142-58181164 CAACACACACTGGGGCTTATTGG + Intergenic
991954517 5:71979376-71979398 GAACACTTCCTGGAACTTAGGGG + Intergenic
993921088 5:93803531-93803553 CAACACATACTGGGGCCTATTGG + Intronic
994469942 5:100190724-100190746 CAACACACACTGGGGCCTACTGG - Intergenic
995578453 5:113568537-113568559 CAACACACACTGGGGCCTACTGG - Intronic
995691853 5:114835389-114835411 CAACACACACTGGGGCTTATTGG + Intergenic
996174927 5:120344646-120344668 CAACACACACTGGGACATATTGG + Intergenic
996932839 5:128911245-128911267 CAACACTCACTGGGGCCTGCTGG - Intronic
997311618 5:132889484-132889506 CAACATTTATTGGTAGTTACTGG + Intronic
998595660 5:143527306-143527328 CAACACACACTGGGGCCTACTGG + Intergenic
999887125 5:155936383-155936405 GAACACTCACTGGGACATTCTGG - Intronic
1000412687 5:160950065-160950087 AAAGACTCACTGGAACTTACAGG + Intergenic
1000588477 5:163129279-163129301 CAACAGATACTGGGGCCTACTGG + Intergenic
1000737429 5:164922804-164922826 CAACACATACTGGGGCCTACTGG - Intergenic
1000774801 5:165406331-165406353 CAACACACACTGGGGCCTACTGG - Intergenic
1001012638 5:168112388-168112410 AAACACATACTGGGACCTTCTGG - Intronic
1003032480 6:2614186-2614208 CAACAGACACTGGGACCTACTGG - Intergenic
1003634043 6:7815129-7815151 CAAGAATTCCTGGGACTTAAAGG + Intronic
1003826067 6:9953492-9953514 CAACACTCACTGGGGCCTATTGG - Intronic
1005009246 6:21320625-21320647 CATCACATACTGGGGCTTGCCGG + Intergenic
1005220669 6:23584847-23584869 CAACACTTTCTGAGAGTTAGAGG + Intergenic
1006217958 6:32461539-32461561 CAACACTTACTGGGGTCTGCTGG - Intergenic
1009382055 6:63043996-63044018 CAACACACACTGGGGCTTATGGG - Intergenic
1009754447 6:67918514-67918536 CAACACACACTGGGGCTTACTGG + Intergenic
1010252602 6:73723719-73723741 CAACACACACTGGGGCCTACTGG + Intronic
1010619489 6:78056479-78056501 CAACACATACTGGGGCCTATTGG - Intergenic
1012232334 6:96774879-96774901 CAACACATACTGGGGCCTATGGG + Intergenic
1015558359 6:134486321-134486343 CAACACTTACTGGGGCCTGTTGG - Intergenic
1017235049 6:152110504-152110526 CAACACATACTGGGGCCTATCGG + Intronic
1017807599 6:157959526-157959548 AAACAATTCCTGGGACTCACAGG - Intergenic
1018158194 6:161009841-161009863 CAACACTTACTGGGGCCTGTCGG + Intronic
1018273167 6:162102201-162102223 CAACACACACTGGGGCCTACTGG - Intronic
1020750357 7:12133175-12133197 CAACACTCACTGGGGCCTATTGG + Intergenic
1022764413 7:33394378-33394400 CAACACACACTGGGGCCTACTGG + Intronic
1023318077 7:38961654-38961676 CAACAGACACTGGGGCTTACTGG + Intergenic
1023531058 7:41154875-41154897 CAACACTTACTGGGGCCTGTCGG - Intergenic
1023590257 7:41774001-41774023 CAACACATACTGGGGCCTATTGG + Intergenic
1024903145 7:54345443-54345465 CAACAATTCCAGGGAATTACTGG - Intergenic
1026413169 7:70148058-70148080 AAACACTTACAGGGAATTAAAGG - Intronic
1028046155 7:86121653-86121675 CAACACATACTGGGGCCTGCTGG + Intergenic
1028147727 7:87336897-87336919 CAACACATACTGGGACCTTTTGG - Intergenic
1028951636 7:96643115-96643137 CAACACACACTGGGACCTATTGG - Intronic
1029143374 7:98428198-98428220 CAACAAAAACAGGGACTTACAGG - Intergenic
1033508715 7:142032897-142032919 CAAGACTTACTGGGAGTGAATGG - Exonic
1033921013 7:146391815-146391837 CAACACACACTGGGACTTTTTGG + Intronic
1035651881 8:1272820-1272842 CAACAGTGACAGGGACTTGCAGG - Intergenic
1036403672 8:8433669-8433691 CAACACTTACTGGGGTTTTCAGG - Intergenic
1039018625 8:33181122-33181144 CAACACACACTGGGGCCTACTGG - Intergenic
1039251553 8:35670686-35670708 CAACACATACTGGGGCTTGTTGG + Intronic
1040557699 8:48495937-48495959 GAACACTTGCTGGAGCTTACAGG + Intergenic
1043168965 8:76940000-76940022 CAACACATACTGGGGCCTATTGG + Intergenic
1044001145 8:86882998-86883020 CAACATACACTGAGACTTACTGG + Intronic
1044994600 8:97827491-97827513 AAACACTTACTGAGGTTTACTGG - Intronic
1045618211 8:103942157-103942179 TAACACGTACTGGGGCCTACCGG - Intronic
1045728164 8:105200466-105200488 CAACACTCACTGGGCCTGTCAGG - Intronic
1046983621 8:120363399-120363421 CAACACATACTGGGACCTGTTGG + Intronic
1047870408 8:129076121-129076143 CAACACACACTGGGGCCTACTGG + Intergenic
1047917551 8:129598838-129598860 CAACACACACTGGGGCCTACCGG - Intergenic
1047936029 8:129779429-129779451 CAACACACACTGGGGCCTACTGG + Intronic
1048929343 8:139298725-139298747 CAACACACACTGGGGCCTACTGG - Intergenic
1051115706 9:13691993-13692015 CAACACATACTGGGGCCTATTGG - Intergenic
1051320111 9:15894254-15894276 CAACACATACTGGGGCTTGTTGG + Intronic
1051498622 9:17752873-17752895 CAACACACACTGGGACCTATTGG - Intronic
1051998983 9:23253182-23253204 CAACACCCACTGGGGCTTGCTGG + Intergenic
1052221939 9:26034943-26034965 CAGAATTTACTGGAACTTACCGG - Intergenic
1054841460 9:69745691-69745713 CATCACTTACTGGGAATTCTTGG + Intronic
1055208772 9:73763975-73763997 CAACACATCCTGGGACCTATTGG + Intergenic
1058332863 9:103785851-103785873 CAACACACACTGGGACCTATTGG + Intergenic
1058603006 9:106691401-106691423 CAACACATACTGGGACCTGTCGG + Intergenic
1058738429 9:107918755-107918777 CACCAGTAACTGGGACTAACTGG - Intergenic
1060342642 9:122790493-122790515 CAACACACACTGGGGCTTATCGG + Intergenic
1185949240 X:4412770-4412792 CAACACACACTGGGACCTAATGG + Intergenic
1186237602 X:7530494-7530516 CAACACACACTGGCACTTATTGG + Intergenic
1187440062 X:19310301-19310323 CATGAGTAACTGGGACTTACAGG - Intergenic
1187796640 X:23010977-23010999 CAACACATACTGGGGCTTTTTGG - Intergenic
1188081017 X:25840705-25840727 CAACAGATACTGGGGCCTACTGG + Intergenic
1190600142 X:52083392-52083414 CAACACACACTGGGGCCTACTGG - Intergenic
1190639851 X:52473881-52473903 CATCACTCACTGGGGCGTACTGG - Intergenic
1190647821 X:52538984-52539006 CATCACTCACTGGGGCGTACTGG + Intergenic
1191591867 X:62894619-62894641 CAACAGTCACTGGGACCTATTGG - Intergenic
1191766064 X:64699422-64699444 CAACACTTACTGGGGCCTGTTGG - Intergenic
1191819771 X:65292454-65292476 CAACATACACTGGGGCTTACTGG + Intergenic
1192293359 X:69821221-69821243 CAACACACACTGGGGCCTACTGG + Intronic
1192383121 X:70637739-70637761 CAACACATACTGGGGCTTGCTGG + Intronic
1193975283 X:88110767-88110789 CAACACATACTGGGGCTTGTTGG - Intergenic
1195117914 X:101718265-101718287 AAACACTTACTTACACTTACTGG - Intergenic
1196553322 X:117056797-117056819 CACCACTTACTGTGATTTCCCGG + Intergenic
1197146272 X:123175919-123175941 CAACACTTAGTTGGACTCAAGGG - Intergenic
1199376362 X:147114706-147114728 CAACACACACTGGGACCTATTGG + Intergenic
1200321027 X:155189825-155189847 CAACACACACTGGGACCTGCAGG - Intergenic
1201456778 Y:14176898-14176920 CAACACACACTGGCACGTACTGG + Intergenic