ID: 1140601045

View in Genome Browser
Species Human (GRCh38)
Location 16:76475264-76475286
Sequence AAACTCTGCTCCCCAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140601045 Original CRISPR AAACTCTGCTCCCCAAAGAT AGG Intronic
900376417 1:2356893-2356915 CAACTCTGCCCCCCAAGGCTGGG - Intronic
902154190 1:14470639-14470661 AAACTCTGCTCAACAGAGAAAGG - Intergenic
904017193 1:27431171-27431193 CACCTCTGCACCCCAAAGATAGG - Intronic
904733643 1:32613597-32613619 AAACTCTGATCCCCAAATACTGG + Intronic
907307148 1:53519754-53519776 AAACTCTGTGGCCCAGAGATGGG - Intronic
907827394 1:58032055-58032077 AAACTCTGCTTCTCAAAGTGTGG + Intronic
908438473 1:64130353-64130375 AAACTCTGCTTTCTAAAGACCGG - Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909281968 1:73768244-73768266 AAATGGTTCTCCCCAAAGATAGG + Intergenic
910822406 1:91365761-91365783 AAACTCTGCTACCCACTGTTAGG + Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
913408650 1:118525820-118525842 TAGCCCTACTCCCCAAAGATGGG - Intergenic
915036806 1:152934643-152934665 AAAATCTGCTCACAAAAGAATGG - Intergenic
915624721 1:157107551-157107573 AGGCTCTCCTCCCCCAAGATGGG - Intergenic
915689299 1:157672486-157672508 CAACTCTGCCTCCCAAAGTTCGG + Intergenic
917041034 1:170806699-170806721 AAACTCTGCTACCAAAGGAAAGG - Intergenic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920223327 1:204420419-204420441 AATCTTTGCTCCCCAAATCTCGG + Intergenic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
921159832 1:212464993-212465015 AAACACAGCTCCCCCAAGACAGG + Intergenic
922190342 1:223313319-223313341 AAACTCTGGACACCAAAGCTTGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923709046 1:236370520-236370542 AAACTCTGTTCCCCAAATGCTGG - Intronic
1063583446 10:7330095-7330117 AATCTCGGCTGCCCAAAGATTGG + Intronic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1064908407 10:20372606-20372628 AATCTGTTCCCCCCAAAGATGGG + Intergenic
1064976986 10:21126995-21127017 AAACTCCACTGGCCAAAGATGGG + Intronic
1064980536 10:21162105-21162127 AAACTCTGGATACCAAAGATTGG + Intronic
1065615869 10:27522504-27522526 AAACTCTCCTATCAAAAGATTGG - Intronic
1066500594 10:35990226-35990248 AAATTCTGCTCTTCAAAAATGGG + Intergenic
1066628487 10:37434481-37434503 AAATTCTGCTCTTCAAAAATGGG + Intergenic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1068147498 10:53089821-53089843 AGAATCTGCTCCTCAAATATAGG - Intergenic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1068753548 10:60624323-60624345 AAACTCTGCACACCAAGGCTTGG + Intronic
1068985463 10:63104176-63104198 AAACTCGGATCCCCAATGCTGGG - Intergenic
1069095671 10:64256832-64256854 AGACACTGCTCCTCAAAGAGCGG - Intergenic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1071278708 10:84079814-84079836 AAACTTTGCTTCCCAAGGGTCGG - Intergenic
1073549134 10:104381206-104381228 GAACTCAGCTCCCCAATGTTTGG - Intronic
1073815060 10:107197418-107197440 AATCTCTTCTCCCTAAGGATGGG + Intergenic
1074274274 10:111986726-111986748 AATTTCTGCTCCCCTAAGAGAGG + Intergenic
1074628204 10:115218278-115218300 AAACTCTGCTCCACGAAGACAGG + Intronic
1075625071 10:123958130-123958152 AAAATCTTCTCCACAAATATTGG - Intergenic
1076172083 10:128327566-128327588 AAACTCTGCTCCCAGAAGTGTGG + Intergenic
1077544607 11:3164013-3164035 AAACTCTGCTCCCCAACCCCAGG - Intronic
1077831188 11:5872570-5872592 AAACTCTGAACACCAAAGCTTGG + Intronic
1078123452 11:8534365-8534387 CCACTCTACTCCCCAAAAATAGG + Intronic
1078591323 11:12642650-12642672 AACCTCTGCCCCCCAAAAATTGG + Intergenic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1078900248 11:15635347-15635369 AAAGACTGCTCCCCAAAGGCCGG - Intergenic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1079759114 11:24306781-24306803 ACACACTGCTCCCAAATGATGGG - Intergenic
1080014732 11:27492303-27492325 GAACTGTGTTCCCCTAAGATAGG - Intergenic
1081861143 11:46333937-46333959 AGACCCTGCTGCCCAGAGATGGG + Intronic
1082272451 11:50186203-50186225 AAACTCTGATCCCCAAATACTGG - Intergenic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1083156452 11:60826296-60826318 AAACCCTACTCCCAAAAGCTGGG - Intergenic
1085416770 11:76323702-76323724 AAACTCTGCTCCCCAATGCCTGG + Intergenic
1087601690 11:100325116-100325138 AAAATGTGCTCCCCACATATAGG + Intronic
1092579314 12:9821186-9821208 ATCCTCTGCTCCCCAAAAAGTGG + Intergenic
1092584976 12:9890382-9890404 AACCTCAGCTCTCGAAAGATGGG - Intronic
1095887669 12:47205940-47205962 AAACTCTGCTCTCCAAACGCTGG - Intronic
1096782521 12:53999434-53999456 CAACTCTGCCCCCCAAATCTGGG - Intronic
1097339586 12:58422262-58422284 AAACTCTGATCCTCAATGCTTGG - Intergenic
1099107722 12:78517767-78517789 ATACTCTTATCACCAAAGATGGG - Intergenic
1100141669 12:91626205-91626227 AAACTCTGGACACCAAAGCTAGG + Intergenic
1100372555 12:93981628-93981650 AAACACAGCACCCAAAAGATGGG - Intergenic
1100701150 12:97149603-97149625 AAACTCTGCATACCAAGGATAGG + Intergenic
1102192841 12:111001999-111002021 AAACTCTGATCCCCAAATTTTGG - Intergenic
1103133701 12:118489706-118489728 AAACTCTGCTCCCTGAATACTGG + Intergenic
1103186415 12:118961585-118961607 AAACTTTGCTCCTCAAAGTGTGG + Intergenic
1106521217 13:30499274-30499296 AAATTCTTCGCCCCGAAGATGGG + Intronic
1106623352 13:31393034-31393056 ACACTTTGCTTCACAAAGATAGG + Intergenic
1106656453 13:31752184-31752206 ACACTCTGTTCCACAAAGTTAGG + Intronic
1108200641 13:48039527-48039549 CAACTCTGCCCCCCCAAGACAGG - Intronic
1108702034 13:52952012-52952034 AAAGTCTGGTCACCAAAGCTTGG + Intergenic
1109735492 13:66479146-66479168 AAACCATGCTCTCAAAAGATAGG - Intronic
1112883034 13:104133112-104133134 AAGCTCTGCTCTCCAAAGCAAGG + Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1114000063 14:18227553-18227575 AAACTCTGCTAACAAAAGAAGGG + Intergenic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1117181186 14:53193484-53193506 AAACTCTGCTCCCGAATGCTCGG + Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1119262639 14:73246477-73246499 ACCCTCTCCTCCCCAAAGGTGGG - Intronic
1119694069 14:76698658-76698680 AAACTGTAATCCCCAAAGTTGGG + Intergenic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121809763 14:96874114-96874136 AAAATCTGCTCTCCAAAAACTGG + Intronic
1122737116 14:103849136-103849158 AAACTCTGCTCCCAGAAGAGGGG - Intergenic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1124450014 15:29779428-29779450 AAACCCACCTCTCCAAAGATGGG - Intronic
1125690663 15:41593611-41593633 AAACTCTGCTCCCCCAATGCTGG - Intergenic
1127042318 15:54990797-54990819 AAACTGTGCAACCCACAGATTGG + Intergenic
1127817771 15:62626989-62627011 AAACTCTGCTCCGCTAAAATAGG + Intronic
1128233587 15:66052127-66052149 TAACGCTGCTCCTCAAAGAGAGG + Intronic
1128907227 15:71477946-71477968 CAATTCTGGTCCCCAAGGATGGG + Intronic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131776267 15:95802580-95802602 AACCTAAGCTCCCCAAAGAGGGG + Intergenic
1135383400 16:22012809-22012831 AAACTCTGCTGTCCAAAGTATGG - Intronic
1136489752 16:30599231-30599253 AAACCCTGCACCCTAAAGCTTGG - Intergenic
1137453261 16:48597110-48597132 AAACTCTGATCCCCGAATATGGG + Intronic
1137697577 16:50472232-50472254 CCACTCTCCTCCCCAGAGATTGG - Intergenic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1138767424 16:59621146-59621168 AGACTCTTCTTCCCAAATATGGG - Intergenic
1139353950 16:66355998-66356020 AAAAGCAGCTGCCCAAAGATGGG - Intergenic
1140601045 16:76475264-76475286 AAACTCTGCTCCCCAAAGATAGG + Intronic
1140688921 16:77462688-77462710 AAACTCTTCTCCCTAGAGAAGGG + Intergenic
1141386421 16:83625909-83625931 AAACACTGCACCCCAAAGTCAGG + Intronic
1143605451 17:7982266-7982288 AAACTCTGATCCCCAAAGGCAGG - Intergenic
1144316102 17:14062997-14063019 TAACCCTGCTCACCAAAGTTAGG - Intergenic
1144575627 17:16427787-16427809 AGACTCTGCTCCCCCAGGAATGG + Intronic
1149103753 17:52937357-52937379 AAACTCTGATCCCCAAGGCCTGG + Intergenic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1151498870 17:74476063-74476085 AAACTCTGGACACCAAAGCTTGG - Intronic
1151773279 17:76178792-76178814 AACCTCTGCTCCCTAAAACTTGG - Intronic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1152235089 17:79134548-79134570 AGACTCTGCTCCTCAAAGTCTGG + Intronic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1155506811 18:26541431-26541453 AAATTCTGTTACCCAAAGCTTGG + Intronic
1155841056 18:30643225-30643247 AATCTCTGCTCCTTAAATATGGG + Intergenic
1156262905 18:35461204-35461226 AAACTGAGGTCCCCAAAGAGAGG - Intronic
1156300042 18:35828325-35828347 CAAATCGCCTCCCCAAAGATGGG - Intergenic
1156918124 18:42485593-42485615 AAAATCTGCTCCGCCAAGGTGGG + Intergenic
1157407943 18:47439182-47439204 TAACTCTCCTACCCCAAGATTGG - Intergenic
1157494490 18:48145513-48145535 AAAGTCTCCTCCACAAATATTGG + Intronic
1158933157 18:62340608-62340630 AAATTCTGCTGCCAAAAGTTAGG - Intronic
1159209916 18:65305383-65305405 ACACTCTGCTCCCCACTGCTGGG + Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1161523654 19:4739764-4739786 AACCTCTGGACCCCAAAGCTTGG + Intergenic
1163094653 19:15048087-15048109 AAATTCTCCTCCCCAAAAATAGG + Intergenic
1167592323 19:50410753-50410775 AAACCCTGGACCCCAAAGCTTGG - Intronic
1168694696 19:58397614-58397636 CAGCTCTGCCCTCCAAAGATAGG - Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
928030987 2:27778987-27779009 AACCTCTACTTCCCAGAGATGGG - Intronic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
929948377 2:46387852-46387874 CAACTCTGCTCCTGAAGGATGGG - Intergenic
932877243 2:75465723-75465745 AATCACTGCTCCCTAAACATGGG + Intergenic
933396054 2:81732705-81732727 AAACTCTGCAGCCCAGACATTGG + Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
937317240 2:120939438-120939460 AAACTCTGAATCCCAAAGAATGG - Intronic
937927816 2:127181703-127181725 ACACTCTCCCCACCAAAGATTGG - Intergenic
940094845 2:149962741-149962763 AAACTGTGCAACCCACAGATTGG - Intergenic
940642701 2:156363611-156363633 AAACTCTACAACTCAAAGATAGG + Intergenic
940878129 2:158918899-158918921 AAATTCATCTCCCCAAAGATGGG - Intergenic
941872271 2:170398478-170398500 CCTCTCTGCTCCCCAGAGATTGG + Intronic
943703589 2:191012620-191012642 AGCCTCTGCTGCCCACAGATTGG + Intronic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
946411371 2:219516896-219516918 AAGCACTGCTCCCCAAAGCAAGG + Intronic
946734243 2:222738834-222738856 AAACTTTGATCCCCAAATGTTGG - Intergenic
946883471 2:224199459-224199481 AAATTCTGCTCAACACAGATGGG + Intergenic
947520027 2:230838454-230838476 AAACTCTGCTCCCCGAATGCTGG + Intergenic
1169802230 20:9522079-9522101 AACCTCTGATACCCAAAGACAGG - Intronic
1170744220 20:19084355-19084377 AAATCCTGATTCCCAAAGATAGG - Intergenic
1171430255 20:25078835-25078857 AAACTGAGCTCCCCGAAGACCGG - Exonic
1173658696 20:44718447-44718469 AAACTTGGCCCCCCAAAGATGGG + Intronic
1174854599 20:54031421-54031443 AAGCTCTGCTCTCCAAATTTAGG + Intronic
1175790347 20:61736739-61736761 CAATTCTGCTCCCCTAAGAAGGG - Intronic
1176515744 21:7782003-7782025 CAACTCGGCTCCCCAAGGCTGGG - Intergenic
1178649772 21:34412015-34412037 CAACTCGGCTCCCCAAGGCTGGG - Intergenic
1179092486 21:38279718-38279740 TGACTCTGCTCCCCAAAGCTTGG + Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179639424 21:42737539-42737561 AACCTCTGCCCCCCGAAGACAGG + Intronic
1180424526 22:15157326-15157348 AAACTCTGCTAACAAAAGAAGGG + Intergenic
1181898457 22:26131940-26131962 AATCTCTGCTCACCAAGGACAGG - Intergenic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
951749008 3:26013152-26013174 AATCTCCTCTCCCCTAAGATAGG - Intergenic
954239683 3:49283797-49283819 AGAGTCTCTTCCCCAAAGATGGG + Intronic
954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG + Intronic
954686638 3:52373891-52373913 AAATTCTGCTCCCGTAGGATTGG - Intronic
955103249 3:55872417-55872439 AAAGTCTGTTCTCCAAATATAGG + Intronic
955329621 3:58036348-58036370 AAACTCTGATCCCAAATGCTCGG - Intronic
956869136 3:73399308-73399330 AAACACTGCTCTCCAAACAGAGG - Intronic
957178396 3:76843302-76843324 AAACTCTGCTTCCAGAAGAAGGG + Intronic
957311175 3:78520742-78520764 AAACTCAGCTCAACAAATATAGG - Intergenic
958422793 3:93947421-93947443 AAAAACTGCTCCCTAAAGATAGG + Intronic
958813883 3:98894488-98894510 AAGCTCTGCTCCCCTCAGATGGG - Intronic
961865878 3:129953142-129953164 TAACTCTGCTTCTCAGAGATGGG - Intergenic
962556689 3:136559763-136559785 AAACTCAGCCTCTCAAAGATAGG - Intronic
962895181 3:139707548-139707570 AAACTCAGCTTCCCAATGATAGG - Intergenic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
963842019 3:150117401-150117423 AAACTCTGCTGCTCTAAGACAGG + Intergenic
964035536 3:152192140-152192162 AATTTCTGCTCCCAAAATATAGG - Intergenic
964250523 3:154711052-154711074 AATCTGTGCTCCTCAAAGACAGG - Intergenic
965443794 3:168749503-168749525 AAGCTCTGCTCCTGGAAGATAGG - Intergenic
965659643 3:171028116-171028138 CAAAGCTGCTCCCCAAAGCTTGG - Intergenic
965882691 3:173405756-173405778 AGAGTCTGCTCCCCAGACATCGG - Intronic
968146469 3:196303249-196303271 AAACTCTGCTCCCCGAATGCTGG + Intronic
968151894 3:196343551-196343573 AAACTCTGCTCCCCGAATGCTGG - Intergenic
969445059 4:7240005-7240027 AAGCTCTGCTCTCCACAGAAGGG + Intronic
969844770 4:9911689-9911711 AATCTCTGTTCTCCAAAGAAAGG + Intronic
970040132 4:11787089-11787111 AATCTCCACTCCCCAGAGATGGG + Intergenic
970969415 4:21964135-21964157 CAGCTCTGGTCCCCAAAGAAAGG - Intergenic
971853107 4:32010048-32010070 GAACTATGCAACCCAAAGATCGG + Intergenic
972657487 4:41078824-41078846 AAACTCTGTTCCCCTATGTTTGG + Intronic
972671708 4:41218686-41218708 AAATTATGGTCCCCAAATATAGG + Intergenic
974791013 4:66689561-66689583 AAACTGTGATGCCTAAAGATAGG - Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
976889842 4:90033138-90033160 CATCTCTCCTCCCCAGAGATTGG + Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978389509 4:108210280-108210302 ACTCCCCGCTCCCCAAAGATGGG + Intergenic
979142880 4:117200956-117200978 CAACTCTGGTACCCAAGGATAGG + Intergenic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
981696364 4:147563195-147563217 AAACTCTGCTCCCCAAATGCTGG - Intergenic
981844335 4:149150355-149150377 AACCAATGCTCACCAAAGATAGG - Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
986799645 5:11246142-11246164 AAAGTCAGCTCCCCAAGAATAGG - Intronic
987045994 5:14108835-14108857 AATCTCTGCTCACCAAAGCACGG + Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988272124 5:29031096-29031118 AAACCCTGGTCCCCAAAGAAGGG + Intergenic
988941300 5:36151124-36151146 AAACTCTTCTCAGCAGAGATAGG + Intronic
990446779 5:55900498-55900520 GAACTCTTCTCCCCACAAATGGG + Intronic
991249825 5:64547362-64547384 AAATTCTTCTCACCAAAGCTTGG + Intronic
991301531 5:65133411-65133433 AACCTCTCCTCCTCAAAGATGGG + Intergenic
992956694 5:81917109-81917131 ACACTATGATCCCAAAAGATAGG + Intergenic
993089194 5:83402921-83402943 AGACTGTGGTCCCCAAAGAAAGG + Intergenic
993362528 5:86995967-86995989 TAACTCTACTCTCCTAAGATTGG + Intergenic
994162772 5:96575476-96575498 AAACGCTTTTCCCCCAAGATCGG - Intronic
994522828 5:100863091-100863113 AAATCCTCCTCCCCAAAGGTAGG + Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995480193 5:112585659-112585681 AAACTCTGCCACCCAAGTATGGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996675631 5:126171919-126171941 GAACTATGCAACCCAAAGATCGG + Intergenic
997534220 5:134604527-134604549 GAACTCTGCCCCCTAAAGCTGGG + Exonic
997634706 5:135396722-135396744 AAAGTCAGCTCCCCCAAGGTAGG + Intronic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
998696945 5:144651728-144651750 AAACTCTACGCCCCAAATTTGGG + Intergenic
1001134830 5:169093591-169093613 AAACTCTGCTTCCCATAAGTTGG - Intronic
1001205459 5:169758348-169758370 AATCTCTCCTCCCCAGAGAGGGG - Intronic
1001314473 5:170632658-170632680 AAAATGTGATGCCCAAAGATGGG + Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1001961351 5:175882058-175882080 AGGCCCTGCTCCCCAAAGAAGGG - Exonic
1002362678 5:178685755-178685777 TAACTCTGCTCCCTGGAGATTGG + Intergenic
1002552019 5:180001733-180001755 CAGCTCTGCTCCCCTAAGCTAGG - Intronic
1003349427 6:5302138-5302160 GAGCTCTGCTCCCCTAAGTTTGG + Intronic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004306233 6:14504273-14504295 AACCTCTTTTCCCCAAAGCTAGG + Intergenic
1004390218 6:15203687-15203709 AAACTCTGCTCCCCAATTCAGGG - Intergenic
1004428611 6:15523517-15523539 AAGGACTGCTCCTCAAAGATAGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1005912408 6:30322630-30322652 AAACTCTGCTCCCCCGTGCTCGG - Intergenic
1007406310 6:41638048-41638070 AATCTCTTTGCCCCAAAGATGGG - Intronic
1007466919 6:42058999-42059021 AAACTCTGCTCCCCGAATGCTGG - Intronic
1008939580 6:57031732-57031754 AAACTCTGATCCCGAATGCTCGG + Intergenic
1011239138 6:85252353-85252375 AAACCCACCTCCCCAAAGATGGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1015514921 6:134074051-134074073 AAACACTGCTCCCCAAAAGCTGG + Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG + Intronic
1022211897 7:28219010-28219032 GAACTCTGCACCCAAAAGATGGG - Intergenic
1022674640 7:32487626-32487648 AATCACTGCTCCCCAAAAATGGG + Intronic
1023209262 7:37785461-37785483 AATCTCTGCTCCTGAAAGAATGG - Intronic
1024583853 7:50823978-50824000 TAACTGTGTCCCCCAAAGATAGG - Intergenic
1028676434 7:93468518-93468540 ATCCTGTTCTCCCCAAAGATAGG + Intronic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1032863794 7:135905826-135905848 CATCTCTGCTCTTCAAAGATGGG - Intergenic
1034587098 7:152103457-152103479 AAACTATGCTACCCAAATTTGGG + Intronic
1037465315 8:19154028-19154050 AAACTCTGATCCCCAAATGCTGG + Intergenic
1038587215 8:28800760-28800782 TAACTCTGTTCCCCAAAGTAGGG + Intronic
1039959324 8:42233719-42233741 AAACTCTGCTCCCGACTGCTGGG - Intergenic
1042623061 8:70727383-70727405 AAACTCTGATCCCCAAATGCTGG - Intronic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1043453693 8:80393250-80393272 CAACTCTCTTCTCCAAAGATGGG - Intergenic
1043656977 8:82679918-82679940 ATTCTCTACTCCTCAAAGATGGG + Intergenic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1044135903 8:88584933-88584955 AAACTGTGCAACCCACAGATCGG - Intergenic
1045690827 8:104758260-104758282 AAACTCTGCTCCCCGAGGCCGGG - Intronic
1045823730 8:106372169-106372191 AAACTGTGCTACCCACAGATTGG - Intronic
1047617478 8:126574495-126574517 ACACATTGATCCCCAAAGATGGG + Intergenic
1048605863 8:135968336-135968358 AAACCCAGCTCCCCAAGGAAAGG + Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050934858 9:11382846-11382868 AAAGTATGTTCCCCAAAGTTGGG + Intergenic
1052784532 9:32816173-32816195 AAAAGCTGCTCTCCAAAGAGTGG + Intergenic
1052802370 9:32981081-32981103 AAACACTGTTCTCCAAAGCTAGG - Intronic
1052968757 9:34363539-34363561 AGCCTCTACTCCCCAAACATAGG - Intergenic
1053900629 9:42792672-42792694 AAACTCTGATCCCAAACGCTCGG - Intergenic
1054239426 9:62597043-62597065 AAACTCTGATCCCAAACGCTCGG - Intergenic
1054553557 9:66631570-66631592 AAACTCTGATCCCAAACGCTCGG - Intergenic
1057361284 9:94375368-94375390 AAACTCTGCTCCCCATCGCTAGG - Intronic
1057662081 9:97012801-97012823 AAACTCTGCTCCCCATCGCTAGG + Intronic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1057999442 9:99850147-99850169 AAACTCTGCTCCCCTCACCTAGG - Intronic
1058136502 9:101313564-101313586 AAACTCTTCTCCAGGAAGATAGG - Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1059741883 9:117159476-117159498 AAGCTCAGCTCCCCACACATGGG - Intronic
1061692133 9:132341732-132341754 AAACTCTGCACTCCAAACAAGGG - Intronic
1061932451 9:133840232-133840254 AAACTCTGCTTCCCGAAGCCGGG - Intronic
1186115553 X:6301740-6301762 AAACTCTGCTCCCCAGTGCTCGG - Intergenic
1186635586 X:11400811-11400833 AAACTCAGACCCCCAAATATTGG - Intronic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1191638282 X:63401717-63401739 AAACTCTGCTCCCCACATTTTGG - Intergenic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic