ID: 1140601215

View in Genome Browser
Species Human (GRCh38)
Location 16:76477275-76477297
Sequence CAGTTGTTCTGGCGCACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1140601211_1140601215 -4 Left 1140601211 16:76477256-76477278 CCCATGTTATTTCATTGTCCAGT 0: 1
1: 0
2: 0
3: 56
4: 5306
Right 1140601215 16:76477275-76477297 CAGTTGTTCTGGCGCACAAATGG 0: 1
1: 0
2: 0
3: 5
4: 62
1140601212_1140601215 -5 Left 1140601212 16:76477257-76477279 CCATGTTATTTCATTGTCCAGTT 0: 1
1: 0
2: 5
3: 426
4: 6142
Right 1140601215 16:76477275-76477297 CAGTTGTTCTGGCGCACAAATGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1140601215 Original CRISPR CAGTTGTTCTGGCGCACAAA TGG Intronic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
917545013 1:175956294-175956316 CAGTTGTTTTAGCACACATATGG - Intronic
917849057 1:179044455-179044477 CAGGTGTTCTGGGGCAGAGAGGG - Intronic
919075696 1:192809852-192809874 CACTATTTCTGGCTCACAAAGGG - Intronic
920971957 1:210750451-210750473 GAGTTTATCTGGGGCACAAAGGG + Intronic
921830663 1:219724541-219724563 CAATTGGGCTGGCTCACAAATGG - Intronic
1066710055 10:38223739-38223761 CATTAGTTCTGGGGCCCAAAAGG - Intergenic
1066979956 10:42403715-42403737 CATTAGTTCTGGGGCCCAAAAGG + Intergenic
1072325975 10:94299027-94299049 CAGTTGTTCTTGCAGTCAAAAGG + Intronic
1080846025 11:36027723-36027745 CAGTTGTTCTTGGGCACAAGGGG + Intronic
1081690362 11:45073916-45073938 TAGTTGTTCTGGCCCATAATTGG - Intergenic
1081725096 11:45322444-45322466 CAGTGCTTCTGGAGCACCAAGGG + Intergenic
1084657308 11:70527097-70527119 CTGGTGTTCTGACCCACAAACGG + Intronic
1087382425 11:97423594-97423616 CAATTGTTCTGGGGAACAAATGG - Intergenic
1087599628 11:100296717-100296739 CAGTTTTTCTGGTGTATAAAAGG + Intronic
1090829089 11:130408604-130408626 CAGTGTTTCTGGCCCACACAGGG + Exonic
1104669076 12:130668046-130668068 CAGTTGTTCAGAAGCACAAGTGG + Intronic
1104798457 12:131536593-131536615 AGCTTGTTCTGGCGCACACACGG + Intergenic
1106309723 13:28543568-28543590 CAGTTGCTCTGGAACATAAATGG - Intergenic
1114259299 14:21025593-21025615 CAGGTGTGCTGGCGCCGAAAGGG + Intronic
1121680657 14:95790342-95790364 CAGTTGATCTGGCTTTCAAAAGG + Intergenic
1140093697 16:71857407-71857429 CAGTTGTAATGGAACACAAATGG + Intronic
1140601215 16:76477275-76477297 CAGTTGTTCTGGCGCACAAATGG + Intronic
1148509401 17:48155883-48155905 CAGTGGTGCTGGTCCACAAAAGG + Intronic
1152162278 17:78676251-78676273 CAGGTGTTCTGGGGCACGAGGGG - Intronic
1161188823 19:2941572-2941594 AAGTTTTTCTGTCCCACAAAGGG + Intronic
1164409623 19:27990034-27990056 CAGTAGTTCTGGGGCCCAAGAGG - Intergenic
927368781 2:22330435-22330457 CAGTTTTTCTGTAGCACAAAAGG + Intergenic
929551710 2:42897462-42897484 CAGTAGGTCTGGCCCACAAGAGG + Intergenic
930403267 2:50919233-50919255 GAGTTGTTATGGAGCACAGAAGG + Intronic
930865782 2:56120785-56120807 CAGATGTTCTGGGGGAGAAAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
937515074 2:122644109-122644131 AAGCTGTTCTGACTCACAAATGG + Intergenic
939622762 2:144440608-144440630 CAATTGTTCTGGCCAAAAAATGG - Intronic
941041689 2:160630236-160630258 CAGTTGGTCTGTGGCAGAAAGGG - Intergenic
946604810 2:221391995-221392017 CAGTGGTTTTGGAGCGCAAAGGG - Intergenic
1181292544 22:21807772-21807794 CAGTAGGTCTGGTGCTCAAAGGG + Exonic
953854303 3:46489135-46489157 CAGTGGCTCAGGCGCTCAAAAGG + Intergenic
964186639 3:153953188-153953210 CATTTGTTCTGGCCAAAAAATGG - Intergenic
965571767 3:170180970-170180992 CAGCAGTTCTGGTGCACAAGAGG + Intronic
967955039 3:194871576-194871598 CAGTTGTTCTGACTCACAGGAGG + Intergenic
970966029 4:21928948-21928970 GAGTTGTTCTGGGGCAGAGATGG - Intronic
972619340 4:40732015-40732037 CAGTTGTTGGAGCTCACAAAAGG + Intergenic
976285890 4:83370759-83370781 AAGGTGCTCTGGAGCACAAATGG - Intergenic
978953129 4:114585220-114585242 CAGTTGTTCTGGGGTAAAAAAGG + Intergenic
980496775 4:133595393-133595415 CAGTTGTATGGGTGCACAAATGG + Intergenic
987516299 5:18914986-18915008 CAGTTGCTCTGAGGAACAAAAGG - Intergenic
999255206 5:150206150-150206172 CACTTCTGCTGGCCCACAAAGGG - Intronic
1001350454 5:170958107-170958129 GAGTTGTTCTGAGGCACAAGTGG - Intronic
1002441073 5:179264846-179264868 CTGTTGTTCTGGCTCACTAAGGG - Intronic
1008391440 6:50956637-50956659 CGTTTGTTCAGGCCCACAAAGGG + Intergenic
1010478315 6:76317526-76317548 CAGTTGTTTTTGCAAACAAATGG + Intergenic
1013393627 6:109712779-109712801 CAGTTGTTTTGGAGGAAAAAAGG + Intronic
1021408067 7:20297349-20297371 TAGTTTTTCTGGCTCTCAAAAGG + Intergenic
1024184056 7:46930532-46930554 CAGATGCTCTGCCGCACACAAGG + Intergenic
1034971175 7:155420248-155420270 CAGTTGTGCTGGGGCCCAAGAGG - Intergenic
1036212555 8:6854149-6854171 CAGCAGTTCTGGGGCACAGAGGG + Intergenic
1041971463 8:63747597-63747619 CAGTTGGTCAGGAGCTCAAATGG - Intergenic
1044847626 8:96397811-96397833 CAGTTGGTCTGGGGATCAAATGG - Intergenic
1046311824 8:112447706-112447728 CAGTTATTTTTGTGCACAAATGG - Intronic
1048070029 8:131011702-131011724 CAGGTGTTGTGTCGGACAAAGGG + Intronic
1052201250 9:25783900-25783922 CAGTTGTTCTGGAACTTAAATGG - Intergenic
1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG + Intronic
1059289848 9:113212985-113213007 CAGTGGTCTTGGAGCACAAAAGG - Intronic
1059742409 9:117164814-117164836 CAGGTGTTCAGGAGGACAAATGG + Intronic
1187857934 X:23655056-23655078 CAGTTGTGCTGGAGGACAAGGGG - Intergenic
1191877867 X:65814056-65814078 CAGTTGTGGTGGAGGACAAAGGG - Intergenic
1200896689 Y:8383301-8383323 GAGTTGTTCAGGCGCATATATGG - Intergenic